A molecular marker closely linked to the low-light tolerance trait in tomatoes and its application
By using the WTS-1 molecular marker developed at 2361 bp of the tomato SlMCS1 gene, combined with KASP primer pairs and PCR amplification, the problem of difficulty in early screening of low-light tolerant varieties in existing technologies has been solved, enabling rapid and accurate variety differentiation and improving the breeding process.
Patent Information
- Application Number
- CN202510429444.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-04-07
AI Technical Summary
Currently, no molecular markers have been developed for identifying the low-light tolerance of tomatoes, resulting in a complicated tomato breeding process and low seed purity, making it difficult to distinguish between low-light tolerant and low-light sensitive varieties through early screening.
A molecular marker, WTS-1, closely linked to the low-light tolerance trait in tomatoes, is provided. Located at nucleotide sequence 2361 bp of the SlMCS1 gene, it can be rapidly distinguished between low-light tolerant and low-light sensitive varieties by PCR amplification and fluorescence detection using KASP primer pairs.
This method enables early and rapid screening of traits resistant to low light, improves the efficiency of tomato breeding, reduces the risk of yield reduction due to low light stress, and is simple, low-cost, and not easily affected by human factors.
Smart Images

Figure CN120249544B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker closely linked to the low-light tolerance trait of tomatoes and its application. Background Technology
[0002] The optimal light intensity for tomato growth and development is 600–900 μmol·m⁻². -2 ·s -1 When the light intensity is below 100 μmol·mm -2 ·s -1 In low light conditions, tomatoes will suffer from reduced photosynthetic rate, stunted growth, thinning of the hypocotyl, leaf discoloration and curling, and in severe cases, complete crop failure. Therefore, breeding low-light-tolerant tomato varieties has become an effective and urgent need to improve the tomato's low-light tolerance and production capacity. Currently, the main method of tomato breeding is hybridization, but this method requires several generations of cultivation, the seed production process is cumbersome, seed yield is difficult to guarantee, and there is a problem of low seed purity.
[0003] The low light tolerance of tomatoes is a complex quantitative trait regulated by multiple genes. To date, no molecular marker has been developed to identify the low light tolerance of tomatoes. Therefore, providing an SNP marker for detecting the low light tolerance of tomatoes has become a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0004] The purpose of this invention is to provide a molecular marker closely linked to the low-light tolerance trait in tomatoes and its application, which can rapidly screen and identify low-light tolerance traits at an early stage without the need for large-scale low-light stress experiments, distinguish between low-light tolerant tomato lines or varieties and low-light sensitive tomato lines or varieties, and improve the breeding efficiency of low-light tolerant tomatoes.
[0005] This invention provides a molecular marker closely linked to the low-light tolerance trait in tomatoes. The molecular marker is a WTS-1 marker located at 2361 bp of the nucleotide sequence of the tomato SlMCS1 gene, and has a single nucleotide polymorphism of T / G.
[0006] Preferably, the nucleotide sequence of the tomato SlMCS1 gene is shown in SEQ ID NO:14.
[0007] The present invention provides a DNA fragment closely linked to the low-light tolerance trait of tomatoes, characterized in that the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO:1 or SEQ ID NO:2;
[0008] In the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2, Y represents the base T / G.
[0009] The present invention also provides a KASP primer pair for identifying the molecular markers or DNA fragments described in the above technical solutions, including forward primer 1, forward primer 2 and reverse primer;
[0010] The forward primer 1 comprises the nucleotide sequence shown in SEQ ID NO:9; the 5' end of the nucleotide sequence shown in SEQ ID NO:9 contains a fluorescent label 1;
[0011] The forward primer 2 comprises the nucleotide sequence shown in SEQ ID NO:10; the 5' end of the nucleotide sequence shown in SEQ ID NO:10 contains a fluorescent label 2;
[0012] The reverse primer comprises a nucleotide sequence as shown in SEQ ID NO:11;
[0013] The fluorescent marker 1 and fluorescent marker 2 produce different colors.
[0014] Preferably, the fluorescent marker 1 is a FAM marker; the fluorescent marker 2 is a HEX marker.
[0015] The present invention also provides a kit for identifying the molecular markers or DNA fragments described in the above technical solutions, the kit comprising the KASP primer pairs described in the above technical solutions.
[0016] This invention also provides the application of the molecular marker, the DNA fragment, the KASP primer pair, or the kit described above in one or more of the following:
[0017] (1) To identify or assist in the identification of low-light tolerant tomato strains or varieties;
[0018] (2) Distinguish between light-tolerant tomatoes and light-sensitive tomato varieties or strains;
[0019] (3) Cultivate or assist in the cultivation of light-tolerant tomato plants, strains, varieties or cultivars;
[0020] (4) Screening or assisting in the screening of light-tolerant tomato plants, strains, varieties or cultivars.
