Application of serum exosome piRNA

By using piR-has-164552 in serum exosomes as a detection molecular marker, the problem of early detection of squamous cell carcinoma in the head and neck is solved, efficient early diagnosis and potential therapeutic target discovery are achieved, and patients' survival and quality of life are improved.

CN120249488APending Publication Date: 2025-07-04QINGDAO UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510386176.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-31
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The existing technology lacks effective early detection methods, which leads to the diagnosis of patients with squamous cell carcinoma of the head and neck, which is mostly advanced in cancer, and loses the best treatment opportunity, affecting the patient's survival and quality of life.

Method used

Using piR-has-164552 in serum exosomes as a detection molecular marker, the expression and stability of its in head and neck squamous cell carcinoma was evaluated through qRT-PCR technology and ROC curve analysis, and the effect of piR-has-164552 mimics and inhibitors on cancer cell function was explored, and its role as a potential target was explored.

Benefits of technology

It improves the early detection performance of squamous cell carcinoma in the head and neck, provides potential therapeutic targets, and significantly improves the accuracy and therapeutic effect of clinical testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005336154090000011
    Figure HDA0005336154090000011
  • Figure HDA0005336154090000012
    Figure HDA0005336154090000012
  • Figure HDA0005336154090000013
    Figure HDA0005336154090000013
Patent Text Reader

Abstract

The invention belongs to the technical field of biomedicine and tumor science, and particularly relates to application of serum exosome piRNA as a detection molecular marker of head and neck squamous cell carcinoma to search for a potential target for overcoming cancers, and the serum-derived exosome piR-has-164552 is used for early detection of the head and neck squamous cell carcinoma. The clinical detection performance of head and neck squamous cell carcinoma is improved; by exploring the influence of piR-has-164552 on the function of a head and neck squamous cell carcinoma cell line, a potential target spot for overcoming cancers is found. The specific process comprises the following steps: firstly, screening piR-has-164552 which is remarkably and highly expressed in the squamous cell carcinoma of the head and neck from three aspects of tissues, cells and serum exosomes; then, carrying out statistical analysis on the detection performance of the serum exosome piR-has-164552 by virtue of a qRT-PCR technology and construction of an ROC curve; and finally, transfecting the piR-has-164552 simulant and the inhibitor into Fadu and Cal27 cell lines of the head and neck squamous cell carcinoma cells, and further exploring the influence of the piR-has-164552 on the functions of the head and neck squamous cell carcinoma cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field:

[0001] The present invention belongs to the fields of biomedical technology and oncology technology, and specifically relates to the use of serum exosomal piRNA as a detection molecular marker for head and neck squamous cell carcinoma to find potential targets for overcoming cancer. Background Art:

[0002] Head and neck squamous cell carcinoma is the sixth most common cancer, with an increasing incidence rate. It has the characteristics of hidden onset location, easy metastasis, easy missed diagnosis in the early stage, and high recurrence. Due to the lack of effective screening strategies, most patients with head and neck squamous cell carcinoma are already in the advanced stage of cancer at the time of diagnosis, losing the best treatment opportunity and generally having a poor prognosis. The occurrence and development of head and neck squamous cell carcinoma seriously affect the survival and quality of life of patients. Therefore, there is an urgent need to develop an effective biomarker for the early detection of head and neck squamous cell carcinoma for prevention, screening, and diagnosis to improve the survival and quality of life of patients with head and neck squamous cell carcinoma.

[0003] Exosomes are vesicles with a double-membrane structure, with a diameter of about 50 - 150 nm. They originate from the endosomal pathway and are released into body fluids such as blood and urine. Exosomes contain a large amount of lipids, nucleic acids, and proteins. Exosomes and their cargos can serve as a delivery system for cells, tissues, and organs and can regulate various biological activities related to cell-to-cell communication. Tumor cells secrete a large amount of exosomes, and tumor-derived exosomes can stably exist in the blood. Based on this, tumor diseases can be detected early by detecting the contents encapsulated in serum exosomes.

