Application of EcorOBP7 in combination with odor information molecules
By combining odor information molecules, recombinant vectors and host cells were prepared to regulate the foraging and egg-laying behavior of giant ash hoverflies, solving the problems of regulation difficulties in the existing technology, achieving effective regulation of the behavior of giant ash hoverflies, and improving the effects of agricultural production and environmental protection.
Patent Information
- Application Number
- CN202510393535.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-07-04
AI Technical Summary
The existing technology lacks effective strategies to regulate the foraging, laying and mating behavior of large ash hoverflies, affecting agricultural production and environmental protection.
Using EcorOBP7 to combine odor information molecules, insect behavior is regulated by preparing recombinant vectors and host cells, including identifying aphid behaviors, foraging behaviors and egg-laying behaviors.
As a broad-spectrum binding protein, EcorOBP7 can interact with a variety of information molecules, regulate the foraging and egg-laying behavior of giant ash hoverflies, and improve agricultural production efficiency and environmental protection effects.
Smart Images

Figure CN120249292A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to the application of EcorOBP7 in binding odorant molecules. Background Art
[0002] Hoverflies are important economic insects distributed globally. Adult hoverflies have the habit of visiting flowers and are one of the largest pollination media for entomophilous pollination. The latest research finds that, compared with bees collecting pollen and taking it back to the hive, the habits of hoverflies visiting flowers and hovering carry pollen over a wider range and farther distance, and have a stronger pollination effect. In addition, the larvae of saprophagous hoverflies play roles in decomposing organic waste and loosening soil in humus; the larvae of predatory hoverflies feed on aphids and are the main natural enemies of aphids, and even the only natural enemies of aphids on some crops. As the main natural enemies of aphids and the main pollinating insects of crops, and with a wide variety of species and a long activity time, hoverflies have important economic value for agricultural production and environmental protection.
[0003] Eupeodes corollae is a kind of hoverfly, belonging to the genus Eupeodes of the family Syrphidae in Diptera. In early spring, when conducting surveys on predatory hoverflies in wheat fields in Shandong, Henan and other regions where wheat is the main crop, it shows that Eupeodes corollae can account for more than 90% of the larvae of predatory hoverflies. Wheat aphids feed on wheat juice and the pulp of wheat ears, and seriously affect the yield and quality of wheat by spreading viruses and secreting honeydew and other means. Eupeodes corollae has become a dominant variety among predatory hoverflies due to its large egg-laying amount and large number of aphids consumed, and has important economic value. At the same time, the adult Eupeodes corollae has the characteristics of small size and flower-visiting behavior, making it have ecological value that cannot be replaced by many anemophilous and other insect pollination media.
[0004] Eupeodes corollae selects the oviposition site and foraging host plants, both of which are induced by external odor molecules. Eupeodes corollae makes a series of behaviors such as foraging, oviposition, and mating after receiving external information. In order to regulate the foraging, oviposition and mating behaviors of Eupeodes corollae, there is an urgent need to provide a new strategy for the interaction between Eupeodes corollae and odorant molecules. Summary of the Invention
[0005] In order to regulate the foraging, oviposition and mating behaviors of Eupeodes corollae, the present invention provides the application of EcorOBP7 in binding odorant molecules.
[0006] The technical solution adopted by the present invention is:
[0007] The first aspect of the present invention provides an application of EcorOBP7 in binding odorant molecules, wherein the nucleotide sequence of EcorOBP7 is as shown in SEQ ID NO.1; the odorant molecules include at least one of (E)-β-farnesene, (E)-β-myrcene, 3-methylbutanal, (Z)-β-ocimene, linalool, and cis-acetamidate.
[0008] The second aspect of the present invention provides a recombinant vector containing the above-mentioned EcorOBP7.
[0009] The third aspect of the present invention provides a method for preparing the recombinant vector, comprising the following steps:
[0010] Extract RNA from Eupeodes corollae, use the obtained cDNA by reverse transcription as a template, and PCR amplify to obtain EcorOBP7; perform enzyme digestion on EcorOBP7 and the expression vector respectively; ligate the digested EcorOBP7 with the expression vector to obtain the recombinant vector.
[0011] Preferably, the expression vector is a pET series vector.
[0012] Preferably, the pET series vector includes any one of pET28a, pET22b, and pET32a.
[0013] The fourth aspect of the present invention provides a host cell containing the recombinant vector.
