WNV detection nucleic acid product based on CRISPR / Cas12a system, kit and detection method
Through the combination of the CRISPR/Cas12a system and the fluorescence signal amplification mechanism, the rapid, sensitive and specific detection of West Nile virus is achieved, solving the problem of insufficient detection complexity and sensitivity in the prior art, and is suitable for miniaturized constant temperature fluorescence detectors.
Patent Information
- Application Number
- CN202510337712.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-04
AI Technical Summary
The existing West Nile virus detection technology has limitations in terms of sensitivity, specificity and operational complexity, and it is difficult to meet the needs of rapid, sensitive and specific detection.
The CRISPR/Cas12a system was used to amplify WNV virus through reverse transcription-recombinase-mediated strand replacement nucleic acid amplification (RT-RAA), and the amplified products were detected using CRISPR/Cas12a technology. Combined with the fluorescence signal amplification mechanism, rapid, sensitive and specific detection of WNV was achieved.
It simplifies the operation process, shortens the detection time, significantly improves the sensitivity and specificity of the detection. It is suitable for miniaturized constant temperature fluorescence detectors, without the need for variable temperature PCR amplification instruments, can detect WNV RNA as low as 10 copies/μL, and has no cross-reaction to other viral nucleic acids.
Smart Images

Figure CN120249556A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the technical field of molecular diagnosis, and particularly relates to a nucleic acid product, a kit, and a detection method for WNV detection based on the CRISPR / Cas12a system. Background Art
[0002] Arboviruses are a group of zoonotic viruses that use arthropods such as mosquitoes as vectors. Due to the unpredictable outbreaks and transmissions of arboviruses, many arboviruses can cause serious human diseases. These viruses are usually transmitted by vector insects such as mosquitoes and ticks, and many birds are also reservoir hosts of the virus. Their outbreaks are often accompanied by changes in the ecological environment, such as climate warming and poor water resource management. In addition, the accelerating globalization process and the increasingly frequent trade and population movements with neighboring countries also provide convenient conditions for the transmission of arboviruses. The symptoms caused by most arboviruses are not significantly specific and often manifest as flu-like symptoms such as fever, headache, and muscle pain, which makes early diagnosis extremely challenging and prone to confusion with other diseases. Therefore, establishing and stockpiling rapid and accurate detection technologies for important arboviruses in the Flaviviridae family is of great significance for the clinical diagnosis and epidemiological detection of arboviruses.
[0003] West Nile virus is classified in the Flaviviridae family and the Flavivirus genus. Its virus particles are spherical structures with a diameter of about 40 - 60 nm. The lipid bilayer membrane is wrapped by a nucleocapsid of about 25 nm and has an icosahedral symmetry structure. West Nile virus is a single-stranded positive-sense RNA virus, and its entire genome is about 11 Kbp in length, including a single open reading frame (ORF) of 10301 bp in size. The genomic RNA of West Nile virus has a type I cap structure (mGpppAmp) at the 5' end and does not contain a polyadenylate sequence (polyA) at the 3' end. Its genomic structure includes a 5' non-coding region, a single reading frame, and a 3' non-coding region. The single reading frame encodes three structural proteins (C, prM or M, E) and seven non-structural proteins (NS1, NS2a, NS2b, NS3, NS4a, NS4b, NS5). Among them, the C protein is the core protein, and the M and E proteins are envelope glycoproteins. The E protein has three domains in total and is the main antigenic structural protein of West Nile virus. The non-structural proteins mainly participate in virus replication. NS2a is involved in the assembly of virus particles and the release of infectious virus particles. NS3 and NS5 are two very conserved non-structural proteins and play important roles in the virus proliferation and replication process.
[0004] The West Nile virus (WNV) has two genotypes (genotype 1 and genotype 2). Genotype 1 is associated with human infections and is currently widespread in Europe, Asia, North America, Australia, India, the Middle East, as well as a few regions in West Africa and North Africa. It can cause severe symptoms and even central nervous system infections, with a relatively high mortality rate. Genotype 2 is mainly prevalent in Africa and Madagascar, causing milder human diseases, generally not invading the nervous system, and mainly causing endemic animal infections. The West Nile virus is an arbovirus, and the most important transmitter is mosquitoes. Birds are also the main sources of WNV infection. It multiplies abundantly in birds and forms a high-viremia virus load. Humans and other mammals are considered the "terminals" in the virus transmission path. Patients may present with symptoms similar to influenza such as headache and fever (West Nile fever), or symptoms of heatstroke and nervous system infections (West Nile encephalitis). In severe cases, it can cause the death of infected individuals, and the case fatality rate of this disease is 5-14%.
[0005] Currently, the diagnostic methods for this disease are mainly carried out in three aspects: etiology, serology, and molecular biology. Each detection method of WNV has its own characteristics and advantages, but also has its own limitations. Serological detection techniques include complement fixation test, neutralization test, hemagglutination inhibition test, and enzyme-linked immunosorbent assay (ELISA), which mainly detect specific antibodies against IgM and IgG. IgM antibodies can be detected 3-5 days after arbovirus infection, while IgG can be detected 7-10 days after infection. Therefore, IgM mainly serves as a marker for acute-phase infection, while IgG serves as a marker for late-stage infection and secondary infection. Although serological detection techniques are mature and widely used, their detection time is relatively long. Due to the small amount of antigen in the early stage of infection and the late appearance of antibodies, false positive and false negative results are prone to occur.
[0006] Virus isolation and identification is the gold standard for etiological diagnosis. It is not only used for disease diagnosis, but also can conduct in-depth analysis of the virus to obtain the main information of the virus, including virus source, genotype, variation, and evolution. Virus isolation and identification usually isolates the virus from tissues such as plasma, serum, urine, and cerebrospinal fluid of infected patients, inoculates it into specific cells for culture, and then uses means such as antigen-antibody and molecular biology for identification. Although virus isolation and identification has high specificity, its operation is complex, time-consuming, and requires high laboratory conditions.
[0007] Molecular biology diagnostic methods include gene chip and qPCR techniques. The detection principle of gene chip is to first immobilize probes on a support, and then hybridize sample molecules with the probes. The content and sequence information of sample molecules are obtained by detecting the hybridization signal intensity of each probe molecule. Gene chip technology is suitable for large-scale screening and gene expression analysis, but its sensitivity and specificity depend on probe design and the cost is relatively high. qPCR technology amplifies the target nucleic acid sequence through specific primers and uses fluorescent dyes or probes to real-time monitor the accumulation of amplification products, so as to achieve quantitative analysis of specific DNA or RNA sequences. qPCR technology has the advantages of high sensitivity, high specificity and accurate quantification, but the experiment requires expensive instrument equipment and the operation requires the participation of professional personnel, and the detection cost is relatively high.