[0004] Non-coding RNA (ncRNA) can be accurately located at the gene level and plays an important auxiliary role in the early diagnosis of diseases. According to the molecular size, ncRNA can be divided into long non-coding RNA (lncRNA) and short non-coding RNA (sncRNA). The transcripts of lncRNA exceed 200 nucleotides, and sncRNA consists of microRNA (miRNA), short interfering RNA (siRNA), and PIWI-interacting RNA (piRNA), etc. piRNA is a class of small non-coding RNA newly discovered in male germ cells in 2001, with a length of about 24 - 32 nt, a 2'-O-methylation at the 3' end, a 5'-terminal uridine modification or an adenosine bias at the tenth position, and no obvious secondary structure region. The piRNA sequences are not conserved, but the gene clusters encoding piRNA are very conserved among species. piRNA often forms a complex with PIWI proteins and plays an important role in the occurrence and development of various diseases, participating in the physiological and pathological processes of organisms through epigenetic regulation methods such as regulating gene transcription, translation, and stability. Since piRNA is expressed in a tissue-specific manner, the dysregulation of piRNA can dynamically reflect the disease state.

[0005] Previous studies have found that piRNAs are abnormally expressed in tumors and enter the circulating blood through the cell membrane via exosomes. The piRNAs encapsulated in tumor-derived exosomes have a stable structure and can resist degradation by ribonucleases in body fluids and stably exist in the blood, showing promise as stable novel tumor markers in liquid biopsy. Summary of the Invention:

[0006] The object of the present invention is to overcome the shortcomings of the existing technology and seek to design a use of serum exosomal piRNAs as detection molecular markers for head and neck squamous cell carcinoma and to find potential targets for overcoming cancer.

[0007] To achieve the above object, the use of serum exosomal piRNAs involved in the present invention is as detection molecular markers for head and neck squamous cell carcinoma and potential targets for overcoming cancer; serum exosomal piRNAs are RNAs derived from serum exosomes and interacting with PIWI proteins, specifically piR-has-164552; the nucleic acid sequence of piR-has-164552 is GTTTCCGTAGTGTAGTGGTTCTCACATTCGCCA, the primer is Human-pir-has-164552, its upstream primer sequence Human-piR-has-164552-F is AGCAGGGTTTCCGTAGTGTAGTG, the downstream primer sequence Human-piR-has-164552-R is ATCCAGTGCAGGGTCCGAGG, and the stem-loop primer sequence Human-piR-has-164552-RT is GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCGA.

[0008] The serum exosomes involved in the present invention are extracted from serum using an exosome extraction kit; the extracted exosomes are verified by three techniques: TEM (transmission electron microscopy), NTA (nanoparticle tracking analysis), and Western-Blot (protein immunoblotting experiment);

[0009] Cells or exosomes are lysed using a total RNA (total ribonucleic acid) extraction reagent (TRIZOL reagent) to extract total RNA containing piR-has-164552, the total RNA is reverse transcribed into cDNA (complementary deoxyribonucleic acid), and the expression level of piR-has-164552 is analyzed by qRT-PCR (real-time fluorescence quantitative reverse transcription polymerase chain reaction);

[0010] Based on the verification of tissue high-throughput sequencing and qRT-PCR experiments, the expression of piR-has-164552 in head and neck squamous cell carcinoma tissues was significantly up-regulated, with potential biological functions.

[0011] The process for verifying the stability of serum exosomal piR-has-164552 involved in the present invention is as follows:

[0012] The exosomal piR-has-164552 from the same serum source was divided into three groups: a control group, a group treated with RNase A alone, and a group treated with a combination of RNase A and Triton X-100. The expression levels of piR-has-164552 in the three groups were detected by qRT-PCR, and whether the exosomes had a protective effect on the encapsulated piR-has-164552 was judged according to the expression levels.

[0013] The exosomal piR-has-164552 from the same serum source was placed at room temperature for 0 h, 12 h, 24 h, and 48 h respectively. The expression levels of piR-has-164552 were detected by qRT-PCR, and the stability was judged according to the expression levels.

[0014] The method for evaluating the detection efficacy of serum exosomal piR-has-164552 in the early stage of head and neck squamous cell carcinoma involved in the present invention is as follows:

[0015] The expression levels of piR-has-164552 in head and neck squamous cell carcinoma tissues and normal serum exosomes were analyzed and compared by qRT-PCR technology and constructing ROC curves.