[0014] The fifth aspect of the present invention provides an application of the recombinant vector or the host cell in regulating the behavior of insects, and the behavior includes any one of aphid recognition behavior, foraging behavior, and oviposition behavior.
[0015] Preferably, the insect is Eupeodes corollae.
[0016] The sixth aspect of the present invention provides a biological pesticide, and the biological pesticide includes any one of the above-mentioned EcorOBP7, the recombinant vector, or the host cell.
[0017] The seventh aspect of the present invention provides an odorant molecule detection kit based on EcorOBP7, and the odorant molecule detection kit includes the above-mentioned EcorOBP7 and N-phenyl-1-naphthylamine.
[0018] Compared with the prior art, the beneficial effects of the present invention are:
[0019] The present invention provides an application of EcorOBP7 in binding odorant molecules. The nucleotide sequence of EcorOBP7 is shown as SEQ ID NO.1; the odorant molecules include at least one of (E)-β-farnesene, (E)-β-myrcene, 3-methylbutanal, (Z)-β-ocimene, linalool, and cis-acetamidoacetate. The present invention discovers that EcorOBP7 is a broad-spectrum binding protein that can interact with multiple odorant molecules, and it can strongly bind to substances such as (E)-β-farnesene and cis-acetamidoacetate. Eupeodes corollae can perceive odor molecules in the environment through highly expressed EcorOBP7 on its antennae. Female insects can find suitable hosts and oviposition sites by distinguishing volatile substances of plants, and male insects can also find female insects for mating by perceiving sex pheromones, indicating that this protein can also regulate the foraging and oviposition behaviors of Eupeodes corollae.
[0020] The present invention selects the gene with the highest transcriptome abundance for in-depth exploration, uses real-time fluorescence quantitative PCR to detect its expression in various adult tissues and different larval instars, and finds that this protein is closely related to the preference for aphids in the life activities of Eupeodes corollae. To further verify the possibility of the existence of this protein, the protein is expressed in prokaryotes, verified by western-Blot, and then the binding characteristics of EcorOBP7 with multiple odorant molecules are analyzed using fluorescence competition binding assay. The results of the fluorescence competition binding assay show that the odorant binding protein EcorOBP7 of Eupeodes corollae has the ability to bind to multiple odor molecules, indicating that this protein may regulate the foraging and oviposition behaviors of Eupeodes corollae. Description of the Drawings
[0021] Figure 1 Shows the expression levels of EcorOBP7 in various tissues of male and female adults.
[0022] Figure 2 Shows the expression of EcorOBP7 in different larval instars.
[0023] Figure 3 Is the colony PCR of pEASY-EcorOBP7.
[0024] Figure 4 Is the prokaryotic expression of EcorOBP7.
[0025] Figure 5 Is the purification of the recombinant EcorOBP7 protein.
[0026] Figure 6 Is the immunoblot identification of the recombinant EcorOBP7 protein.
[0027] Figure 7 Is the BSA protein standard curve.
[0028] Figure 8 It is the binding curve of EcorOBP7 and 1-NPN.
[0029] Figure 9 It is the binding curve of EcorOBP7 and odor ligand molecules. Specific embodiments
[0030] The present invention will be further described below through specific embodiments, but it does not limit the scope of the present invention. Modifications or substitutions can be made to the details and forms of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but these modifications or substitutions all fall within the protection scope of the present invention.
[0031] The inventive concept of the present invention is as follows:
[0032] The present invention provides an application of EcorOBP7 in binding odor information molecules, wherein the nucleotide sequence of the EcorOBP7 is shown as SEQ ID NO.1; the odor information molecules include at least one of (E)-β-farnesene, (E)-β-myrcene, 3-methylbutyraldehyde, (Z)-β-ocimene, linalool and cis-acetamidoacetate.
[0033] Among them, (E)-β-farnesene (EBF) is the main or only component of aphid alarm pheromone, and at the same time is an important pheromone for aphid natural enemies to identify aphids, and plays a very important role in the interaction relationship among the multi-trophic cascades of plants-aphids-Euphorpha formosa. The fluorescence competition binding experiment verified the structure of the odor binding protein and the main mechanism of recognizing (E)-β-farnesene by detecting the binding ability of the odor protein and (E)-β-farnesene.