[0021] This invention also provides a method for identifying tomatoes tolerant of low light, comprising the following steps:
[0022] Using the genomic DNA of the tomato to be identified as a template, PCR amplification was performed using the KASP primer pair described in the above technical solution to obtain the amplification product;
[0023] The amplification products were subjected to fluorescence detection, and the results were determined based on the fluorescence signal.
[0024] If only the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result of the tomato to be identified is TT, and the tomato to be identified is a low-light tolerant tomato.
[0025] If only the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result of the tomato to be identified is GG, and the tomato to be identified is a light-sensitive tomato.
[0026] If fluorescence signals corresponding to both forward primer F1 and forward primer F2 are detected simultaneously, the genotyping result of the tomato to be identified is TG, and the tomato to be identified is a common tomato with low light sensitivity between low light tolerant tomatoes and low light sensitive tomatoes.
[0027] Preferably, the PCR amplification system, in 10 μL, comprises: 8 μL of 10 μmol / L SNP Primer Mix solution, 2 ng of genomic DNA, and the remainder of sterile water;
[0028] The concentration ratio of forward primer 1, forward primer 2, and reverse primer in the SNP PrimerMix solution is 1:1:1.
[0029] Preferably, the PCR amplification program is as follows: denaturation at 91°C for 1 min, annealing at 55°C for 60 s, extension at 72°C for 1 min, 25 to 35 cycles.
[0030] Beneficial effects:
[0031] This invention provides a molecular marker closely linked to the low-light tolerance trait in tomatoes, located at nucleotide sequence 2361 bp of the tomato SlMCS1 gene, with a single nucleotide polymorphism of T / G. The molecular marker developed in this invention is closely linked to the low-light tolerance trait in tomatoes. When the tomato genotype is TT, it is a low-light tolerant tomato; when the genotype is GG, it is a low-light sensitive tomato; and when the genotype result is TG, it is a normal tomato, with low-light sensitivity intermediate between low-light tolerant and low-light sensitive tomatoes. The molecular marker developed in this invention can distinguish between low-light tolerant and low-light sensitive tomato lines or varieties, allowing for accurate screening of low-light tolerance traits at an early stage without large-scale low-light stress experiments. This can significantly promote the breeding process of new low-light tolerant tomato varieties, obtain tomato varieties with low-light tolerance characteristics, and increase the yield of low-light tolerant varieties under low-light conditions.
[0032] This invention develops KASP primer pairs based on the aforementioned molecular markers. It can rapidly and with high throughput select for low light tolerance in tomatoes without large-scale low light stress experiments. It only requires simple genomic DNA extraction, PCR amplification, and KASP genotyping detection to distinguish between low light tolerant tomatoes and low light sensitive tomatoes. The method is simple, low-cost, high-throughput, and not easily affected by human factors. It can solve the problem of not being able to predict the low light tolerance phenotype of individual tomatoes through phenotype in the early stages of growth, and reduce the risk of reduced tomato yield or even crop failure due to high temperatures. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0034] Figure 1 Phenotypic identification results for the low-light tolerant tomato inbred line GC303 and the low-light sensitive tomato inbred line LA2838; where different lowercase letters indicate P < 0.05;
[0035] Figure 2 BSA analysis of mixed groups of tomatoes with low light tolerance;
[0036] Figure 3 To precisely locate the genes for low-light tolerance in tomatoes;
[0037] Figure 4 The results of the screening for variant sites are shown; where ST represents low-light tolerant plants in F2 and SS represents low-light sensitive plants in F2.
[0038] Figure 5 The image shows the genotyping diagrams of different tomato germplasms detected using molecular markers from Example 2. Green markers represent light-tolerant tomato germplasms with genotype GG, gray markers represent insertion / deletion variants, red markers represent common tomato germplasms with genotype GA, and blue markers represent light-sensitive tomato germplasms with genotype AA. Detailed Implementation
[0039] This invention provides a molecular marker closely linked to the low-light tolerance trait in tomatoes. The molecular marker is a WTS-1 marker located at 2361 bp of the nucleotide sequence of the tomato SlMCS1 gene, and has a single nucleotide polymorphism of T / G.