[0016] The method for evaluating the prognostic effect of serum exosomal piR-has-164552 after surgery for head and neck squamous cell carcinoma involved in the present invention is as follows:

[0017] The expression levels of piR-has-164552 in serum exosomes before and one week after surgery of the same tissue were evaluated by qRT-PCR technology and constructing ROC curves to judge the intervention effect of surgery on head and neck squamous cell carcinoma tissues.

[0018] The process for verifying the targeting effect of piR-has-164552 involved in the present invention is as follows: The piR-has-164552 mimics and inhibitors were transfected into head and neck squamous cell carcinoma Fadu and Cal27 cell lines. The cell proliferation indexes of head and neck squamous cell carcinoma cells were detected by EdU (thymidine (T) analogue) staining and CCK8 kit, and the effect of piR-has-164552 on cell proliferation viability was judged.

[0019] The migration indexes of head and neck squamous cell carcinoma cells were detected by scratch test, Transwell migration and invasion tests, and the effect of piR-has-164552 on cell migration ability was judged.

[0020] Compared with the prior art, the present invention uses serum-derived exosomal piR-has-164552 for the early detection of head and neck squamous cell carcinoma to improve the clinical detection performance of head and neck squamous cell carcinoma; by exploring the effect of piR-has-164552 on the functions of head and neck squamous cell carcinoma cell lines, potential targets for overcoming cancer are searched. The specific process is as follows: First, piR-has-164552 that is significantly highly expressed in head and neck squamous cell carcinoma is screened from three aspects: tissue, cells and serum exosomes; then, the detection performance of serum exosomal piR-has-164552 is statistically analyzed by qRT-PCR technology and constructing an ROC curve; finally, piR-has-164552 mimics and inhibitors are transfected into head and neck squamous cell carcinoma Fadu and Cal27 cell lines to further explore the effect of piR-has-164552 on the functions of head and neck squamous cell carcinoma cells. Based on large sample size data analysis and repeated experimental verification, it has high credibility and remarkable performance, provides a novel early detection serum biomarker for head and neck squamous cell carcinoma, and provides potential therapeutic targets for overcoming head and neck squamous cell carcinoma. Description of the Drawings:

[0021] Figure 1 It is a schematic diagram of the high-throughput sequencing results of tissues related to Example 1 of the present invention. A is a heat map of differentially expressed genes, B is the differentially expressed genes further screened by qRT-PCR technology, and C is the expression of piR-has-164552 in paired tissues.

[0022] Figure 2 It is a schematic diagram of the results of serum exosome extraction and structural feature verification related to Example 2 of the present invention. A is a transmission electron microscope image (TEM) of exosomes, B is a nanoparticle tracking analysis image (NTA) of exosomes, and C is a Western-Blot image of exosome surface marker proteins.

[0023] Figure 3 It is a schematic diagram of the results of piRNA stability verification in serum exosomes related to Example 3 of the present invention. A is the expression level of piR-hsa-164552 in serum exosomes stored at room temperature for different times (1 represents 0 h, 2 represents 12 h, 3 represents 24 h, 4 represents 48 h), and B is the expression level of piR-hsa-164552 in serum exosomes before and after treatment with RNase A analyzed by qRT-PCR.

[0024] Figure 4Schematic diagram of the results of evaluating the detection efficacy of serum exosome piR-hsa-164552 related to Example 4 of the present invention for head and neck squamous cell carcinoma. A shows the expression of piR-has-164552 in normal serum exosomes and serum exosomes of head and neck squamous cell carcinoma. B shows the ROC curve analysis results of the data in Figure A. C shows the expression of piR-has-164552 in serum exosomes before and after surgery of head and neck squamous cell carcinoma tissues. D shows the ROC curve analysis results of the data in Figure C.

[0025] Figure 5 Schematic diagram of the results of detecting the overexpression and knockdown efficiency of piR-hsa-164552 in head and neck squamous cell carcinoma cells Fadu and CAL27 related to Example 5 of the present invention.

[0026] Figure 6 Schematic diagram of the results of the influence of EdU staining on the proliferation viability of head and neck squamous cell carcinoma cell lines Fadu and CAL27 related to Example 6 of the present invention. A shows the influence of overexpressing and knocking down piR-hsa-164552 on the proliferation viability of Fadu cells verified by a thymidine (T) analogue (5-ethynyl-2'-deoxyuridine, EdU) cell proliferation detection kit. B shows the influence of overexpressing and knocking down piR-hsa-164552 on the proliferation viability of Cal27 cells verified by a thymidine (T) analogue (5-ethynyl-2'-deoxyuridine, EdU) cell proliferation detection kit. C shows the quantitative results of Figure A. D shows the quantitative results of Figure B.