[0034] The change of Euphorpha formosa to the host plant is induced by the change of odor molecules in the environment, which has to rely on the highly developed olfaction of insects. In the olfactory system, odor proteins play roles such as solubilization buffer and co-activating the electrophysiological response of receptor neurons with odor molecules because of their small size, strong hydrophilicity and good stability. Odor molecules need to be recognized by odor proteins to be transported through the hydrophobic lymph to the nerve dendrites for the next reaction. The specific recognition of odor molecules by odor proteins is closely related to the structure of odor proteins.
[0035] Through the clustering analysis of the odorant protein genes of Eupeodes corollae, it is found that EcorOBP7 has a high similarity with EbalOBPs of Episyrphus balteatus, but only a moderate homology with DmelOBPs of Drosophila melanogaster. It is speculated that this is because Eupeodes corollae EcorOBP7 and Episyrphus balteatus belong to predatory hoverflies and have similar activity environments, while their foraging differences from Drosophila melanogaster are large. The differential expression of EcorOBP7 in different tissues of adults and different stages of larvae further verifies that EcorOBP7 plays a certain role in the life activities of Eupeodes corollae.
[0036] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below with reference to specific embodiments. In the description of the present invention, unless otherwise specified, the reagents used are commercially available, and the methods used are conventional techniques in the art.
[0037] Example 1
[0038] The application of EcorOBP7 in binding odorant information molecules is as follows:
[0039] The present invention spliced the antenna transcriptome of Eupeodes corollae, and screened out multiple high-abundance transcripts similar to OBP genes. On this basis, the coding regions of 8 OBP genes were cloned and named EcorOBP1 - EcorOBP8 in sequence. Sequence analysis showed that the encoded proteins of these 8 genes all possess the characteristics of classical odorant proteins, including six conserved cysteine sites, and a signal peptide composed of 14 - 24 amino acids at the N-terminus.
[0040] Subsequently, EcorOBP7 with the highest expression abundance in the antenna transcriptome was selected, and its tissue expression profile in adult Eupeodes corollae was analyzed using real-time quantitative PCR technology. The results showed that the transcriptional level of EcorOBP7 was relatively high in the abdomen and wings. Through in vitro recombinant expression technology, the coding sequence of the EcorOBP7 gene was introduced into Escherichia coli for induced expression, and the recombinant protein was obtained after nickel column affinity chromatography. Western blot confirmed the successful expression of the target protein. The nucleotide sequence of EcorOBP7 is shown in SEQ ID NO.1.
[0041] SEQ ID NO.1:
[0042] attgaaattccagaacacctaaaggcacatgctaagagattacacgatagatgtcaaaaggaaattggtgttgatgaggcgctaattgctcaaagcaacaatgggaacttaccaaatgatagaaaattacagtgttacattcattgcttgttccaaaaaactggattgattgatgaaaacaacattattcatctggaacatatgattgagattcttccaacagaaatgcaggagattatcgaaagattaatttcatcatgcgggacaaaacacggagcagatccttgtgaaactgcatatctaacagtcaaatgctatttcgatgcagatcctgagaattcaatgttgatatag。
[0043] Finally, the binding characteristics of EcorOBP7 with various odorant molecules were analyzed by fluorescence competition binding experiments. The results showed that EcorOBP7 is a broad-spectrum binding protein that can interact with various odorant molecules. Among them, EcorOBP7 can bind strongly to (E)-β-farnesene, cis-acetamidoacetate and other substances.
[0044] 1. Expression profile analysis of EcorOBP7 in different tissues of Eupeodes corollae.
[0045] The expression levels of EcorOBP7 in different tissues of adult Eupeodes corollae of different genders were analyzed by real-time fluorescence quantitative PCR. The results showed that the expression levels of EcorOBP7 in various tissues of male insects tended to be balanced, which was comparable to that in the antennae of female insects. The expression levels in the abdomen and wings of female insects were relatively high, which were 5-6 times that of the corresponding tissues of male insects. The expression level in the feet of female insects was low, about one-fourth of that in various tissues of male insects. The expression level in the antennae of female insects was about twice that of male insects. The above results are shown in Figure 1 The expression level of EcorOBP7 in the first instar larvae was higher than that in the third instar larvae, about four times that of the third instar larvae. The results are shown in Figure 2 。
[0046] 2. Amplification results of the signal peptide-free coding region of EcorOBP7.