[0008] In summary, the existing detection technologies have limitations in terms of sensitivity, specificity, detection time and operation complexity, and it is difficult to fully meet the requirements of rapid, sensitive and specific detection of arboviruses. Therefore, developing a detection method that can simplify the operation process, shorten the detection time, and has high sensitivity and high specificity has become the key to solving the problems of the existing technologies. Summary of the Invention
[0009] Based on this, an embodiment of the present application provides a WNV detection nucleic acid product, kit and detection method based on the CRISPR / Cas12a system.
[0010] On the one hand, the present application provides a nucleic acid product, which includes one or more of the following 1) and 2);
[0011] 1) crRNA and a fluorescent reporter probe with a nucleic acid sequence as shown in any one of SEQ ID NO.6 to SEQ ID NO.8; and
[0012] 2) A primer set with a nucleic acid sequence as shown in SEQ ID NO.4 to SEQ ID NO.5.
[0013] In some embodiments, the fluorescent reporter probe has a nucleic acid sequence as shown in SEQ ID NO.9.
[0014] In some embodiments, the fluorescent reporter probe is labeled with a fluorescent group and a quenching group.
[0015] In some embodiments, the fluorescent group includes one or more of FAM, ROX, HEX, CY5, TET, JOE, Cy3, Cy7, RED610, TexasRed, RED670 and NED.
[0016] In some of these embodiments, the quenching group includes one or more of TAMRA, Dabcyl, and BHQ.
[0017] In some of these embodiments, the BHQ includes one or both of BHQ1 and BHQ2.
[0018] On the other hand, this application provides the use of the above nucleic acid product in the preparation of a kit for detecting West Nile virus.
[0019] On the other hand, this application provides a kit, which includes the above nucleic acid product.
[0020] In some of these embodiments, the kit further includes Cas12a.
[0021] In some of these embodiments, the Cas12a includes LbCas12a.
[0022] In some of these embodiments, the kit includes one or more of an RT-RAA amplification composition and a CRISPR-Cas12a trans-cleavage composition.
[0023] In some of these embodiments, the RT-RAA amplification composition includes one or more of a primer set having nucleic acid sequences as shown in SEQ ID NO.4 to SEQ ID NO.5 and an amplification reagent.
[0024] In some of these embodiments, the CRISPR-Cas12a trans-cleavage composition includes one or more of the crRNA, the fluorescent reporter probe, the Cas12a, and a trans-cleavage reagent.
[0025] On the other hand, this application provides a method for detecting West Nile virus, which includes detecting West Nile virus in a sample using the above nucleic acid product or the above kit.
[0026] In some of these embodiments, it includes:
[0027] Using an RT-RAA system including the primer set to reverse-transcribe and amplify the RNA of the sample to prepare an amplification product; and, mixing a CRISPR-Cas12a trans-cleavage composition including the crRNA and the fluorescent reporter probe with the amplification product to form a CRISPR-Cas12a trans-cleavage system and reacting, and detecting the fluorescence signal.
[0028] In some of these embodiments, the amplification satisfies one or more of the following conditions (1) to (2):
[0029] (1) The temperature is 39°C to 42°C, and the time is 15 min to 40 min; and,
[0030] (2) In the initial system of the amplification reaction, the concentration of the primer is 0.3 μM to 0.8 μM;
[0031] In some of these embodiments, the trans-cleavage detection reaction satisfies one or both of the following conditions (1) to (2):
[0032] (1) The temperature is 36°C to 38°C and the time is 15 min to 60 min; and
[0033] (2) In the initial system of the trans-cleavage, the concentration of the crRNA is 200 nM to 250 nM; the concentration of the fluorescent reporter probe is 0.5 μM to 1 μM;
[0034] In some of these embodiments, detecting the fluorescence signal includes:
[0035] Setting the excitation wavelength and the emission wavelength; and
[0036] Collecting the fluorescence signal every 15 s to 30 s, reacting at 36°C to 38°C for 15 min to 60 min, detecting the change in the fluorescence signal intensity, and making a fluorescence curve.
[0037] Details of one or more embodiments of the present application are set forth in the following description, and other features, objects, and advantages of the present application will become apparent from the specification and its claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its beneficial effects, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative efforts.
[0039] Figure 1 It is a result diagram of screening 3 candidate crRNAs by CRISPR fluorescence method;
[0040] Figure 2 It is a comparison diagram of the fluorescence values of 3 crRNAs containing West Nile virus at 15 min;
[0041] Figure 3 It is a fluorescence diagram of the detection sensitivity of CRISPR / Cas12a of crRNA03 containing West Nile virus;
[0042] Figure 4 It is a comparison diagram of the detection sensitivity results of CRISPR / Cas12a of crRNA03 containing West Nile virus at 15 min;
[0043] Figure 5 It is a cross - reaction fluorescence image where crRNA03 against West Nile virus shows no specific signal when detecting other pathogens;
[0044] Figure 6 It is a comparison chart of cross - reaction results where crRNA03 against West Nile virus shows no specific signal when detecting other pathogens at 15 minutes;
[0045] Figure 7 It is a comparison chart of the repeatability results of CRISPR / Cas12a detection of crRNA03 against West Nile virus with different concentrations at 15 minutes. Detailed implementation manners
[0046] The present application will be further described in detail below in combination with the implementation manners and examples. It should be understood that these implementation manners and examples are only used to illustrate the present application and not to limit the scope of the present application. The purpose of providing these implementation manners and examples is to make the understanding of the disclosed content of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms and is not limited to the implementation manners and examples described herein. Those skilled in the art can make various changes or modifications without departing from the connotation of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. In addition, in the following description, a large number of specific details are given to provide a more thorough understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.
[0047] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by those skilled in the technical field to which the present application belongs.
[0048] Terms
[0049] Unless otherwise stated or there is a contradiction, the terms or phrases used herein have the following meanings:
[0050] As used herein, the alternative ranges of the terms "and / or", "or / and", and "and / or" include any one of two or more related listed items, as well as any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctive combinations selected from "and / or", "or / and", and "and / or", it should be understood that in this application, this technical solution undoubtedly includes the technical solution connected by "logical AND", and undoubtedly also includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example is the technical solution of "A, and / or, B, and / or, C, and / or, D", which includes any one of A, B, C, and D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, combinations of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution connected by "logical AND").