[0040]
[0041] This invention provides a DNA fragment closely linked to the low-light tolerance trait in tomatoes, characterized in that the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO:1 or SEQ ID NO:2; wherein, Y in the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is a T / G base. The specific nucleotide sequence of SEQ ID NO:1 is: 5'-CACGGTTAGGTCTTTGGTGGAYTACTTCCAGAAA TAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCAGATGACCAAGAAGTAATGAGCGCTGA-3'. The specific nucleotide sequence of SEQ ID NO: 2 is: 5'-TTGTGTCTTTTG CTGAATGTAATAGATCCAAAGATTGGAGGCGTGATGATTATGGGTGATAGAGGAACTGGGAAGTCCACCACGGTTAGGTCTTTGGTGGAYTACTTCCAGAAATAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCAGATGACCAAGAAGTAATGAGCGCTGAAGTCCGTGACAAATTGAGGAAGG-3'.
[0042] The molecular markers developed in this invention are closely linked to the low-light tolerance trait in tomatoes. When the tomato genotype is TT, it is a low-light tolerant tomato; when the genotype is GG, it is a low-light sensitive tomato; and when the genotype is TG, it is a normal tomato with low-light sensitivity intermediate between the two. These molecular markers can distinguish between low-light tolerant and low-light sensitive tomato lines or varieties, allowing for accurate screening of low-light tolerance traits at an early stage without large-scale low-light stress experiments. This significantly promotes the breeding process of new low-light tolerant tomato varieties, resulting in tomato varieties with low-light tolerance characteristics and increased yields under low-light conditions.
[0043] The present invention also provides a KASP primer pair for identifying the molecular markers described in the above-mentioned technical solutions, comprising a forward primer 1, a forward primer 2, and a reverse primer; the forward primer 1 comprises a nucleotide sequence as shown in SEQ ID NO:9; the 5' end of the nucleotide sequence shown in SEQ ID NO:9 contains a fluorescent marker 1; the forward primer 2 comprises a nucleotide sequence as shown in SEQ ID NO:10; the 5' end of the nucleotide sequence shown in SEQ ID NO:10 contains a fluorescent marker 2; the reverse primer comprises a nucleotide sequence as shown in SEQ ID NO:11; the fluorescent markers 1 and 2 produce different colors.
[0044] In one embodiment, the fluorescent label 1 is a FAM label. In one embodiment, the fluorescent label 2 is a HEX label. In one embodiment, the nucleotide sequence of the forward primer 1 is shown in SEQ ID NO:12. In one embodiment, the nucleotide sequence of the forward primer 2 is shown in SEQ ID NO:13.
[0045] The present invention also provides a kit for identifying the molecular markers or DNA fragments described in the above technical solutions, the kit comprising the KASP primer pairs described in the above technical solutions.
[0046] As one implementation, the kit also includes other reagents for KASP detection, including but not limited to KASP 2x PCR Mix.
[0047] This invention develops KASP primer pairs based on the aforementioned molecular markers, which can select for the low-light tolerance trait in tomatoes. Without large-scale low-light stress experiments, rapid and high-throughput detection of samples can be completed through simple genomic DNA extraction, PCR amplification, and KASP genotyping. This method can distinguish between low-light tolerant tomatoes and low-light sensitive tomatoes, and is effective for identifying low-light tolerant tomatoes. It can be applied to breeding and high-quality genetic improvement research.
[0048] In view of the advantages of the molecular markers or DNA fragments or KASP primer pairs or kits provided by the present invention, the application of the molecular markers or KASP primer pairs or kits in one or more of the following is also within the scope of protection of the present invention: (1) identifying or assisting in the identification of light-tolerant tomato strains or varieties; (2) distinguishing between light-tolerant tomatoes and light-sensitive tomato strains or varieties; (3) cultivating or assisting in the cultivation of light-tolerant tomato individual plants, strains, strains or varieties; (4) screening or assisting in the screening of light-tolerant tomato individual plants, strains, strains or varieties.
[0049] This invention also provides a method for identifying tomatoes tolerant of low light, comprising the following steps:
[0050] Using the genomic DNA of the tomato to be identified as a template, PCR amplification was performed using the KASP primer pair described in the above technical solution to obtain the amplification product;
[0051] The amplification products were subjected to fluorescence detection, and the results were determined based on the fluorescence signal.
[0052] If only the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result of the tomato to be identified is TT, and the tomato to be identified is a low-light tolerant tomato.
[0053] If only the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result of the tomato to be identified is GG, and the tomato to be identified is a light-sensitive tomato.
[0054] If fluorescence signals corresponding to both forward primer F1 and forward primer F2 are detected simultaneously, the genotyping result of the tomato to be identified is TG, and the tomato to be identified is a common tomato with low light sensitivity between low light tolerant tomatoes and low light sensitive tomatoes.