[0047] Cloning of the EcorOBP7 gene from Eupeodes corollae: Using the total RNA from the head of Eupeodes corollae as a template for reverse transcription, and then using the cDNA obtained from reverse transcription as a template, specific primers containing restriction enzyme sites and protection bases were designed with an online program software to amplify the CDS region gene sequence of the signal peptide-free EcorOBP7 from Eupeodes corollae. The results showed that there was an obvious single band at around 450 bp in the PCR product, which was basically consistent with the expected 417 bp. After cutting and recovering the target band consistent with the expectation, it was ligated to PEASY-T1 and transformed into Dh5α competent cells. Positive colonies were selected for PCR detection, and the detection results were consistent with the target gene band, as shown in Figure 3 , and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, showing that the inserted fragment was correct without any base mutations.
[0048] 3. Construction of the recombinant vector pET-EcorOBP7.
[0049] Using the recombinant plasmid PEASY-T1-EcorOBP7 with correct sequencing and no base mutations as a template, amplification was carried out with restriction enzyme primers. The amplification result had no impurity bands and could be directly purified and recovered. After recovery, a restriction enzyme digestion reaction was carried out with restriction enzymes, and then the EcorOBP7 fragment containing restriction enzyme sites was purified. The expression vector pET-28a plasmid was extracted, and both PEASY-T1-EcoOBP7 and the expression vector pET-28a were double-digested with BamHⅠ and XhoⅠ. The target fragments and vectors after digestion were purified and recovered. The recovered EcorOBP7 fragment and the vector were ligated, and the recombinant plasmid was named pET28a-EcorOBP7. The recombinant plasmid pET28a-EcorOBP7 was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. The sequencing results showed 100% consistency with the constructed vector sequence, without any base mutations, and were consistent with the simulated constructed plasmid PETa-EcorOBP7. It indicated that the recombinant vector PET28a-EcorOBP7 was successfully constructed. To ensure the expression of PET28a-EcorOBP7, the start codon ATG was added to the initial upstream primer sequence; because the odor protein EcorOBP7 has a relatively small protein molecule, in order to obtain a higher protein yield after prokaryotic expression and purification and recovery, the sequence corresponding to the stop codon TAA was removed from the downstream primer, so that his Tags at both ends of the inserted fragment of PET28a-EcorOBP7 were expressed.
[0050] 4. Induced expression and purification of the fusion protein.
[0051] The successfully constructed plasmid vector pET28a-EcorOBP7 was transformed into BL21(DE3), and the positive transformants were screened by coating. After removing the signal peptide sequence fragment, EcorOBP7 encodes 127 amino acid residues, about 13.35 kDa, and forms a fusion protein encoding 160 amino acids with pET-28a. Among them, 33 amino acids including two consecutive six-histidine tags and one T7 tag are encoded by the vector nucleotides, and the theoretical molecular weight is 18.09 kDa. The SDS-PAGE electrophoresis diagram shows that, see Figure 4 , the fusion protein is expressed in the form of inclusion bodies, and the expressed pET-EcorOBP7 fusion protein is about 18 kDa in size. It indicates that EcorOBP7 of Eupeodes corollae has successfully expressed a fusion protein with a molecular mass similar to the predicted protein in Escherichia coli. EcorOBP7 is expressed in the form of inclusion bodies in the precipitate. After denaturation and renaturation incubation of the inclusion bodies, a soluble fusion protein is obtained. The fusion protein dissolved in the buffer is purified by a nickel column to obtain a protein band with the same size as the odorant-binding protein EcorOBP7. The band is the darkest when eluted with 50 mM imidazole, but the band is not single enough. The band is single and free of impurities when eluted with 20 mM imidazole, see Figure 5 , and the fusion protein eluted with a gradient of 20 mM to 50 mM imidazole is collected for later use.
[0052] Figure 4 In, M: Protein molecular weight standard; Lanes 1-9 are in turn: pet28a-OBP7 bacterial solution without IPTG induction; pet28a-OBP7 bacterial solution induced with 0.1 mM IPTG at 37 °C for 7 h; pet28a-OBP7 bacterial solution cultured overnight at 16 °C with 0.1 mM IPTG; supernatant of pet28a empty vector bacterial solution cultured overnight at 16 °C with 0.1 mM IPTG; supernatant of pet28a-OBP7 bacterial solution cultured overnight at 16 °C with 0.1 mM IPTG; supernatant of pet28a-OBP7 bacterial solution cultured overnight at 37 °C with 0.1 mM IPTG; precipitate of pet28a empty vector bacterial solution cultured overnight at 16 °C with 0.1 mM IPTG; precipitate of pet28a-EcorOBP7 bacterial solution cultured at 16 °C for 20 h with 0.1 mM IPTG; precipitate of pet28a-EcorOBP7 bacterial solution cultured at 37 °C for 20 h with 0.1 mM IPTG.