[0027] Figure 7 Schematic diagram of the results of the influence of detecting CCK8 proliferation viability on head and neck squamous cell carcinoma cell lines Fadu and CAL27 related to Example 7 of the present invention. A shows the influence of overexpressing and knocking down piR-hsa-164552 on the proliferation viability of Fadu cells verified by a cell counting experiment (CCK8). B shows the influence of overexpressing and knocking down piR-hsa-164552 on the proliferation viability of Cal27 cells verified by a cell counting experiment (CCK8).

[0028] Figure 8 Schematic diagram of the results of the influence of a scratch assay on the migration ability of head and neck squamous cell carcinoma cell lines Fadu and CAL27 related to Example 8 of the present invention. A shows the influence of overexpressing and knocking down piR-hsa-164552 on the migration of Fadu cells verified by a scratch assay. B shows the quantitative results of Figure A. C shows the influence of overexpressing and knocking down piR-hsa-164552 on the migration of Cal27 cells verified by a scratch assay. D shows the quantitative results of Figure C.

[0029] Figure 9This is a schematic diagram of the results of detecting the effects of the Transwell chamber on the migration and invasion abilities of head and neck squamous cell carcinoma cell lines Fadu and CAL27 in Example 9 of the present invention. A shows the effects of overexpressing and knocking down piR-hsa-164552 on the migration and invasion abilities of Fadu cells verified by Transwell. B is the quantitative result of Figure A. C shows the effects of overexpressing and knocking down piR-hsa-164552 on the migration and invasion abilities of Cal27 cells verified by Transwell. D is the quantitative result of Figure C. Detailed implementation method:

[0030] The present invention will be further described below through examples in conjunction with the accompanying drawings.

[0031] Example 1:

[0032] This example involves screening for piRNAs that are significantly differentially expressed and highly expressed in head and neck squamous cell carcinoma tissues and corresponding adjacent tissues using tissue high-throughput sequencing (LC Sciences). High-throughput sequencing and gene microarray analysis showed that 10 piRNAs were significantly differentially expressed in head and neck squamous cell carcinoma tissues and adjacent tissues, including 7 upregulated genes and 3 downregulated genes. The results are as Figure 1 shown in A; further screening and verification by qRT-PCR confirmed that piR-hsa-164552 was significantly upregulated in head and neck squamous cell carcinoma tissue samples, as Figure 1 shown in B-C.

[0033] Example 2:

[0034] This example involves the extraction and verification of serum exosomes.

[0035] Collect serum samples and extract serum exosomes using an exosome extraction and purification kit (YMbio, UR52151). The specific extraction method is as follows:

[0036] Pretreatment:

[0037] (1) Pre-cool the centrifuge at 4°C for 10 minutes before use;

[0038] (2) When sampling, if it is a frozen sample, thaw it in a 25°C water bath after taking it out. After complete melting, place it on ice. If it is a fresh sample, directly place it on ice;

[0039] (3) Aliquot the samples at 500 μL per tube;

[0040] (4) Transfer the samples to 1.5 mL centrifuge tubes and centrifuge at 4°C at 3000×g for 10 minutes to remove cell debris in the samples;

[0041] (5) Transfer the centrifuged supernatant to a new centrifuge tube, centrifuge at 12,000×g for 10 min at 4°C to remove impurity fragments in the sample, and transfer the supernatant to a new centrifuge tube;

[0042] Remove miscellaneous proteins:

[0043] (1) Add 400 μL of pre-cooled Solution A to 500 μL of the sample, immediately tighten the centrifuge tube, and mix well for 30 s using a vortex oscillator;

[0044] (2) Centrifuge the mixed sample at 12,000×g for 20 min at 4°C to remove miscellaneous proteins in the sample, and transfer the centrifuged supernatant to a new 1.5 mL centrifuge tube;

[0045] Extract serum exosomes:

[0046] (1) Add 120 μL of Solution B to the centrifuged supernatant after removing miscellaneous proteins, tighten the centrifuge tube, mix well for 1 min using a vortex oscillator, and then let it stand at 4°C for more than 30 min and less than 24 h to improve the yield of serum exosomes;