[0051] In this application, the terms "multiple", "multiple types", "multiple times", "multiple elements", etc. refer to a quantity greater than 2 or equal to 2 if not otherwise specified. For example, "one or more types" means one type or two or more types.
[0052] As used herein, "its combinations", "any of its combinations", "any combination mode thereof", etc. include all suitable combination modes of any two or more than two of the listed items.
[0053] In this document, the "suitable" in "suitable combination mode", "suitable mode", "any suitable mode", etc. is subject to being able to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.
[0054] In this application, terms such as "further", "even further", "especially", etc. are used for descriptive purposes, indicating differences in content, but should not be construed as limiting the scope of protection of this application.
[0055] In this application, "optionally", "optional", "optional" mean that it can be there or not, that is, it refers to any one of the two parallel options of "yes" or "no". If "optional" appears multiple times in a technical solution, without special instructions and without contradictions or mutual restrictions, each "optional" is independent.
[0056] In this application, for the technical features described in an open-ended manner, it includes the closed technical solutions composed of the listed features, as well as the open technical solutions containing the listed features.
[0057] In this application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the selectable numerical values are considered continuous within the above numerical intervals, and include the two numerical endpoints (i.e., the minimum value and the maximum value) of the numerical range, as well as each numerical value between these two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer. For example, when t is an integer selected from 1 to 10, it means that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed in this article should be understood to include any and all sub-ranges subsumed therein.
[0058] The temperature parameter in this application, unless otherwise specified, allows for both constant temperature treatment and variation within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.
[0059] In this application, %(w / w) and wt% both represent weight percentages, %(v / v) refers to volume percentages, and %(w / v) refers to mass-volume percentages.
[0060] All documents mentioned in this application are cited as references in this application, just as if each document was cited separately as a reference. Unless it conflicts with the inventive purpose and / or technical solution of this application, the cited documents involved in this application are cited for all their contents and all their purposes. When this application involves cited documents, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When this application involves cited documents, the examples and preferred methods of the relevant technical features cited can also be incorporated as references into this application, but only to the extent that this application can be implemented. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or be amended adaptively according to the description in this application.
[0061] The term "crRNA" (CRISPR RNA) is a key component in the CRISPR-Cas system, mainly responsible for guiding the Cas protein to recognize and bind to specific target nucleic acid sequences. It is initially transcribed in the form of pre-crRNA (precursor crRNA), and then processed and matured into a functional crRNA.
[0062] In this application, the West Nile virus (WNV) is amplified by Reverse Transcription-Recombinase-aided Amplification (RT-RAA), and then the amplified product is detected using the CRISPR / Cas12a technology.
[0063] The basic principle is as follows: First, RNA is reverse transcribed into cDNA by reverse transcriptase. Then, the recombinase binds to the primer DNA fragment at room temperature to form a recombinase / primer complex, which invades the RNA-cDNA double-stranded nucleic acid template. At the invasion site, the recombinase unwinds the double strand, and at the same time, the single-stranded DNA-binding protein (SSB) binds to the unwound single strand to maintain the open-chain state of the double-stranded template. At this time, the recombinase / primer complex scans the template to find a complementary sequence that exactly matches the primer. Once a matching complementary sequence is found, the recombinase / primer complex dissociates, and the strand-displacement DNA polymerase immediately undergoes a strand-exchange reaction to initiate DNA synthesis and exponentially amplify the target region. After the target amplification is completed, LbCas12a forms a ternary complex with the crRNA designed to specifically target the target sequence and the target sequence, and non-specifically cleaves the single-stranded DNA fluorescent reporter probe (ssDNA 8C-FQ) in the reaction system to generate a fluorescent signal. By detecting the intensity of the fluorescent signal, the presence and concentration of the target nucleic acid can be indicated.
[0064] On the one hand, this application provides a nucleic acid product, which includes one or more of the following 1) and 2);
[0065] 1) crRNA and a fluorescent reporter probe with a nucleic acid sequence as shown in any one of SEQ ID NOs. 6 to 8; and 2) a primer set with a nucleic acid sequence as shown in SEQ ID NOs. 4 to 5.
[0066] This application provides a nucleic acid product that can specifically recognize and cleave the WNV nucleic acid sequence by guiding the Cas12a protein with crRNA, and combined with the fluorescent signal amplification mechanism, realizes the rapid, sensitive, and specific detection of WNV.
[0067] WNV-crRNA01 (SEQ ID NO.6):
[0068] AAUUUCUACUCUUgUAgAUUgAACCACgAUCAgggAUUgACA
[0069] WNV-crRNA02 (SEQ ID NO.7):
[0070] AAUUUCUACUCUUgUAgAUgAACAAAgACgUUCUUggUCCAU
[0071] WNV-crRNA03 (SEQ ID NO.8):
[0072] AAUUUCUACUCUUgUAgAUAAgAACCACACgCCACgAAgCAg
[0073] WNV-RAA-F: TGCTGGAAGTACTGTGTGGAGGAACAGAGAGA (SEQ ID NO.4)
[0074] WNV-RAA-R: GCCAAAGCTTGATGCAGAGCTCCCTCTTGTGA (SEQ ID NO.5)
[0075] In some of these embodiments, the above-mentioned fluorescent reporter probe comprises a nucleic acid sequence as shown in SEQ ID NO.9.
[0076] SEQ ID NO.9: CCCCCCCC.
[0077] In some of these embodiments, the above-mentioned fluorescent reporter probe is labeled with a fluorescent group and a quenching group.
[0078] Optionally, the fluorescent group comprises one or more of FAM, ROX, HEX, CY5, TET, JOE, Cy3, Cy7, RED610, TexasRed, RED670, and NED;
[0079] Optionally, the quenching group comprises one or more of TAMRA, Dabcyl, and BHQ.
[0080] In some of these embodiments, the above-mentioned BHQ comprises one or both of BHQ1 and BHQ2.
[0081] On the other hand, the present application provides the use of the above-mentioned nucleic acid product in the preparation of a kit for detecting West Nile virus.
[0082] On the other hand, the present application provides a kit for detecting West Nile virus, which comprises the above-mentioned nucleic acid product as claimed.
[0083] In some of these embodiments, it further comprises Cas12a.