[0053] Figure 5Among them, M: protein molecular weight standard; CL: prokaryotic expression at 37°C for 8 hours with a final IPTG concentration of 0.1 mM; FT: flow-through; W1: washing with 5 mM imidazole; W2: washing with 10 mM imidazole; W3: washing with 15 mM imidazole; W4: washing with 20 mM imidazole; W5: washing with 25 mM imidazole; E1: elution with 50 mM imidazole; E2: elution with 100 mM imidazole; E3: elution with 150 mM imidazole; E4: elution with 200 mM imidazole.
[0054] 5. Purification and Western blot verification of the EcorOBP7 fusion protein.
[0055] The EcorOBP7 fusion protein was expressed in the form of inclusion bodies. The EcorOBP7 fusion protein was purified by nickel column. The purified protein was verified by SDS-PAGE to be the same size as EcorOBP7. To further confirm that this protein is the target protein, the purified protein was subjected to SDS-PAGE polyacrylamide gel electrophoresis, and then the protein on the gel was transferred to a PVDF membrane. Ponceau S staining showed successful transfer. The membrane was incubated successively in a mouse anti-6×his antibody as the primary antibody and a horseradish peroxidase-labeled goat anti-mouse antibody as the secondary antibody. After washing with TBST, ECL luminescent solution was added and a single target band was obtained in the imaging system, as shown in Figure 6 , and it was determined that the eluted protein is the target protein expressed by the PET28a-EcorOBP7 recombinant plasmid.
[0056] 6. Determination of the concentration of the purified protein.
[0057] The concentration of the purified protein was determined using Bradford method. The correlation coefficient R of the standard curve prepared was 2 = 0.9941, as shown in Figure 7 , and the concentration of the recombinant protein was measured to be 1.5 mg / mL, which can be used for downstream experiments.
[0058] 7. Determination of the odorant ligand molecules bound by EcorOBP7.
[0059] Six small molecule compounds were selected as candidate odorant ligand molecules for EcorOBP7 in the present invention. The test compounds are shown in Table 1.
[0060] Table 1 Test compounds 7.1 Binding characteristics of EcorOBP7 to 1-NPN.
[0061] With an excitation wavelength of 280 nm, when the fluorescent probe N-phenyl-1-naphthylamine 1-NPN was gradually added to the recombinant EcorOBP7 protein solution of Eupeodes corollae, the maximum emission wavelength of the protein became 340 nm. As the concentration of 1-NPN in the system increased, fluorescence quenching occurred at the maximum emission wavelength of the mixture, indicating that the fluorescent probe 1-NPN could form a stable complex with the EcorOBP7 protein. The spectral data was linearized using the Scatchard equation, and the binding curve of EcorOBP7 and 1-NPN was plotted, as shown in Figure 8 , and the binding constant between the protein and the fluorescent probe was calculated to be 3.346, and the number of binding sites was 0.94.
[0062] As can be seen from Figure 8 , when the 1-NPN fluorescent probe was added to the recombinant EcorOBP7 protein solution of Eupeodes corollae at a concentration gradient of 2 μM, the fluorescence intensity of the mixed solution increased steadily. When 20 μM of 1-NPN was added, the change in fluorescence intensity was no longer obvious. The number of binding sites between EcorOBP7 and 1-NPN was close to 1, indicating that the two were basically bound in a 1:1 ratio, and the binding constant was small, indicating that the binding ability between the two was strong. The above results show that 1-NPN is suitable as a fluorescent probe for EcorOBP7 and meets the requirements of subsequent experiments.
[0063] 7.2. Characteristics diagram of EcorOBP7 and odor ligand molecules.
[0064] The results of the fluorescence competitive binding assay showed that the recombinant EcorOBP7 protein of Eupeodes corollae could effectively bind to all candidate odor ligand molecules, and the binding curve is shown in Figure 9 .
[0065] As can be seen from Figure 9 , as the concentration of the odor ligand molecule gradually increased in the mixed solution of EcorOBP7 and 1-NPN, the fluorescence intensity decreased continuously, indicating that the odor information molecule competed with 1-NPN for binding to EcorOBP7. The IC50 and Ki data of EcorOBP7 and different odor ligand molecules are shown in Table 2.