[0047] (2) Centrifuge at 12,000×g for 15 min at 4°C, discard the supernatant, and the precipitate is rich in exosome particles;

[0048] (3) Centrifuge the centrifuge tube containing the precipitate again at 12,000×g for 2 min at 4°C, and discard the supernatant;

[0049] (4) Take 1×PBS solution and gently pipette to resuspend the centrifuged precipitate. After it dissolves, transfer the resuspended solution to a new 1.5 mL centrifuge tube (resuspend every 500 μL of sample with 200 μL of 1×PBS solution);

[0050] (5) Centrifuge the 1.5 mL centrifuge tube containing the resuspended solution at 12,000×g for 2 min at 4°C, retain the supernatant, which is rich in serum exosome particles; if there is a lot of precipitate, centrifuge at 12,000×g for 2 min multiple times until there is no obvious precipitate, and take the supernatant each time;

[0051] Purify serum exosomes:

[0052] Transfer the crude product of harvested serum exosome particles to the upper chamber of the Exosome Purification Filter (EPF column), centrifuge at 3,000×g for 10 min at 4°C, collect the liquid at the bottom of the EPF column tube, which is the purified serum exosome particles, and aliquot and store them frozen at -80°C in a low-temperature refrigerator.

[0053] Verify the characteristics of serum exosomes through the following three experiments respectively:

[0054] Transmission electron microscope (TEM)

[0055] (1) Fix the serum exosomes on a dedicated copper grid, and resuspend the serum exosomes with 50 - 100 μl of 2% paraformaldehyde;

[0056] (2) Drop 5 μl of the serum exosome suspension on a Formvar-carbon copper grid for loading, and prepare 2 - 3 copper grids / sample in this way;

[0057] (3) Drop 100 μl of PBS on the sealing film and wash the copper grid with the PBS buffer drop;

[0058] (4) Place the copper grid in a 50 μl droplet of 1% glutaraldehyde solution for 5 min;

[0059] (5) Place the copper grid in 100 μl of deionized H2O and wash for 2 min, 8 times in total;

[0060] Electron microscopy detection of negatively stained serum exosomes

[0061] (1) Place the copper grid on a 50 μl droplet of uranyl oxalate solution for 75 min;

[0062] (2) Place the copper grid on a droplet of methylcellulose on ice for 10 min;

[0063] (3) Place the copper grid on a stainless steel ring and blot off the excess liquid with filter paper;

[0064] (4) Air dry for 5 - 10 min;

[0065] (5) Place the copper grid in a box and capture electron microscopy photos under the condition of 80 kV.

[0066] Exosome nanoparticle tracking analysis (NTA)

[0067] (1) Wash the sample cell with deionized water;

[0068] (2) Calibrate the instrument with polystyrene microspheres (110 nm);

[0069] (3) Wash the sample cell with 1×PBS buffer;

[0070] (4) Dilute with 1×PBS and then perform sample detection.

[0071] Western blot (WB)

[0072] Extract the total protein of serum exosomes with radioimmunoprecipitation assay lysis buffer (RIPA, Meilun);

[0073] Adjust the protein concentration to be consistent by BCA colorimetric method (total protein quantification test kit);

[0074] Separate the protein samples by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), transfer them to PVDF membranes, block with 5% skim milk for 1 h, wash the membranes, incubate with primary antibodies (CD9, CD81, TSG101), incubate overnight in a refrigerator at 4 °C, wash the membranes, incubate with secondary antibodies at room temperature for 1 h, wash the membranes, and develop the target bands by ECL chemiluminescence method.

[0075] The results are as Figure 2 shown: Transmission electron microscopy images of serum exosomes show ( Figure 2 A) Serum exosome vesicles have a typical saucer-shaped structure;

[0076] The particle size measured by nanoparticle tracking analysis is concentrated around 120 nm ( Figure 2 B);

[0077] Surface marker proteins (CD9, CD81, and TSG101) are detected and enriched in extracellular vesicles ( Figure 2 C);

[0078] indicating that the exosome particles extracted from serum are obtained.

[0079] Example 3:

[0080] This example is related to the evaluation of the stability of serum exosomal piR-hsa-164552.