[0055] This invention uses the genomic DNA of millet to be identified as a template and performs PCR amplification using the KASP primer pair described in the above technical solution to obtain the amplification product. This invention does not have strict requirements on the method of obtaining the genomic DNA; conventional methods in the art can be used, such as the CTAB (hexadecyltrimethylammonium bromide) extraction method.
[0056] As one implementation method, the PCR amplification system, in 10 μL volumes, comprises: 8 μL of 10 μmol / L SNP PrimerMix solution, 2 ng of genomic DNA, and the remainder sterile water; the concentration ratio of forward primer 1, forward primer 2, and reverse primer in the SNP PrimerMix solution is 1:1:1. As one implementation method, the PCR amplification program is: >91℃ denaturation for 1 min, 55℃ annealing for 60 s, 72℃ extension for 1 min, for 25–35 cycles.
[0057] The method provided by this invention is simple, low-cost, high-throughput, and not easily affected by human factors. It can solve the problem that the tolerance of tomatoes to low light can not be predicted by phenotype in the early stage of growth, and reduce the risk of reduced tomato yield or even crop failure caused by low light stress.
[0058] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a molecular marker closely linked to the low-light tolerance trait of tomatoes and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.
[0059] The molecular biology experimental techniques used in the following examples include DNA extraction, PCR amplification, PAGE gel electrophoresis, enzyme digestion, transformation, etc. Unless otherwise specified, they are usually performed according to conventional methods. For details, please refer to "Molecular Cloning: A Laboratory Manual" (3rd Edition) (translated by Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peitang et al., 2002, Beijing: Science Press), or follow the conditions recommended by the manufacturer.
[0060] Example 1
[0061] Construction and genetic analysis of genetic populations
[0062] 1. Test materials
[0063] The inbred line 'NTBM216', discovered in 2014, is resistant to high temperatures and low light, and is resistant to fruit cracking and has a calyx variation; the inbred line 'LA-2838' is a model inbred line for studying the quality of fruits sensitive to low light.
[0064] The above material is published in the literature: Xu Weijie, Hu Yingxue, Li Tao, et al. Morphological and physiological study of tomato seedlings under low light conditions in artificial climate chamber [J]. Guangdong Agricultural Sciences, 2024, 51(12): 54-63.
[0065] 2. Phenotypic identification
[0066] Using 'NTBM216' as the male parent and 'LA-2838' as the female parent, an F2 population containing 400 lines was constructed. Through single-seed passage, 300 F8 recombinant inbred lines (RILs) were obtained. From 2021 to 2022, the low-light tolerance of the 300 F8 lines was investigated in a greenhouse at the Baiyun Base of the Guangdong Academy of Agricultural Sciences. The specific steps were as follows: First, tomato seeds were soaked in 55℃ warm water, then germinated at a constant temperature of 27℃. The seeds were then sown in 50-cell trays containing a substrate (vermiculite and peat moss in a 1:2 mass ratio) for seedling cultivation. Every 3 days, the seeds were irrigated with a Yamazaki tomato-specific nutrient solution (containing 540 mg / L ammonium calcium nitrate (containing 25% calcium oxide and 15% total nitrogen) and 700 mg / L potassium magnesium nitrate (containing 42% potassium oxide)). Management of each material was consistent throughout the process. When the seedlings have two leaves and one bud, select 15 seedlings of uniform growth from each tomato variety and transplant them into flowerpots (top diameter 18cm, bottom diameter 13cm, width 103cm, height 15cm). After one week, transfer them to an artificial climate chamber for further treatment. The chamber will be exposed to light at an intensity of 600 μmol·m⁻². -2 ·s -1 For control, 100 μmol·m -2 ·s -1Low light treatment was applied. The ambient temperature was set at 28℃, the outlet air temperature at 18℃, the relative humidity at 70-80%, and the photoperiod at 12 / 12h. Phenotypic results were measured after 15 days to screen low-light-tolerant and low-light-sensitive tomato inbred lines. The screening criteria for low-light-tolerant tomato inbred lines were as follows: maximum photochemical efficiency (Fv / Fm) > 0.79, non-photochemical quenching value (NPQ) < 0.20, and quenching value of photosynthetic inhibition damage (qL) < 0.62. The screening criteria for low-light-sensitive tomato inbred lines were as follows: maximum photochemical efficiency (Fv / Fm) ≤ 0.79, non-photochemical quenching value (NPQ) ≥ 0.20, and quenching value of photosynthetic inhibition damage (qL) ≥ 0.62. Following the methods and standards described above, this embodiment screened out the low-light-tolerant tomato inbred line 'GC303' and the low-light-sensitive tomato inbred line 'LA2838'. The test results for 'GC303' and 'LA2838' are as follows: Figure 1 As shown in Table 1. Subsequent studies on seedling morphology and physiology under low-light conditions were conducted using 'GC303' and 'LA2838' as experimental materials.