[0066] Table 2 Binding data of EcorOBP7 and odor ligands
[0067]
[0068] These data indicate that the six molecules, (E)-β-farnesene, (E)-β-myrcene, 3-methylbutyraldehyde, cis-acetamidoacetate, (Z)-β-ocimene and linalool, can reduce the binding strength of 1-NPN and EcorOBP7 to less than 50% at a certain concentration, among which cis-acetamidoacetate and (E)-β-farnesene have smaller dissociation constants with EcorOBP7 protein and stronger binding ability.
[0069] The results of the fluorescence competition binding test showed that the odor binding protein EcoROBP7 of the large gray hoverfly has the ability to bind to a variety of odor information molecules. (E)-β-farnesene has been confirmed to play an important role as an information molecule in the relationship between plants, aphids and natural enemy insects. It can be produced by aphids or by plants infested by aphids, and can be recognized and located by natural enemy insects. The research of the present invention found that EcoROBP7 has a strong binding ability with (E)-β-farnesene, indicating that the protein may regulate the foraging behavior of the large gray hoverfly.
[0070] In order to clarify the life activities of the great gray hoverfly in response to external stimuli, a series of studies were conducted on the olfactory system of the great gray hoverfly. In-depth observations were made on the antennae, an important organ of the olfactory system, and it was found that a large number of sensors were distributed on the antennae. These sensors are closely related to the sensitive and efficient olfactory discrimination ability of insects. The odor protein not only cascades the odor receptors that constitute the olfactory nerve unit of the great gray hoverfly, but also receives odor molecule stimulation from the outside world. It is extremely important in the life activities of the great gray hoverfly. The present invention selected the gene with the highest transcriptome abundance for in-depth discussion, and used real-time fluorescence quantitative PCR to detect its expression in various tissue spectra of adults and the expression of different ages of larvae. It was found that the protein is closely related to the preference of the great gray hoverfly for aphids in its life activities. In order to further verify the possibility of the existence of the protein, the protein was expressed in prokaryotes and verified by Western-Blot. After that, a fluorescence competitive binding test was used to perform functional analysis of the binding characteristics of EcoROBP7 with various odor information molecules. The results showed that EcorOBP7 is a broad-spectrum binding protein that can interact with a variety of information molecules, among which it can produce strong binding with substances such as (E)-β-farnesene and cis-acetylaminoacetate, indicating that this protein may regulate the foraging and oviposition behavior of the large gray hoverfly.
[0071] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0072] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation to the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention.
Claims
1. Application of EcorOBP7 in binding odorant molecules, characterized in that, The nucleotide sequence of the EcorOBP7 is shown as SEQ ID NO.1; The odorant includes at least one of (E)-β-farnesene, (E)-β-myrcene, 3-methylbutanal, (Z)-β-ocimene, linalool, and cis-acetamidoacetate.
2. A recombinant vector comprising the EcorOBP7 according to claim 1.
3. The preparation method of the recombinant vector according to claim 2, characterized in that, Comprising the following steps: Extract the RNA of Eupeodes corollae, use the cDNA obtained by reverse transcription as a template, and PCR amplify to obtain EcorOBP7; Perform enzymatic digestion on EcorOBP7 and the expression vector respectively; Connect the enzymatically digested EcorOBP7 with the expression vector to obtain the recombinant vector.
4. The preparation method according to claim 3, characterized in that, The expression vector is a pET series vector.
5. The preparation method according to claim 4, characterized in that, The pET series vector includes any one of pET28a, pET22b, and pET32a.
6. A host cell comprising the recombinant vector according to claim 2.
7. Use of the recombinant vector according to claim 2 or the host cell according to claim 6 in regulating the behavior of insects, characterized in that, The behavior includes any one of aphid recognition behavior, foraging behavior, and oviposition behavior.
8. The application according to claim 7, characterized in that, The insect is Eupeodes corollae.
9. A biological pesticide, characterized in that, The biological pesticide includes any one of the EcorOBP7 according to claim 1, the recombinant vector according to claim 2, or the host cell according to claim 6.
10. An odorant molecule detection kit based on EcorOBP7, characterized in that, The odorant detection kit includes the EcorOBP7 according to claim 1 and N-phenyl-1-naphthylamine.
Citation Information
Cited By
Cyctria megacephala odorant binding protein and application thereof
CN120699124A