[0084] In some of these embodiments, the above-mentioned Cas12a includes LbCas12a. LbCas12a (Cas12a protein from Lachnospiraceae bacteria) is a type II-V CRISPR effector protein. Guided by crRNA, LbCas12a can specifically recognize target sites with a PAM sequence of TTTV and form double-stranded DNA breaks (DSBs) on the target sequence, generating 5'-overhanging sticky ends. Compared with Cas9, the crRNA of LbCas12a is shorter (about 42 nt), which is easy to synthesize in vitro, and its cleavage site is far from the PAM sequence, making it suitable for multiple cleavage and large fragment deletion.
[0085] In some of these embodiments, it includes one or more of an RT-RAA amplification composition and a CRISPR-Cas12a trans-cleavage composition.
[0086] In some of these embodiments, the above-mentioned RT-RAA amplification composition includes a primer set with nucleic acid sequences as shown in SEQ ID NO.4 to SEQ ID NO.5.
[0087] In some of these embodiments, the above-mentioned CRISPR-Cas12a trans-cleavage composition includes one or more of the above-mentioned crRNA, the above-mentioned fluorescent reporter probe, and the above-mentioned Cas12a.
[0088] In some of these embodiments, the above-mentioned kit further includes one or more of a nucleic acid release reagent, a nucleic acid extraction reagent, a nucleic acid amplification reagent, and a transcription reagent.
[0089] On the other hand, the present application provides a method for detecting West Nile virus, including using the above-mentioned nucleic acid product or the above-mentioned kit to detect a sample.
[0090] Compared with the prior art, the detection method of the present application significantly simplifies the operation process, shortens the detection time, and greatly improves the detection sensitivity and specificity, having good potential for on-site application. Overall, the present invention is superior to the existing serological detection, virus isolation and identification, and molecular biology diagnostic methods in terms of operation simplicity, detection efficiency, and accuracy, providing a more efficient and reliable technical means for the rapid diagnosis and detection of WNV.
[0091] It can be understood that the detection method of the present application includes disease diagnosis or non-diagnostic purposes. For example, the situation analysis of West Nile virus or related applications in occasions such as epidemic prevention and security inspection.
[0092] In some of these embodiments, the detection includes: amplifying the RNA of the sample using an RT-RAA system containing the above-mentioned primer set to prepare an amplification product; and,
[0093] Mix the above CRISPR-Cas12a trans-cleavage composition with the above amplification product to form a CRISPR-Cas12a trans-cleavage system, and react to detect the fluorescence signal.
[0094] In some of these embodiments, the amplification temperature is 39°C to 42°C and the time is 15 min to 40 min. For example, the temperature is 39°C, 40°C, 41°C or 42°C and any value in between, and for example, the time is 15 min, 16 min, 17 min, 18 min, 19 min, 20 min, 21 min, 22 min, 23 min, 24 min, 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min, 35 min, 36 min, 37 min, 38 min, 39 min or 40 min and any value in between.
[0095] In some of these embodiments, in the initial system of the amplification reaction, the concentration of the primer is 0.3 μM to 0.8 μM. For example, the primer concentration is 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM or 0.8 μM and any value in between.
[0096] In some of these embodiments, the temperature of the trans-cleavage reaction is 36°C to 38°C and the time is 15 min to 60 min. For example, the temperature is 36°C, 37°C or 38°C and any value in between. For example, the time is 15 min, 16 min, 17 min, 18 min, 19 min, 20 min, 21 min, 22 min, 23 min, 24 min, 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min, 35 min, 36 min, 37 min, 38 min, 39 min, 40 min, 41 min, 42 min, 43 min, 44 min, 45 min, 46 min, 47 min, 48 min, 49 min, 50 min, 51 min, 52 min, 53 min, 54 min, 55 min, 56 min, 57 min, 58 min, 59 min or 60 min and any value in between.
[0097] In some of these embodiments, in the initial system of trans - cleavage, the concentration of crRNA is 200 nM to 250 nM; the concentration of the fluorescent reporter probe is 0.5 μM to 1 μM. For example, the concentration of crRNA is 200 nM, 201 nM, 202 nM, 203 nM, 204 nM, 205 nM, 206 nM, 207 nM, 208 nM, 209 nM, 210 nM, 211 nM, 212 nM, 213 nM, 214 nM, 215 nM, 216 nM, 217 nM, 218 nM, 219 nM, 220 nM, 221 nM, 222 nM, 223 nM, 224 nM, 225 nM, 226 nM, 227 nM, 228 nM, 229 nM, 230 nM, 231 nM, 232 nM, 233 nM, 234 nM, 235 nM, 236 nM, 237 nM, 238 nM, 239 nM, 240 nM, 241 nM, 242 nM, 243 nM, 244 nM, 245 nM, 246 nM, 247 nM, 248 nM, 249 nM or 250 nM and any value in between.
[0098] For example, the concentration of the fluorescent reporter probe is 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM or 1 μM and any value in between.
[0099] In some of these embodiments, detecting the fluorescence signal includes:
[0100] Setting the excitation wavelength and the emission wavelength; and collecting the fluorescence signal every 15 s to 30 s, reacting at 36 °C to 38 °C for 15 min to 60 min, detecting the change in the intensity of the fluorescence signal, and making a fluorescence curve.
[0101] For example, the fluorescence signal is collected every 15 s, 16 s, 17 s, 18 s, 19 s, 20 s, 21 s, 22 s, 23 s, 24 s, 25 s, 26 s, 27 s, 28 s, 29 s, or 30 s, the temperature is 36 °C, 37 °C, or 38 °C and any value in between, and the time is 15 min, 16 min, 17 min, 18 min, 19 min, 20 min, 21 min, 22 min, 23 min, 24 min, 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min, 35 min, 36 min, 37 min, 38 min, 39 min, 40 min, 41 min, 42 min, 43 min, 44 min, 45 min, 46 min, 47 min, 48 min, 49 min, 50 min, 51 min, 52 min, 53 min, 54 min, 55 min, 56 min, 57 min, 58 min, 59 min, or 60 min and any value in between.
[0102] The nucleic acid composition, kit, and detection method provided by this application have the following effects:
[0103] Simple instrument requirements: RT-RAA isothermal amplification and CRISPR / Cas12a trans-cleavage fluorescence reporter probes only require a constant-temperature fluorescence detection device and do not require a variable-temperature PCR amplifier, and are applicable to various models of miniaturized constant-temperature fluorescence detectors.
[0104] High sensitivity: The lowest detection sensitivity is 10 copies / μL, that is, the concentration of West Nile virus RNA as low as 10 copies can be detected per cycle, realizing trace and low-copy detection of West Nile virus.