[0081] Extract exosomes from serum, and divide the exosomal piR-has-164552 from the same serum source into three groups: a control group, a group treated with RNase A alone, and a group treated with a combination of RNase A and Triton X-100;

[0082] Detect the expression levels of piR-has-164552 in the three groups by qRT-PCR, and determine whether serum exosomes have a protective effect on the encapsulated piR-has-164552;

[0083] Place the exosomal piR-has-164552 from the same serum source at room temperature for 0 h, 12 h, 24 h, and 48 h respectively, detect the expression levels of piR-has-164552 by qRT-PCR, and determine the stability.

[0084] The results are as Figure 3 shown:

[0085] After storing serum exosomes from the same source at room temperature for different lengths of time (1 represents 0 h, 2 represents 12 h, 3 represents 24 h, 4 represents 48 h), there was no significant difference in the expression level of piR-has-164552 in the serum exosomes ( Figure 3 A);

[0086] The expression level of piR-hsa-164552 in the serum exosomes did not change significantly before and after treatment with RNase A ( Figure 3 B);

[0087] indicating that piR-hsa-164552 can stably exist in serum exosomes.

[0088] Example 4:

[0089] This example relates to the evaluation of the detection efficiency of serum exosomal piR-has-164552 in the early stage of head and neck squamous cell carcinoma and the prognosis of patients after surgery for head and neck squamous cell carcinoma.

[0090] By using qRT-PCR technology and constructing an ROC curve, the expression of piR-has-164552 in head and neck squamous cell carcinoma tissues and normal serum exosomes was analyzed and compared to determine the detection efficiency of serum exosomal piR-has-164552 in the early stage of head and neck squamous cell carcinoma;

[0091] By using qRT-PCR technology and constructing an ROC curve, the expression of piR-has-164552 in serum exosomes before and one week after surgery in the same tissue was evaluated to determine the intervention effect of surgery on tumor tissues of head and neck squamous cell carcinoma.

[0092] The results are as Figure 4 shown:

[0093] Compared with the normal situation, the expression of piR-has-164552 in serum exosomes of head and neck squamous cell carcinoma tissues was significantly upregulated ( Figure 4 A);

[0094] Constructing an ROC curve to analyze the AUC (area under the curve) of serum exosomal piR-hsa-164552 was 0.7202 ( Figure 4 B);

[0095] The expression of piR-hsa-164552 in serum exosomes significantly decreased one week after surgery ( Figure 4 C);

[0096] Constructing an ROC curve to analyze the AUC (area under the curve) of serum exosomal piR-hsa-164552 was 0.7178 ( Figure 4 D);

[0097] It is shown that the expression of serum exosomal piR-hsa-164552 is up-regulated in head and neck squamous cell carcinoma tissues, and its expression significantly decreases after surgery, and it has the potential to become an effective indicator for the early detection and postoperative prognosis evaluation of head and neck squamous cell carcinoma.

[0098] Example 5:

[0099] This example involves the process of constructing mimics and inhibitors of piR-has-164552 and transfecting cells.

[0100] Using the piR-has-164552 gene as a template, PCR amplification was carried out with the primer Human-piR-has-164552 to generate double-stranded RNA piR-has-164552. Cholesterol modification was carried out at the 3' end, four phosphorothioate backbone modifications were carried out at the 3' end, two phosphorothioate backbone modifications were carried out at the 5' end, and full-chain methoxy modification were carried out on the antisense strand of piR-has-164552 (Shanghai GenePharma Co., Ltd.) to complete the construction of mimics and inhibitors. Transfection of piR-hsa-164552 mimics and inhibitors:

[0101] (1) Seed cells in a well plate to reach the set density;

[0102] (2) First, add 5 μL of piR-hsa-164552 mimics and inhibitors to 95 μL of serum-free DMEM. Then, add 5 μL of lipofectamine 3000 to 95 μL of serum-free DMEM. Finally, mix the above two components to form a transfection reagent;

[0103] (3) Add the transfection reagent to the well plate;

[0104] (4) Verify the transfection efficiency.

[0105] The results are as Figure 5 shown:

[0106] The expression levels of piR-hsa-164552 were significantly increased or decreased after transfection of mimics and inhibitors of piR-hsa-164552 in head and neck squamous cell carcinoma cell lines Fadu ( Figure 5 A) and Cal27 ( Figure 5 B).