[0067] Table 1. Phenotypic results of tomato inbred lines (n=20)
[0068] Phenotype GC303 LA2838 Maximum photochemical efficiency of leaves (Fv / Fm) 0.81 0.64 Non-photochemical quenching value (NPQ) 0.13 0.23 Quenching value of photosynthetic inhibition damage (qL) 0.57 0.69
[0069] 3. Genetic analysis
[0070] Using 'GC303' as the male parent and 'LA2838' as the female parent, F1 was obtained through hybridization. F1 plants were then self-crossed to obtain the F2 population. In the F2 population, the low-light tolerance phenotype was investigated following step 2. Principal component analysis was used to calculate the eigenvectors and obtain the comprehensive evaluation value of the tomato F2 population. The results showed that low-light tolerant plants exhibited significantly increased fruit size and leaf dry weight. Further investigation of segregating population traits revealed that the F2 population showed a low-light sensitivity ratio (218 plants): a low-light tolerance ratio (82 plants) of 3:2 (R0). 2 =0.8711), indicating that the low-light tolerance trait of the low-light tolerant tomato inbred line 'GC303' is controlled by one pair of recessive genes.
[0071] Example 2
[0072] 1. Locating the gene for low light tolerance in tomatoes
[0073] (1) Establishment of light-sensitive and light-resistant DNA mixing pools
[0074] Using 'GC303' as the male parent and 'LA2838' as the female parent, F1 was obtained through hybridization. F1 was then self-crossed to obtain the F2 population. 436 plants of the F2 population were planted in a greenhouse, one plant per hole. When the plants had two leaves and a central bud, they were transplanted into flowerpots (18cm top diameter, 13cm bottom diameter, 103cm width, 15cm height). After one week, they were transferred to an artificial climate chamber for treatment under a light intensity of 600 μmol·m². -2 ·s -1 For control, 100 μmol·m -2 ·s -1 Low light treatment was applied. The ambient temperature was set at 28℃, the outlet air temperature at 18℃, the relative humidity at 70-80%, and the photoperiod at 12 / 12h. After 15 days, the phenotype was measured, and 50 plants each of extremely low light tolerant plants (ST) and low light sensitive plants (SS) were selected. DNA was extracted from each plant using the conventional CTAB method. The DNA concentration was detected using a Thermo Nanodrop 2000, and the purity and integrity of the DNA were detected by 1% agarose gel electrophoresis. After passing the tests, the DNA from the 50 low light tolerant plants and the 50 low light sensitive plants were mixed in equal amounts to form low light tolerant DNA pools and low light sensitive DNA pools with a final concentration of 40 ng / μL, respectively.
[0075] (2) BSA combined with RNA-seq analysis to locate resistance genes
[0076] By combining BSA-Seq and GBTS genotyping, the regulatory gene was located on chromosome 10, and a 17kb candidate region was screened. Eleven candidate genes were identified within this region. Through gene annotation and transcriptome analysis, a candidate gene, MCS1, encoding a magnesium subfamily protein of chelases, was identified. (See details...) Figure 2 and Figure 3 ;in, Figure 2 The black line represents the SNP index plot, the red line represents the probability value with a 99% confidence level (P<0.01), the blue box represents the target genome region that controls leaf color, the horizontal axis represents chromosome position, and the vertical axis represents the ED value. The larger the ED value, the stronger the association. Figure 3 Image A shows the development of SNP molecular markers within the low-light tolerance region of the tomato QTL; Image B shows a heatmap of gene expression levels within the candidate region in the low-light tolerance tomato inbred line 'GC303' and the low-light sensitivity tomato inbred line 'LA2838'.
[0077] (3) Development of SNP site variations
[0078] Further analysis using simplified genome sequencing revealed a non-synonymous SNP mutation at position 2361 bp in the coding region of the MCS1 gene on chromosome 10 of the tomato genome. The nucleotide changed from G to A, and lysine was changed to arginine. Figure 4 ).
[0079] 2. Molecular marker amplification
[0080] Using low-light-tolerant DNA mixtures and low-light-sensitive DNA mixtures as templates, PCR amplification was performed using the upstream primer (5'-CACGGTTAGGTCTTTGGTGGA-3', SEQ ID NO:3) and the downstream primer (5'-TACTTCCAGAAATAAAAGTTATTTCTGG-3', SEQ ID NO:4). The molecular marker amplification products were then subjected to polyacrylamide gel electrophoresis (PAGE). The PCR amplification system, in 10 μL volumes, included: 8 μL of 10 μmol / L SNP Primer Mix solution, 2 ng of genomic DNA, and the remainder sterile water. The concentration ratio of upstream primer to downstream primer in the Mix solution is 1:1. The PCR amplification procedure is as follows: Denaturation: First, the reaction mixture containing the DNA sample to be amplified is heated in a high-temperature environment (>91℃) for 1 minute to denature the double-stranded DNA; Annealing: Then, the reaction temperature is lowered (about 55℃) to allow the oligonucleotide primers to anneal with the two single-stranded template DNAs; Extension: The temperature of the reaction mixture is raised to about 72℃ and kept at that temperature for 1 minute. Under the action of DNA polymerase, deoxyribonucleoside triphosphate is added from the 3' end of the primer and extended along the template molecule in the 5'→3' direction to synthesize a new complementary DNA strand; Cycling: The above denaturation, annealing and extension steps are repeated, usually for 25 to 35 cycles.
[0081] 3. Recovery, cloning, and sequencing
[0082] (1) Cut the molecular marker amplification fragment from the polyacrylamide gel, place it in a centrifuge tube, crush it with a pipette tip, rinse it three times with ultrapure water, then add 10 μL of ultrapure water and incubate it in a 95°C water bath for 15 min, and then quickly centrifuge to collect the supernatant.
[0083] (2) Using the recovered supernatant as a template, PCR amplification was performed using the upstream primer (SEQ ID NO:3) and the downstream primer (SEQ ID NO:4). The reaction system for 50 μL PCR amplification was as follows: 5 μL of recovered supernatant (containing DNA), 5 μL of 10×Taq DNA polymerase buffer, 3 μL of 25 mM MgCl2, 1.2 μL of upstream primer (10 μM), 1.2 μL of downstream primer (10 μM), 4 μL of 2.5 mM dNTP, 0.4 μL of 5 U / μL Taq enzyme, and ddH2O to a final volume of 50 μL. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ final extension for 5 min. 20 μL of PCR product was extracted from each sample and separated by 2% agarose gel electrophoresis. The target fragment was excised under UV light and placed into a 1.5 mL centrifuge tube. DNA was recovered according to the instructions of the DNA Gel Extraction Kit (Beijing TransGen Biotech Co., Ltd.). The recovered PCR product was ligated into pMD19-T Simple vector (Takara Biotech Co., Ltd.) and transformed into *E. coli* DH5α competent cells using the heat shock method. The DNA was extracted from cells coated with Amp (100 μg / mL). -1 X-gal (20 μg·mL) -1 ) and IPTG ((40 μg·mL -1 White colonies containing recombinants were selected from LB agar plates. PCR amplification was performed using primers RV-M (5'-GAGCGGATAACAATTTCACACAGG-3', SEQ ID NO:5) and M13-47 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3', SEQ ID NO:6). PCR products were detected by 1.2% agarose gel electrophoresis to verify positive clones. The 25 μL PCR reaction system consisted of 2.5 μL of 10×Taq DNA polymerase buffer, 1.5 μL of 25 mM MgCl2, 0.5 μL each of primers RV-M (10 μM) and M13-47 (10 μM), and 2.5 mM dNTPs. 2 μL, 0.2 μL of 5 U / μL Taq enzyme, E. coli single colony as template, ddH2O added to 25 μL; PCR reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ final extension for 5 min.
[0084] (3) Positive clones were selected and sent to Shanghai Sangon Biotech for sequencing. The sequencing results showed that the nucleotide sequence of the molecular marker corresponding to the weak light resistant DNA pool was as shown in SEQ ID NO:7, specifically: 5'-TTGTGTCTTTTGCTGAATGTAATAGATCCAAAGATTGGAGGCGTGATGAT TATGGGTGATAGAGGAACTGGGAAGTCCACCACGGTTAGGTCTTTGGTGGATTACTTCCAGAAATAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCA GATGACCAAGAAGTAATGAGCGCTGAAGTCCGTGACAAATTGAGGAAGG-3';
[0085] The nucleotide sequence of the molecular marker corresponding to the weak light-sensitive DNA pool is shown in SEQ ID NO:8, specifically: 5'-TTGTGTCTTTTGCTGAATGTAATAGATCCAAAGATTGGAGGCGT GATGATTATGGGTGATAGAGGAACTGGGAAGTCCACCACGGTTAGGTCTTTGGTGGAGTACTTCCAGAAATAAAAGTTATTTCTGGTGATCCATTTAATTCAGATCCAGATGACCAAGAAGTAATGAGCGCTGAAGTCCGTGACAAATTGAGGAAGG-3'.
[0086] 4. Development of KASP molecular marker primers
[0087] Based on the SNP variant sites recorded in step 1 and the sequencing results in step 3, and following the KASP design principles, KASP primers were designed by Zhongyu Gold Labeling (Beijing) Biotechnology Co., Ltd. (http: / / www.cgmb.com.cn / index.php / Home / Index / ke_suc_case_xiangqing?id=45). Two forward primers, WTS-1-F1 and WTS-1-F2, and a reverse primer, WTS-1-R, were designed, with the following nucleotide sequences:
[0088] WTS-1-F1: 5'-CACGGTTAGGTCTTTGGTGGAT-3', SEQ ID NO: 9;
[0089] WTS-1-F2: 5'-CACGGTTAGGTCTTTGGTGGAG-3', SEQ ID NO: 10;
[0090] WTS-1-R: 5'-TCAGGCTCATTACTTCTTGGTC-3', SEQ ID NO: 11;
[0091] The FAM fluorescent adapter sequence was ligated to the 5' end of the WTS-1-F1 primer, and the HEX fluorescent adapter sequence was ligated to the 5' end of the WTS-1-F2 primer, resulting in forward primer 1 and forward primer 2. The primer sequences after ligating the fluorescent adapters are as follows:
[0092] Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT CACGGTTAGGTCTTTGG TGGAT-3' (SEQ ID NO: 12, where the underlined portion is the FAM fluorescent tag sequence);
[0093] Forward primer 2: 5'- GAAGGTGAAACGGATCATGCT CACGGTTAGGTCTTTGG TGGG-3' (SEQ ID NO: 13, where the underlined part is the HEX fluorescent tag sequence);
[0094] The aforementioned forward primer 1, forward primer 2, and universal reverse primer WTS-1-R were used as KASP primer pairs for molecular marker detection.
[0095] Example 3
[0096] Genotyping and low-light tolerance identification of tomatoes
[0097] 1. Using existing tomato varieties (published in XuWeijie, Gong C, Mai PT, Li ZX, SunBJ & Li T. (2024). Genetic diversity and population structure analysis of 418 tomato cultivars based on single nucleotide polymorphism markers[J]. Frontiers in Plant Science, 2024, 11:484. (IF: 6.627; Biology Q2)) as experimental materials, the seeds were first soaked in warm water at 55℃, and then the tomato seeds were germinated at a constant temperature of 27℃. The tomato seeds were sown in 50-cell trays containing substrate (vermiculite and peat moss in a mass ratio of 1:2) for seedling cultivation. The seeds were watered with Yamazaki tomato-specific nutrient solution (purchased from Qiyue (Shanghai) Biotechnology Co., Ltd.) every 3 days. The management of each material was consistent during the period. When the seedlings have two leaves and one bud, they are transplanted into flowerpots (18cm upper diameter, 13cm lower diameter, 103cm width, and 15cm height). After one week, they are transferred to an artificial climate chamber with an ambient temperature of 28℃, an outlet air temperature of 18℃, a relative humidity of 70-80%, and a photoperiod of 12 / 12h. After 15 days, the phenotype is determined. DNA is extracted from each individual plant using the conventional CTAB method. The DNA concentration is detected using Thermo Nanodrop 2000, and the purity and integrity of the DNA are detected by 1% agarose gel electrophoresis. Once the DNA passes the test, it is used as a template for subsequent measurements.
[0098] 2. Using the genomic DNA from step 1 as a template, PCR amplification was performed using the KASP primer pair obtained in Example 2 to obtain the amplification products; wherein,
[0099] The PCR amplification system, in 10 μL volumes, includes: 8 μL of 10 μmol / L SNP PrimerMix solution, 2 ng of genomic DNA, and the remainder sterile water; the concentration ratio of forward primer 1, forward primer 2, and reverse primer in the SNP PrimerMix solution is 1:1:1.
[0100] The PCR amplification procedure is as follows: Denaturation: First, the reaction mixture containing the DNA sample to be amplified is heated at a high temperature (>91°C) for 1 minute to denature the double-stranded DNA; Annealing: Then, the reaction temperature is lowered (to about 55°C) to allow the oligonucleotide primers to anneal with the two single-stranded template DNAs; Extension: The temperature of the reaction mixture is raised to about 72°C and kept at that temperature for 1 minute. Under the action of DNA polymerase, deoxyribonucleoside triphosphates are added from the 3' end of the primers and extended along the template molecules in the 5'→3' direction to synthesize a new complementary DNA strand; Cycling: The above denaturation, annealing, and extension steps are repeated, usually for 25 to 35 cycles.
[0101] 3. After amplification, KASP detection was performed. Based on the relative fluorescence values, the samples were classified and statistically analyzed. The results are as follows: Figure 5 As shown in Table 2, the detailed typographic results for some varieties are as follows.
[0102] Table 2 Genotyping results for some varieties
[0103]
[0104]
[0105] According to Table 2 and Figure 5 It can be seen that the PCR product of the sample only detected the fluorescent signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence, so the genotype of the detection site is TT, and it is determined to be a light-tolerant single plant; the PCR product of the sample only detected the fluorescent signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence, so the genotype of the detection site is GG, and it is determined to be a light-sensitive single plant; the PCR product of the sample detected the fluorescent signals corresponding to both the forward primer 1 and the forward primer 2 connected to the fluorescent adapter sequence, so the genotype of the detection site is TG, and it is determined to be a normal single plant, with light sensitivity between light-tolerant and light-sensitive tomatoes.
[0106] As can be seen from the above, the technical solution provided by this invention can distinguish between light-tolerant tomatoes and light-sensitive tomato strains or varieties without large-scale light stress experiments, accurately screen light-tolerant tomatoes at an early stage, promote the breeding process of new light-tolerant tomato varieties, obtain tomato varieties with light-tolerant characteristics, and increase the yield of light-tolerant varieties under light conditions.
[0107] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A molecular marker closely linked to the low-light tolerance trait in tomatoes, characterized in that, The molecular marker is WTS-1, and the nucleotide sequence is shown in SEQ ID NO:14; wherein, the single nucleotide polymorphism at position 2361 bp of the nucleotide sequence shown in SEQ ID NO:14 is T / G.
2. A DNA fragment tightly linked to the low-light tolerance trait in tomatoes, characterized in that, The nucleotide sequence of the DNA fragment is shown in SEQ ID NO:1 or SEQ ID NO:2; In the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2, Y represents the base T / G.
3. A KASP primer pair for identifying the molecular marker of claim 1 or the DNA fragment of claim 2, characterized in that, It includes forward primer 1, forward primer 2, and reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO:9, and the 5' end of the nucleotide sequence shown in SEQ ID NO:9 contains fluorescent marker 1; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO:10, and the 5' end of the nucleotide sequence shown in SEQ ID NO:10 contains a fluorescent marker 2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:11; The fluorescent marker 1 and fluorescent marker 2 produce different colors.
4. The KASP primer pair according to claim 3, characterized in that, The fluorescent label 1 is a FAM label; the fluorescent label 2 is a HEX label.
5. A kit for identifying the molecular marker of claim 1 or the DNA fragment of claim 2, characterized in that, The kit contains the KASP primer pair as described in claim 3 or 4.
6. The use of the molecular marker of claim 1, the DNA fragment of claim 2, the KASP primer pair of claim 3 or 4, or the kit of claim 5 in one or more of the following: (1) To identify or assist in the identification of light-tolerant tomato strains or varieties; (2) Differentiate between light-tolerant tomato varieties and light-sensitive tomato strains or cultivars; (3) To cultivate or assist in the cultivation of light-tolerant tomato plants, strains, varieties or cultivars; (4) Screening or assisting in the screening of light-tolerant tomato plants, strains, varieties or cultivars.
7. A method for identifying tomatoes tolerant of low light, characterized in that, The steps include: Using the genomic DNA of the tomato to be identified as a template, PCR amplification was performed using the KASP primer pair described in claim 3 or 4 to obtain the amplification product; The amplification products were subjected to fluorescence detection, and the results were determined based on the fluorescence signal. If only the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result of the tomato to be identified is TT, and the tomato to be identified is a low-light tolerant tomato. If only the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result of the tomato to be identified is GG, and the tomato to be identified is a light-sensitive tomato. If fluorescence signals corresponding to both forward primer F1 and forward primer F2 are detected simultaneously, the genotyping result of the tomato to be identified is TG, and the tomato to be identified is a common tomato with low light sensitivity between low light tolerant tomatoes and low light sensitive tomatoes.
8. The method according to claim 7, characterized in that, The PCR amplification system, in 10 μL increments, includes: 8 μL of 10 μmol / L SNP Primer Mix solution, 2 ng of genomic DNA, and the remainder of sterile water; The concentration ratio of forward primer 1, forward primer 2, and reverse primer in the SNP Primer Mix solution is 1:1:
1.
9. The method according to claim 8, characterized in that, The PCR amplification program is as follows: denaturation at 91℃ for 1 min, annealing at 55℃ for 60 s, extension at 72℃ for 1 min, 25-35 cycles.
Citation Information
Patent Citations
Method for diagnostic marker development
AU2014203001A1
Method for identifying anti-late blight character of tomato and used molecular marker and primer thereof
CN105087802A