[0105] Good specificity: Specifically detect West Nile virus nucleic acid, and there is no detection signal for the nucleic acids of other viruses such as dengue virus, West Nile virus, yellow fever virus, Zika virus, and chikungunya virus.
[0106] Good repeatability: The WNV target nucleic acid detection templates with concentrations of 1.0×10 5 copies / μL and 1.0×10 1 copies / μL were repeatedly detected 10 times, and the results were all positive, and the data uniformity results were good.
[0107] The implementation scheme of the present application will be described in detail below in conjunction with embodiments. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specific conditions noted in the following embodiments, the guidance given in the present application shall be preferentially referred to. It can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturer, or by referring to the experimental methods known in the art.
[0108] In the following specific embodiments, for the measurement parameters of raw material components, if there is no special instruction, there may be slight deviations within the weighing accuracy range. For the temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.
[0109] It should be understood that in various embodiments of the present application, the magnitudes of the serial numbers of the above processes do not mean the sequence of execution. The execution sequence of each process should be determined by its function and internal logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.
[0110] For those without specific technologies or conditions noted in the embodiments, they are all carried out according to the technologies described in the literature in the art (such as referring to "Molecular Cloning: A Laboratory Manual" by J. Sambrook et al., translated by Huang Peitang et al., the third edition, Science Press) or according to the product instructions. The materials, reagents, etc. used in the following embodiments, if not otherwise specified, can be obtained from commercial channels.
[0111] In the quantitative experiments in the following embodiments, three repeated tests are set, and the results are averaged.
[0112] The reagents involved in the following embodiments and their sources are as follows:
[0113] Fast Pure Plasmid Mini Kit (Vazyme, DC201-01), Ampicillin Sodium Salt (BioFroxx, 69-52-3), Phanta Super-Fidelity DNA Polymerase (Vazyme, P501-d1), 2×Phanta Max Master Mix (Vazyme, P515-01), dNTP Mix (10 mM each), Agarose (Biomed, SH441-01), Gel Red (APExBIO, A8746), Universal DNA Purification Kit (TIANGEN, DP214-03), T7 RNA Polymerase (NEB, 50 U / μL, M0251L), 10×RNA Polymerase Reaction Buffer (NEB, B9012S), NTP Mix (10 μM) (BBI, B600056-0500), Recombinant RNase Inhibitor (TaKaRa, 40 U / μL, 2313A), Recombinant DNaseI (TaKaRa, 5 U / μL, 2270A), 10×DNase I Buffer (TaKaRa, AL62500A), RNA Clean&Concentrator TM-5 (ZYMO RESEARCH, R1016), RT-RAA Nucleic Acid Amplification Reagent (Zhongce Bio, S003ZC), 10×NEBuffer3.1 (NEB, B7203S).
[0114] Single-stranded ssDNA-FQ fluorescence reporter probe: The sequence is 5’(6)-FAM-CCCCCCCC (SEQ ID NO.9)-3’-BHQ1, synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0115] The other five viruses are Dengue virus (GeneBank: OQ821371.1), Zika virus (GeneBank: OQ661917.1), Chikungunya virus CHIKV (Genebank: OR037305.2), Japanese encephalitis virus JEV (Genebank: MT134112.1), Yellow fever virus YFV (Genebank: MN119486.1). The virus plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0116] Example 1 West Nile virus nucleic acid detection kit and detection method based on CRISPR / Cas12a system
[0117] (1) Preparation of WNV virus RNA
[0118] 1. Plasmid sequence
[0119] Search for the nucleic acid sequence of West Nile virus WNV in the Genebank database, select a partial sequence as the WNV target sequence fragment (GeneBank: JX442281.1), insert it into the pUC57 vector to construct a recombinant plasmid, and it is synthesized by Sangon Biotech (Shanghai) Co., Ltd.;
[0120] The information of the WNV target nucleic acid sequence (SEQ ID NO.1) is as follows:
[0121] CTCCTGCGGCGCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGATTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGATCTCAACCTCCCTGGAGTAGTGCTGGAAGTACTGTGTGGAGGAACAGAGAGACGTTAATGGAGTTTGAAGAACCACACGCCACGAAGCAGTCTGTGATAGCATTGGGCTCACAAAGAGGGAGCTCTGCATCAAGCTTTGGCTGGAGCCATTCTGTGGAATTTTCAAGCAGCACTGTCAAGTTGACTTCGGGTCATTGAAGTGTAGAGTGAAGATGG
[0122] 2. Plasmid extraction and acquisition
[0123] Take 5 μL of the glycerol bacteria from which the required plasmid will be obtained from the above-mentioned company and spread it on an ampicillin-resistant plate. Pick a monoclonal colony on the plate and inoculate it into 5 mL of LB culture medium containing ampicillin resistance, and shake the bacteria overnight at 37 °C and 220 rpm. Aliquot the overnight culture into 2 mL centrifuge tubes, centrifuge at 13,000 rpm for 2 min, discard the supernatant, and invert the tubes onto absorbent paper to suck out all the residual liquid. Add 250 μL of Buffer P1 (RNase A enzyme has been added) to the centrifuge tube with the cell pellet, and mix well using a pipette or vortex oscillator. Then add 250 μL of Buffer P2 and gently invert the tube 10 - 15 times to fully lyse the cells, taking no more than 5 min. Then add 350 μL of Buffer P3 and immediately gently invert the tube 10 - 15 times, and a white flocculent precipitate will appear. Then centrifuge at 13,000 rpm for 10 min. Place the FastPure DNA Mini Column adsorption column into a 2 mL Collection Tube, carefully transfer the supernatant after the above centrifugation to the adsorption column using a pipette, being careful not to aspirate the precipitate, centrifuge at 13,000 rpm for 1 min, and then discard the waste liquid in the collection tube. Place the adsorption column back into the collection tube again. Add 500 μL of Buffer PW1 to the adsorption column, centrifuge at 13,000 rpm for 1 min, discard the waste liquid, and place the adsorption column back into the collection tube. Then add 600 μL of Buffer PW2 (diluted with absolute ethanol) to the adsorption column, centrifuge at 13,000 rpm for 1 min, discard the waste liquid, and repeat this step once. Place the above adsorption column back into the collection tube, centrifuge at 13,000 rpm for 5 min to dry the adsorption column. Place the adsorption column into a new sterilized 1.5 mL centrifuge tube, add 100 μL of sterilized water to the center of the adsorption column membrane, let it stand at room temperature for 2 min, centrifuge at 13,000 rpm for 1 min, measure the concentration using a UV spectrophotometer, and store it at -20 °C. At this time, the target plasmid pUC57-WNV is obtained.
[0124] 3. PCR Amplification
[0125] Using the above plasmid pUC57-WNV as the target, and WNV-PCR-F (SEQ ID NO.2: GAAATTAATACGACTCACTATAGGGCTCCTGCGGCGCCTTCAT) and WNV-PCR-R (SEQ ID NO.3: CCATCTTCACTCTACACTTCAAATGACCC) as the primer set to perform a PCR amplification experiment. The PCR reaction program is as follows: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 20 s, annealing at 57 °C for 25 s, extension at 72 °C for 30 s, for a total of 32 cycles; then extension at 72 °C for 2 min, and store the PCR product at 4 °C (as shown in Table 1).
[0126] Table 1 PCR Amplification System for Preparing WNV Target Nucleic Acid Sequence
[0127]
[0128]
[0129] 4. Gel Recovery of PCR Products
[0130] 1) Add 5 μL of 10×DNA loading buffer to each 50 μL of the above PCR products, mix well, and then perform agarose gel electrophoresis.
[0131] 2) Prepare a 1.5% agarose gel, add the above samples to be tested into the gel reaction wells, and perform electrophoresis at a voltage of 120 V, current of 150 mA for 30 min to observe the electrophoresis bands, and cut and recover the target nucleic acid band.
[0132] 3) First, place the adsorption column CB2 into the collection tube, then add 500 μL of equilibration buffer BL to it, centrifuge at 12000 rpm for 1 min, and then pour out the waste liquid in the collection tube. Add an equal volume of solution PC (0.1 g of gel block is added with 100 μL of PC solution) to the gel block, place it in a 55°C water bath for about 10 min, and gently invert the centrifuge tube up and down continuously until the gel block is completely dissolved. Add the above solution to the treated adsorption column CB2, let it stand at room temperature for 2 min, then centrifuge at 12000 rpm for 1 min, and pour out the waste liquid in the collection tube. Then add 600 μL of washing buffer PW to the adsorption column CB2, centrifuge at 12000 rpm for 1 min, and pour out the waste liquid in the collection tube. Repeat this step once. Subsequently, place the adsorption column into the collection tube and centrifuge at 13000 rpm for 5 min to dry the adsorption column. Finally, place the adsorption column CB2 into a new 1.5 mL centrifuge tube, add 60 μL of ddH2O to the center of the column membrane, let it stand at room temperature for 2 min, then centrifuge at 13000 rpm for 1 min, measure the concentration with a UV spectrophotometer, and store it at 4°C.
[0133] 5. Transcription
[0134] 1) Convert all the above WNV PCR gel recovery products into RNA. The T7 polymerase transcription reaction system is shown in Table 2 below, and the reaction conditions are 37°C for 12 h.
[0135] Table 2 T7 Polymerase Transcription System
[0136] Name Volume WNV PCR Gel Extraction Product 500 ng NTP mixture (10 mM) 10 μL T7 RNA Polymerase (NEB, 50 U / μL) 4 μL Recombinant RNase Inhibitor (Takara, 40 U / μL) 1 μL 10×T7 RNA Polymerase Buffer 5 μL RNase-free Water Make up to 50 μL
[0137] 2) Add 1 / 10 volume of 3M sodium acetate (pH = 5.2) to the above transcription reaction system, then add 2 volumes of absolute ethanol, and let it stand at -20°C for 30 min. Then centrifuge at 15000g for 10 min at 4°C and discard the supernatant. Add 500 μL of 75% ethanol to the centrifuge tube, pipette 15 - 20 times until the precipitate is completely dissolved, centrifuge at 15000g for 10 min at 4°C and discard the supernatant. Repeat this step once more. Then let it stand at room temperature for 15 min, add 90 μL of RNase-free water at 50 - 60°C to completely dissolve the precipitate, then add 10 μL of 10×DNaseI Buffer and 2 μL of DNaseI enzyme (Takara), mix well and react at 37°C for 1 h to completely digest the DNA template.
[0138] 3) Recover RNA: Recover RNA using the RNA Clean&Concentrator-5 Kit (Zymo).
[0139] Add 2 volumes of RNA Binding Buffer to the above reaction system, then add an equal volume of absolute ethanol, mix well and place it in the Zymo IC column. Let it stand at room temperature for 2 min, then centrifuge at 12000g for 2 min at 4°C and discard the waste liquid in the collection tube. Then add 400 μL of RNA Prep Buffer to the column, centrifuge at 12000g for 1 min and discard the waste liquid in the collection tube. Then add 700 μL of RNAWash Buffer to the column, centrifuge at 12000g for 1 min and discard the waste liquid in the collection tube. Repeat this step once more. Then put the column back into the collection tube, centrifuge at 12000g for 2 min to dry the adsorption column, and then place the adsorption column in a new sterile 1.5 mL centrifuge tube and let it stand at room temperature for 5 min. Add 50 μL of RNase-free Water to the center of the adsorption column membrane, let it stand at room temperature for 2 min, and centrifuge at 10000g for 40 s at 4°C to obtain the recovered RNA sample. Measure the concentration with a UV spectrophotometer and store it at -80°C.
[0140] (2) RT-RAA amplification reaction of WNV virus nucleic acid target
[0141] 1. Synthesis of RT-RAA primers
[0142] According to the target nucleic acid sequence of WNV (GeneBank: JX442281.1), following the RT-RAA primer design principle, the sequence of the RT-RAA primer set constructed and sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis is as follows:
[0143] WNV-RAA-F: TGCTGGAAGTACTGTGTGGAGGAACAGAGAGA (SEQ ID NO.4).
[0144] WNV-RAA-R: GCCAAAGCTTGATGCAGAGCTCCCTCTTGTGA (SEQ ID NO.5).
[0145] 2. Preparation of RT-RAA reaction system
[0146] Take the recovered West Nile virus RNA sample above as the isothermal amplification target template and add it to the RT-RAA amplification reaction system (as shown in Table 3). Add the mixed 47.5 μL solution to the centrifuge tube containing the lyophilized powder to fully and evenly dissolve the lyophilized powder. Add 2.5 μL of Buffer B solution (magnesium acetate solution) to each centrifuge tube, close the tube cap, briefly centrifuge and mix evenly. After reacting at 37 °C for 30 min, obtain the RAA amplification product and store it at 4 °C for subsequent experiments. Replace the RNA sample with RNase-free Water in the RT-RAA amplification reaction system shown in Table 3 below, and keep other components unchanged as the negative control.
[0147] Table 3 RT-RAA amplification reaction system
[0148]
[0149]
[0150] (III) CRISPR-LbCas12a trans-cleavage detection reaction
[0151] 1. Synthesis of crRNA sequence
[0152] According to the selected target nucleic acid sequence of the West Nile virus, three different crRNAs are designed. The 1st - 19th positions are the anchor sequences binding to LbCas12a, and the 20th - 42nd positions are the guide sequences targeting the WNV target sequence of the West Nile virus. The specific sequences are as follows:
[0153] WNV-crRNA01 (SEQ ID NO.6):
[0154] AAUUUCUACUCUUgUAgAUUgAACCACgAUCAgggAUUgACA
[0155] WNV-crRNA02 (SEQ ID NO.7):
[0156] AAUUUCUACUCUUgUAgAUgAACAAAgACgUUCUUggUCCAU
[0157] WNV-crRNA03 (SEQ ID NO.8):
[0158] AAUUUCUACUCUUgUAgAUAAgAACCACACgCCACgAAgCAg
[0159] 2. Preparation of the LbCas12a trans-cleavage system
[0160] Take 1 μL of the RT-RAA product after reverse transcription-isothermal amplification and add it to the LbCas12a trans-cleavage system shown in Table 4 below. Add the above 3 different crRNAs to the trans-cleavage system respectively, and screen out the crRNA with the shortest reaction time, the strongest fluorescence signal and the best sensitivity. In the LbCas12a trans-cleavage system shown in Table 4 below, use the RT-RAA amplification product with RNA-free water instead of the nucleic acid target as the negative control.
[0161] Table 4 LbCas12a trans-cleavage system
[0162] Name Volume RT-RAA Amplification Product 1 μL WNV-crRNA01 / 02 / 03 250 nM 1 μL ssDNA8C-FQ 10 μM 1 μL LbCas12a 5 μM 2 μL 10×NEBuffer3.1 2 μL RNA-free water 13 μL
[0163] Place the mixed reaction tube in a real-time fluorescence quantitative PCR instrument, set the excitation wavelength of the FAM channel to 490 nm and the emission wavelength to 520 nm, collect the fluorescence signal every 15 s, react at 37 °C for 15 min, and monitor the change in the fluorescence signal intensity in the system.
[0164] 3. Determination of the fluorescence curve results
[0165] 1) Within the same detection time, if the fluorescence intensity value of the experimental group is more than 2 times higher than that of the negative control, it is determined as a positive result, that is, the test sample contains West Nile virus nucleic acid; otherwise, it is a negative result, that is, the test sample does not contain West Nile virus nucleic acid.
[0166] 2) Select the fluorescence value at the 5th cycle as the starting fluorescence value and the fluorescence value at the 64th cycle as the ending fluorescence value, calculate the end / start fluorescence ratio, and if it is greater than 2, it is determined as a positive result.
[0167] Example 2 Screening of the optimal crRNA in the method for detecting West Nile virus nucleic acid based on the CRISPR / Cas12a system
[0168] 1. Synthesize and prepare 3 kinds of crRNAs according to the method in (3) of Example 1, and name them WNV-crRNA01, WNV-crRNA02, and WNV-crRNA03 respectively.
[0169] 2. Take the RT-RAA amplification product in (2) of Example 1 and perform a trans-cleavage reaction according to (3) of Example 1. Add different crRNAs thereto respectively, observe the change of the fluorescence curve and the comparison result of the fluorescence value. Use the RT-RAA amplification product with RNA-free water instead of the nucleic acid target as the negative control.
[0170] 3. The experimental results are as Figure 1 shown. Compared with the other two crRNAs, the fluorescence curve of the reaction group where WNV-crRNA03 is located has a faster peak rising speed, a shorter time, and higher sensitivity.
[0171] Experimental results Figure 2 shown. When using the detection template of WNV target nucleic acid with the same concentration, the fluorescence value detected by WNV-crRNA03 at 15 min is the highest. Therefore, WNV-crRNA03 is used as the preferred crRNA for this method.
[0172] Example 3 Sensitivity Detection of West Nile Virus Nucleic Acid Detection Based on CRISPR / Cas12a System
[0173] Gradiently dilute the West Nile virus WNV target RNA template obtained in Example 1 to obtain an RNA solution containing nucleic acid fragments with different concentrations, and use WNV-crRNA03 as the selected crRNA in the trans-cleavage system to detect the sensitivity of this method.
[0174] The specific steps are as follows:
[0175] 1. Gradiently dilute the RNA template obtained in (1) of Example 1 with sterilized water to obtain an RNA solution containing nucleic acid fragments with different concentration gradients, and the concentrations are 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.
[0176] 2. Perform RT-RAA amplification according to step (2) in Example 1 to obtain the RT-RAA amplification product.
[0177] 3. 1 μL of each of the above RT-RAA amplification products was taken and subjected to the Lbcas12a trans-cleavage reaction according to the steps (iii) in Example 1. At the same time, the amplification product with RNA-free water as the template was set as the negative control, and the crRNA was WNV-crRNA03.
[0178] 4. According to the experimental results Figure 3 As shown, when detecting the WNV template using WNV-crRNA03 in the CRISPR / Cas12a detection system, although the fluorescence signal decreased continuously at the concentration of 10 6 ~10 0 copies / μL, it was significantly different from the negative control group. According to the experimental results Figure 4 As shown, the WNV target at the concentration of 10 copies / μL could be effectively detected within 15 minutes at the beginning of the reaction, and the sensitivity could reach 10 copies (10 copies / μL).
[0179] Example 4 Specific Detection of West Nile Virus Nucleic Acid Based on the CRISPR / Cas12a System
[0180] 1. The pathogen nucleic acid RNAs of Chikungunya virus (CHIKV), Dengue virus (DENV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), and Zika virus (ZIKA) were used as detection templates respectively, and RT-RAA amplification was carried out according to the steps (ii) in Example 1 to obtain the RT-RAA amplification products of different viruses.
[0181] 2. 1 μL of each of the above RT-RAA amplification products of different viruses was added to the LbCas12a trans-cleavage system respectively, and the Lbcas12a trans-cleavage reaction was carried out according to the steps (iii) in Example 1. At the same time, the amplification product with RNA-free water replacing the template was set as the negative control, and the crRNA was WNV-crRNA03.
[0182] 3. According to the experimental results Figure 5 As shown, the fluorescence signal of the experimental group containing the West Nile virus WNV target nucleic acid increased rapidly after the start of the reaction, while the fluorescence intensities of the negative control group and the experimental groups of other virus nucleic acids hardly increased with the passage of time. According to the experimental results Figure 6 As shown, at 15 minutes after the start of the reaction, the fluorescence intensity value of the experimental group containing the WNV target nucleic acid was significantly higher than that of the negative control and the experimental groups of other pathogens. It shows that this detection method has high specificity and there is no cross-reaction during the detection process.
[0183] Example 5 Repeatability Detection of West Nile Virus Nucleic Acid Based on the CRISPR / Cas12a System
[0184] 1. Using West Nile virus RNA at concentrations of 10 1 copies / μL and 10 5 copies / μL respectively as detection templates, RT-RAA amplification was carried out according to step (ii) in Example 1, with each concentration repeated 10 times.
[0185] 2. 1 μL of the RT-RAA amplification products of West Nile virus at the above different concentrations was respectively added to the LbCas12a trans-cleavage system, and the Lbcas12a trans-cleavage reaction was carried out according to step (iii) in Example 1. At the same time, an amplification product using sterile water instead of the template was set as a negative control, and the crRNA was WNV-crRNA03.
[0186] 3. 1 μL of the RT-RAA amplification products of the above different viruses was respectively added to the LbCas12a trans-cleavage system, and the Lbcas12a trans-cleavage reaction was carried out according to step (iii) in Example 1. At the same time, an amplification product using sterile water instead of the template was set as a negative control, and the crRNA was WNV-crRNA03.
[0187] 4. According to the experimental results Figure 7 shown, at 15 min after the start of the reaction, the fluorescence values of the 10 repeated experiments for each of the two different concentrations of WNV target nucleic acids were relatively concentrated. At the same time, the fluorescence signal intensity of the experimental group with 10 1 copies / μL was significantly higher than that of the negative control group, further verifying the high sensitivity and result accuracy of this method.
[0188] The above-described embodiments only express several implementation manners of the present application, which are convenient for understanding the technical solutions of the present application specifically and in detail, but should not be construed as limiting the scope of patent protection of the application. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several deformations and improvements can be made, and these all belong to the protection scope of the present application. In addition, it should be understood that after reading the above teachings of the present application, those skilled in the art can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by those skilled in the art through logical analysis, reasoning or limited experiments based on the technical solutions provided in the present application are all within the protection scope of the appended claims of the present application. Therefore, the protection scope of the patent of the present application should be subject to the content of the appended claims, and the specification can be used to explain the content of the claims.
Claims
1. A nucleic acid product, characterized in that, It includes one or more of the following (1) and (2); (1) A crRNA and a fluorescent reporter probe with a nucleic acid sequence as shown in any one of SEQ ID NO.6 to SEQ ID NO.8; and (2) A primer set with a nucleic acid sequence as shown in SEQ ID NO.4 to SEQ ID NO.
5.
2. The nucleic acid product according to claim 1, wherein The fluorescent reporter probe has a nucleic acid sequence as shown in SEQ ID NO.9; Optionally, the fluorescent reporter probe is labeled with a fluorophore and a quencher group; Optionally, the fluorophore includes one or more of FAM, ROX, HEX, CY5, TET, JOE, Cy3, Cy7, RED610, Texas Red, RED670, and NED; Optionally, the quencher group includes one or more of TAMRA, Dabcyl, and BHQ; Optionally, the BHQ includes one or two of BHQ1 and BHQ2.
3. Use of the nucleic acid product according to any one of claims 1 to 2 in the preparation of a kit for detecting West Nile virus.
4. A kit, characterized in that, The kit includes the nucleic acid product according to any one of claims 1 to 2; Optionally, the kit further includes Cas12a; Optionally, the Cas12a includes LbCas12a.
5. The kit according to claim 4, characterized in that, The kit includes one or more of an RT-RAA amplification composition and a CRISPR-Cas12a trans-cleavage composition.
6. The kit according to claim 5, characterized in that, The RT-RAA amplification composition includes one or more of a primer set with a nucleic acid sequence as shown in SEQ ID NO.4 to SEQ ID NO.5 and an amplification reagent; Or / and, the CRISPR-Cas12a trans-cleavage composition includes one or more of the crRNA, the fluorescent reporter probe, the Cas12a, and a trans-cleavage reagent.
7. A method for detecting West Nile virus, characterized in that, It includes detecting West Nile virus in a sample using the nucleic acid product according to any one of claims 1 to 2 or the kit according to any one of claims 4 to 6.
8. The method according to claim 7, wherein It includes: Using an RT-RAA system including the primer set to reverse transcribe and amplify the RNA of the sample to prepare an amplification product; And, mixing a CRISPR-Cas12a trans-cleavage composition including the crRNA and the fluorescent reporter probe with the amplification product to form a CRISPR-Cas12a trans-cleavage system, and reacting to detect a fluorescence signal.
9. The method according to claim 8, characterized in that, The amplification satisfies one or more of the following conditions (1) to (2): (1) The temperature is 39°C to 42°C and the time is 15 min to 40 min; and, (2) In the initial system of the amplification reaction, the concentration of the primer is 0.3 μM to 0.8 μM; Optionally, the trans-cleavage detection reaction satisfies one or two of the following conditions (1) to (2): (1) The temperature is 36°C to 38°C and the time is 15 min to 60 min; and (2) In the initial system of the trans-cleavage, the concentration of the crRNA is 200 nM to 250 nM; the concentration of the fluorescent reporter probe is 0.5 μM to 1 μM.
10. The method according to claim 9, wherein Detecting the fluorescence signal includes: Set the excitation wavelength and emission wavelength; and Collect the fluorescence signal every 15 s to 30 s, react at 36 °C to 38 °C for 15 min to 60 min, detect the change in the fluorescence signal intensity, and make a fluorescence curve.
Citation Information
Patent Citations
Indirect enzyme-linked immunosorbent assay (ELISA) kit for detecting human West Nile virus and detection method thereof
CN102183637A
Recombinant pseudotyped baculovirus Bac-G-prM / E for preventing West Nile virus as well as vaccine and application thereof
CN103045544A
JEV detection nucleic acid combination, kit and method based on CRISPR-Cas12a system
CN119391909A