[0107] Example 6:

[0108] This example involves the process of EdU staining analysis of the proliferation viability of head and neck squamous cell carcinoma cell lines Fadu and CAL27.

[0109] Cultivate head and neck squamous cell carcinoma cells. For the experimental group, transfect with piR-hsa-164552 mimics and inhibitors. Two days after transfection, perform EdU staining to analyze cell proliferation (Beyotime, C0071S). The specific procedure is as follows:

[0110] Reagent preparation

[0111] (1) 10 mM PBS, pH 7.2 - 7.6;

[0112] (2) PBS containing 4% paraformaldehyde (fixative);

[0113] (3) PBS containing 3% BSA, pH 7.2 - 7.6 (washing solution);

[0114] (4) PBS containing 0.3 - 0.5% Triton X-100 (permeabilization solution);

[0115] (5) Deionized water or ultrapure water;

[0116] EdU labeling, fixation and permeabilization

[0117] (1) Prepare 2×EdU working solution;

[0118] (2) Add pre-warmed 1×EdU working solution to each well and incubate for 2 h;

[0119] (3) After EdU labeling is completed, remove the culture medium;

[0120] (4) Add 50 μl of fixative and fix at room temperature for 15 - 30 min;

[0121] (5) Wash the cells with the washing solution and the permeabilization solution, 3 - 5 min each time;

[0122] EdU detection

[0123] (1) Prepare Click-iT Additive Solution;

[0124] (2) Remove the washing solution, add the Click reaction solution to each well, and adjust to evenly cover the sample;

[0125] (3) Incubate at room temperature in the dark for 30 min and then wash;

[0126] Nucleus staining

[0127] (1) Discard the washing solution, incubate with 1×Hoechst 33342 solution at 100 μL / well at room temperature for 10 min (in the dark);

[0128] (2) Discard the 1×Hoechst 33342 solution, wash with the washing solution, 3 - 5 min / time;

[0129] (3) Capture the image.

[0130] The results are as Figure 6 shown:

[0131] In Fadu ( Figure 6 A) and CAL27 ( Figure 6 B) cells, after overexpressing piR - hsa - 164552, the proportion of positive cells (red fluorescent cells) increased significantly. After knocking down piR - hsa - 164552, the opposite result occurred;

[0132] Figures C and D are the quantitative analysis results of Figures A and B respectively;

[0133] It shows that the mimics constructed with piR - hsa - 164552 can significantly promote the growth of head and neck squamous cell carcinoma cells, and the inhibitors constructed with piR - has - 164552 can significantly inhibit the growth of head and neck squamous cell carcinoma cells.

[0134] Example 7:

[0135] This example involves the CCK8 proliferation viability analysis process of head and neck squamous cell carcinoma cell lines Fadu and CAL27.

[0136] Culture head and neck squamous cell carcinoma cells in a 96 - well plate. For the experimental group, transfect with piR - hsa - 164552 mimics and inhibitors. Respectively, 0, 1, 2, and 3 days after transfection, discard the original culture medium from the experimental group and control group of head and neck squamous cell carcinoma cells, wash the head and neck squamous cell carcinoma cells twice with PBS, add 90 μl of fresh culture medium and 10 μl of CCK8 reagent (Meilun, MA0218), and incubate for 1.5 h, then detect the OD value at the absorbance of 450 nm.

[0137] The results are as Figure 7 shown:

[0138] Overexpressing piR - hsa - 164552 can significantly promote the proliferation of Fadu ( Figure 7 A left figure) and CAL27 ( Figure 7 B left figure) cells. After knocking down piR - hsa - 164552, the opposite result occurred ( Figure 7 A right figure, Figure 7 B right figure);

[0139] It is shown that the mimics constructed with piR-hsa-164552 can significantly promote the growth of head and neck squamous cell carcinoma cells, and the inhibitors constructed with piR-hsa-164552 can significantly inhibit the growth of head and neck squamous cell carcinoma cells.

[0140] Example 8:

[0141] This example involves the analysis process of the migration ability of head and neck squamous cell carcinoma cell lines Fadu and CAL27 by scratch assay.

[0142] Culture head and neck squamous cell carcinoma cells in a 6-well plate. Transfect the experimental group with piR-hsa-164552 mimics and inhibitors. Two days after transfection, use a 200 μl pipette tip to scratch the cell monolayer. Capture representative images of cell migration by taking pictures at 10x high magnification fields at 0 h and 24 h after scratching. Measure the reduced distance across the induced wound area and normalize it to the 0 h control, expressed as the relative migration rate.

[0143] The results are as Figure 8 shown, indicating that the mimics constructed with piR-hsa-164552 can significantly promote the migration ability of head and neck squamous cell carcinoma cells, and the inhibitors constructed with piR-hsa-164552 can significantly inhibit the migration ability of head and neck squamous cell carcinoma cells.

[0144] Example 9:

[0145] This example involves the analysis process of the migration and invasion abilities of head and neck squamous cell carcinoma cell lines Fadu and CAL27 by Transwell chamber assay.

[0146] Culture head and neck squamous cell carcinoma cells in a 6-well plate. Transfect the experimental group with piR-hsa-164552 mimics and inhibitors. Two days after transfection, perform the migration assay in a 24-well Millicell chamber: Add the cells (2×10 5 ) in 200 μl of serum-free medium to the Transwell chamber with or without Matrigel coating. Add 500 μl of medium containing 20% fetal bovine serum as a chemoattractant to the lower chamber. After placing it in an incubator at 37 °C for 36 h, fix the cells that have migrated through the filter membrane with methanol, stain them with 0.5% crystal violet, and take pictures and count the number of cells under a microscope.

[0147] The results are as Figure 9 shown, the mimics constructed with piR-hsa-164552 can significantly promote the migration and invasion abilities of head and neck squamous cell carcinoma cells, and the inhibitors constructed with piR-hsa-164552 can significantly inhibit the migration and invasion abilities of head and neck squamous cell carcinoma cells.

Claims

1. Use of a primer for detecting piR-hsa-164552 derived from serum exosomes in the preparation of a reagent for evaluating the detection efficacy of head and neck squamous cell carcinoma, characterized in that, The nucleic acid sequence of piR-has-164552 is GTTTCCGTAGTGTAGTGGTTCTCACATTCGCCA, and the primer is Human-pir-has-164552.

2. Use of the primer for detecting piR-hsa-164552 derived from serum exosomes according to claim 1 in the preparation of a reagent for evaluating the detection efficacy of head and neck squamous cell carcinoma, characterized in that, The upstream primer sequence Human-piR-has-164552-F is AGCAGGGTTTCCGTAGTGTAGTG.

3. Use of the primer for detecting piR-hsa-164552 derived from serum exosomes according to claim 1 in the preparation of a reagent for evaluating the detection efficacy of head and neck squamous cell carcinoma, characterized in that, The downstream primer sequence Human-piR-has-164552-R is ATCCAGTGCAGGGTCCGAGG.

4. Use of the primer for detecting piR-hsa-164552 derived from serum exosomes according to any one of claims 1-3 in the preparation of a reagent for evaluating the detection efficacy of head and neck squamous cell carcinoma, characterized in that, The stem-loop primer sequence Human-piR-has-164552-RT is GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCGA.

5. Use of a primer for detecting piR-hsa-164552 derived from serum exosomes in the preparation of a reagent for postoperative prognosis evaluation of head and neck squamous cell carcinoma tissues, characterized in that, The nucleic acid sequence of piR-has-164552 is GTTTCCGTAGTGTAGTGGTTCTCACATTCGCCA, and the primer is Human-pir-has-164552.

6. Use of a primer for detecting piR-hsa-164552 derived from serum exosomes in the preparation of a reagent for postoperative prognosis assessment of head and neck squamous cell carcinoma tissues, characterized in that, The upstream primer sequence Human-piR-has-164552-F is AGCAGGGTTTCCGTAGTGTAGTG.

7. Use of a primer for detecting piR-hsa-164552 derived from serum exosomes in the preparation of a reagent for postoperative prognosis assessment of head and neck squamous cell carcinoma tissues, characterized in that, The downstream primer sequence Human-piR-has-164552-R is ATCCAGTGCAGGGTCCGAGG.

8. Use of a primer for detecting piR-hsa-164552 derived from serum exosomes in the preparation of a reagent for postoperative prognosis assessment of head and neck squamous cell carcinoma tissue, characterized in that, The stem-loop primer sequence Human-piR-has-164552-RT is GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCGA.