Application of PSTPIP2 inhibitor in preparation of medicine for treating Kawasaki disease, method and medicine

By developing PSTPIP2 inhibitors, the 4in1 interfering gene expression system was used to inhibit PSTPIP2 expression, which solved the problem of limited treatment methods for Kawasaki disease, and achieved effective treatment and prognosis improvement of Kawasaki disease.

CN120267833APending Publication Date: 2025-07-08NANJING CHILDRENS HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510382124.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

Existing methods for treating Kawasaki disease are limited and costly, and new antagonistic inflammatory treatments are needed to reduce complications and improve patient outcomes.

Method used

Using the PSTPIP2 protein or its encoding gene as a target, PSTPIP2 inhibitors, including shRNA, siRNA, etc., are developed through the 4in1 interfering gene expression system, to inhibit the expression and function of PSTPIP2, reduce the content of inflammatory factors, and block the occurrence and development of Kawasaki disease.

Benefits of technology

It significantly inhibits the early inflammatory factor storm of Kawasaki disease and reduces complications, provides new treatment ideas, improves patient prognosis, and reduces treatment costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120267833A_ABST
    Figure CN120267833A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of a PSTPIP2 inhibitor in preparation of a medicine for treating Kawasaki disease, a method and the medicine. The invention provides the application of the PSTPIP2 inhibitor in the treatment of the Kawasaki disease, especially the Kawasaki disease induced by the lactobacillus cell wall extract LCWE for the first time. Based on a 4in1 interference gene expression system, four shRNA sequences acting on different mRNA parts of a target gene are cloned into the same shRNA vector, the sequences do not need to be screened, the experimental workload is greatly reduced, more importantly, the knock-down efficiency of the target gene can be obviously improved, a theoretical basis and a new treatment thought are provided for treatment of the Kawasaki disease, and the application has a wide application prospect. Wide clinical application prospects are realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to the application, method and drug of PSTPIP2 inhibitor in the preparation of drugs for treating Kawasaki disease. Background Art

[0002] Kawasaki disease (KD), also known as mucocutaneous lymph node syndrome, is a systemic inflammation of small and medium-sized blood vessels with unknown etiology, which is prone to occur in children under 5 years old. According to statistics, the incidence rate of children aged 0-4 in Beijing and Shanghai has exceeded 100 / 100000 in recent years. The two most important complications of Kawasaki disease are coronary artery injury and coronary artery thrombosis, which are the second leading cause of acquired heart disease in children and pose a serious threat to the survival and quality of life of children. Therefore, the related prevention, diagnosis and treatment of Kawasaki disease are major research directions in the pharmaceutical field.

[0003] The etiology of Kawasaki disease is not yet clear. At present, it is considered that bacterial or viral infection is the main risk factor for the occurrence of this disease. It is worth noting that the early cytokine storm is the main reason for promoting the occurrence and development of Kawasaki disease. The activation of the NF-κB (Nuclear factor-kappa B) signaling pathway is an important way to promote inflammation, which can be activated by cytokine pathways such as IL-1 and TNF-α, and enters the nucleus to participate in the transcription process of inflammatory factors such as IL-1, IL-6 and TNF-α and factor receptors. This loop further promotes the development of inflammation. Studies have found that the increase of TNF-a in the blood circulation of children with Kawasaki disease can aggravate the inflammatory cascade reaction and cause serious damage to blood vessels. Therefore, early inflammation control is particularly important for preventing and treating the occurrence and development of Kawasaki disease.

[0004] The clinical treatment methods for Kawasaki disease are relatively limited. At present, it is mainly the combination treatment of high-dose intravenous immunoglobulin (IVIG) and aspirin. It is reported that IVIG mainly achieves the therapeutic effect by inhibiting the activity of the NF-κB signaling pathway and reducing the level of inflammatory factors. Although the combined use of drugs can reduce the incidence rate of coronary artery injury, a complication of Kawasaki disease, from 15%-25% to 5%, there are still up to 7.5%-26.8% of KD children who are resistant to the first dose of IVIG. The above shows that it is crucial to find a new method to antagonize inflammation for treating Kawasaki disease.

[0005] PSTPIP2 belongs to the protein family containing a conserved Fes / CIP4 homology domain at the N-terminus (F-BAR protein family), is related to autoimmune diseases, and plays an important role in the development of innate immunity and autoinflammatory bone diseases. The PSTPIP2 protein is rich in proline-glutamate-serine-threonine (PEST) sequence binding sites at the C-terminus and can exert an inhibitory function by binding to protein tyrosine phosphatases with this sequence. In a relatively classic study, researchers found that autoimmune diseases were closely related to excessive levels of IL-1β. During this process, it was found that PSTPIP2 promoted the secretion of IL-1β by binding to two PEST sequence-containing inflammatory pathway inhibitory proteins, CSK and SHIP1. Based on the close relationship between PSTPIP2 and the secretion process of inflammatory factors, it is speculated that it may also play an important role in the early inflammatory cytokine storm of Kawasaki disease in children.

[0006] The 4in1 interfering gene expression system is an efficient gene interference technology. It realizes the efficient down-regulation of the target gene by cloning 4 shRNA sequences acting on different mRNA sites of the target gene into the same shRNA vector. Moreover, using the 4in1 shRNA vector construction technology, there is no need to screen the sequences, greatly reducing the experimental workload. Summary of the Invention

[0007] The object of the present invention is to provide an application, method and drug of PSTPIP2 in the preparation of drugs for treating Kawasaki disease, so as to be able to effectively treat Kawasaki disease and thus solve the problems of limited current treatment methods and high treatment costs of Kawasaki disease.

[0008] To this end, the present invention provides the following technical solutions.

[0009] The first aspect of the present invention provides an application of a PSTPIP2 protein or its coding gene as a target in the preparation of drugs for treating Kawasaki disease.

[0010] The second aspect of the present invention provides an application of a PSTPIP2 inhibitor in the preparation of drugs for treating Kawasaki disease.

[0011] In a preferred embodiment of the present invention, the PSTPIP2 inhibitor includes: (1) shRNA targeting the PSTPIP2 gene; (2) siRNA targeting the PSTPIP2 gene; (3) A reagent that inhibits the transcriptional activity of the PSTPIP2 gene; (4) A reagent that inhibits the transcriptional level of PSTPIP2 mRNA; (5) An agent that promotes the degradation of PSTPIP2 mRNA; (6) An agent that inhibits the translation of PSTPIP2 mRNA; (7) An agent that specifically recognizes the guide nucleic acid of the PSTPIP2 gene and performs cleavage to reduce the expression level of PSTPIP2; (8) An agent for partially or completely knocking out the PSTPIP2 gene; (9) An agent that inhibits the function of the PSTPIP2 protein; (10) An agent that promotes the degradation of the PSTPIP2 protein.

[0012] In a preferred embodiment of the present invention, the PSTPIP2 inhibitor is shRNA against the PSTPIP2 gene.

[0013] In a preferred embodiment of the present invention, the PSTPIP2 inhibitor is 4in1 shPSTPIP2.

[0014] In a preferred embodiment of the present invention, the 4in1 shPSTPIP2 includes shRNA1, shRNA2, shRNA3, and shRNA4, and the nucleotide sequences of the shRNA1, shRNA2, shRNA3, and shRNA4 are respectively shown in SEQ ID NO: 1, 2, 3, and 4.

[0015] In a preferred embodiment of the present invention, the Kawasaki disease is Kawasaki disease induced by Lactobacillus cell wall extract LCWE.

[0016] The third aspect of the present invention provides a drug for treating Kawasaki disease, and the drug can inhibit the expression of the PSTPIP2 gene or protein.

[0017] In a preferred embodiment of the present invention, the drug includes 4in1 shPSTPIP2, and a pharmaceutically acceptable carrier or excipient.

[0018] In a preferred embodiment of the present invention, the 4in1 shPSTPIP2 includes shRNA1, shRNA2, shRNA3, and shRNA4, and the nucleotide sequences of the shRNA1, shRNA2, shRNA3, and shRNA4 are respectively shown in SEQ ID NO: 1, 2, 3, and 4.

[0019] In a preferred embodiment of the present invention, the dosage form of the drug includes oral liquid, injection, tablet, pill, dispersant, capsule, or granule.

[0020] The fourth aspect of the present invention provides the use of a PSTPIP2 protein or its encoding gene as a target in screening for candidate drugs for the preparation of drugs for treating Kawasaki disease.

[0021] The fifth aspect of the present invention provides a method for screening candidate drugs for treating Kawasaki disease, the method comprising the following steps: (i) treating a system expressing or containing PSTPIP2 with a test substance; (ii) detecting the expression of PSTPIP2 in the system; (iii) selecting a test substance capable of inhibiting the expression of PSTPIP2 as a candidate drug.

[0022] The sixth aspect of the present invention provides a medicine box for treating Kawasaki disease, the medicine box including: the drug as described above.

[0023] The seventh aspect of the present invention provides the use of a reagent specifically recognizing a PSTPIP2 protein or its encoding gene in the preparation of a reagent or reagent kit for diagnosing or prognosing Kawasaki disease.

[0024] In a preferred embodiment of the present invention, the reagent specifically recognizing a PSTPIP2 protein or its encoding gene is selected from: primers specifically amplifying the encoding gene of the PSTPIP2 protein; probes specifically recognizing the encoding gene of the PSTPIP2 protein; or antibodies or ligands specifically binding to the PSTPIP2 protein.

[0025] By means of the above technical solutions, the present invention has at least the following advantages: The present invention firstly proposes the application of PSTPIP2 inhibitors in the treatment of Kawasaki disease, especially Kawasaki disease induced by Lactobacillus cell wall extract LCWE. The present invention firstly discovers that inhibiting the expression of PSTPIP2 protein can significantly inhibit the content of inflammatory factors in plasma during the occurrence of Kawasaki disease, indicating that it can inhibit the early inflammatory cytokine storm of Kawasaki disease and reduce complications, that is, PSTPIP2 inhibitors can be used in the treatment of Kawasaki disease to improve the prognosis of patients. In addition, drugs for treating Kawasaki disease can also be developed with PSTPIP2 as a target. The present invention provides a theoretical basis and a new treatment idea for the treatment of Kawasaki disease, and has broad clinical application prospects.

[0026] The present invention is based on a 4in1 interference gene expression system, which clones 4 shRNA sequences acting on different mRNA sites of the target gene into the same shRNA vector, without screening the sequences, greatly reducing the experimental workload, and more importantly, can significantly increase the knockdown efficiency of the target gene and improve the treatment effect.

[0027] The above description is only an overview of the technical solution of the present invention. In order to understand the technical means of the present invention more clearly and implement it in accordance with the content of the specification, the following details the preferred embodiments of the present invention as follows. Brief Description of the Drawings

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following briefly introduces the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0029] Figure 1 Shows the construction of a Kawasaki disease model mouse; among them, A shows the content of the inflammatory factor IL-6 in the plasma of the Kawasaki disease model mouse constructed by ELISA detection control and LCWE injection, and B shows the H&E staining map of the mouse heart tissue; Figure 2 Shows the expression of PSTPIP2 in PBMC of Kawasaki disease model mice; among them, A shows the WB map of the protein expression level of PSTPIP2 in peripheral blood mononuclear cells of control and Kawasaki disease model mice, and B shows the gray scale analysis map thereof; Figure 3 Shows the treatment flow chart of Kawasaki disease model mice; Figure 4 Shows the comparison of the mRNA expression level of PSTPIP2 in PBMC of bone marrow transplantation mice 14 days after LCWE injection; Figure 5 Shows the content of inflammatory factors in the plasma of Kawasaki disease model mice after knocking down PSTPIP2; among them, A and B respectively show the content of IL-6 and IL-1β in the plasma of mice on the 7th day after LCWE injection, and C shows the content of IL-6 in the plasma of mice on the 14th day after LCWE injection; Figure 6 Shows the expression levels of mRNA of inflammation-related genes in peripheral blood mononuclear cells of Kawasaki disease model mice after knocking down PSTPIP2; among them, A, B, and C respectively show the mRNA expression levels of IL-6, IL-1β, and TNFα in peripheral blood mononuclear cells of mice on the 14th day after LCWE injection. Detailed Description of the Preferred Embodiments

[0030] In order to make the technical means, creative features, achieved purposes and functions of the present invention easy to understand, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention.

[0031] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0032] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and embodiments of the present invention are merely exemplary.

[0033] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0034] PSTPIP2 protein or its encoding gene Through extensive and in-depth research, the present inventors have revealed that the proline-serine-threonine phosphatase interacting protein 2 gene (PSTPIP2) plays an important regulatory role in the occurrence and development of Kawasaki disease, especially Kawasaki disease induced by Lactobacillus cell wall extract LCWE. Moreover, the down-regulation of the PSTPIP2 gene can significantly inhibit the content of inflammatory factors in plasma during the occurrence of Kawasaki disease. It can inhibit the early inflammatory cytokine storm in Kawasaki disease, reduce complications, and improve the prognosis of patients. Therefore, PSTPIP2 can be used as a research target for Kawasaki disease, especially Kawasaki disease induced by Lactobacillus cell wall extract LCWE, to develop drugs for the treatment of Kawasaki disease, especially Kawasaki disease induced by Lactobacillus cell wall extract LCWE, and as a diagnostic and prognostic evaluation marker for Kawasaki disease, especially Kawasaki disease induced by Lactobacillus cell wall extract LCWE.

[0035] According to what is known in the art, PSTPIP2 belongs to a protein family (F-BAR protein family) with a conserved Fes / CIP4 homology domain at the N-terminus, which is associated with autoimmune diseases and plays an important role in the development of innate immunity and autoinflammatory bone diseases. PSTPIP2 protein is rich in proline-glutamic acid-serine-threonine (PEST) sequence binding sites at the C-terminus, and can exert inhibitory functions by binding to protein tyrosine phosphatases with this sequence. In a more classic study, researchers found that autoimmune diseases are closely related to excessive IL-1β levels. In this process, it was found that PSTPIP2 promoted the secretion of IL-1β by binding to two inflammatory pathway inhibitory proteins rich in PEST sequences, CSK and SHIP1. Based on the close relationship between PSTPIP2 and the secretion process of inflammatory factors, it is speculated that it may also play an important role in the early inflammatory factor storm of Kawasaki disease in children.

[0036] As used herein, the term "PSTPIP2 protein" refers to a protein (CAJ18516.1) having an amino acid sequence as shown in SEQ ID NO: 5, and its corresponding gene sequence is shown in NM_013831.4. The term also includes variant forms of sequences having the same function as PSTPIP2 protein. These variant forms include, but are not limited to: deletion, insertion and / or substitution of several (usually 1-50, preferably 1-30, more preferably 1-20, optimally 1-10, and more preferably 1-8, 1-5) amino acids, and addition or deletion of one or several (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. For example, in the art, when amino acids with similar or similar properties are substituted, the function of the protein is usually not changed. For another example, adding or deleting one or several amino acids at the C-terminus and / or N-terminus usually does not change the function of the protein. The term also includes active fragments and active derivatives of PSTPIP2 protein.

[0037] SEQ ID NO: 5 MTGSLFKGNFWSTDILSTIGYDSIIQHLNNGRKNCKEFEDFLKERASIEEKYGKDLLNLSRKKPCGQSEINTLKRALEVFKQQVDNVAQCHIQLAQTLREEARKMEEFREKQKLQRKKTETIMDAAHKQRNAQFKKAMDAKKNYEQKCRDKDEAEQAVHRSANVANQRQQEKLFVKLATSKTAVEDSDKAYVLHINMLEKVREDWQSEHIKACEVFEAQECERINFFRNALWLHLNQLSQQCVANDEMYEQVRKSLETCSIEKDIQYFVNQRKTGQTPPAPIMYENFYSPQRNAAPPEKTTGPNPARRGPLPVPKRIPDDPDYSVVEDYSLLYQ。

[0038] The polynucleotide sequence (coding sequence) encoding the PSTPIP2 protein or its conservative variant protein can also be applied to the present invention. The term "coding gene" can be a polynucleotide encoding the said protein, or can also be a polynucleotide further comprising additional coding and / or non-coding sequences. The PSTPIP2 protein is highly conserved in mammals, and the sequence identity between its murine protein and human protein is as high as 88.3%.

[0039] Through further research, it was found that in a murine model of Kawasaki disease, the expression of PSTPIP2 in murine PBMCs was significantly upregulated, and it could induce the early inflammatory storm of Kawasaki disease by promoting the generation of inflammatory factors. By knocking down the expression of PSTPIP2 in murine PBMCs, the expression level of early inflammatory factors in Kawasaki disease could be inhibited, and the content of inflammatory factors in plasma could be reduced, thereby blocking the occurrence and development of Kawasaki disease. The above results reveal that PSTPIP2 plays an important role in the occurrence of Kawasaki disease, and PSTPIP2 can be used as a target to develop corresponding drugs and means for the treatment of Kawasaki disease.

[0040] PSTPIP2 Inhibitors and Their Applications Based on the above new findings, the present invention provides an application of a PSTPIP2 protein or its coding gene as a target in the preparation of drugs for the treatment of Kawasaki disease, for the effective treatment of Kawasaki disease, especially Kawasaki disease induced by the Lactobacillus cell wall extract LCWE.

[0041] As used herein, inhibitors of the said PSTPIP2 protein or its coding gene include downregulators, antagonists, blockers, inhibitors, etc., and these terms can be used interchangeably.

[0042] The inhibitor of the PSTPIP2 protein or its encoding gene refers to any substance that can reduce the activity of the PSTPIP2 protein, reduce the stability of the PSTPIP2 protein or its encoding gene, inhibit the expression of the PSTPIP2 protein, reduce the effective action time of the PSTPIP2 protein, or inhibit the transcription and translation of the PSTPIP2 gene. These substances can all be used in the present invention as substances useful for down-regulating PSTPIP2, and thus can be used for the treatment of Kawasaki disease, especially Kawasaki disease induced by Lactobacillus cell wall extract LCWE. For example, the inhibitors are: shRNA targeting the PSTPIP2 gene, siRNA targeting the PSTPIP2 gene, reagents inhibiting the transcriptional activity of the PSTPIP2 gene, reagents inhibiting the transcriptional level of PSTPIP2 mRNA, reagents promoting the degradation of PSTPIP2 mRNA, reagents inhibiting the translation of PSTPIP2 mRNA, reagents specifically recognizing the guide nucleic acid of the PSTPIP2 gene and cleaving it to reduce the expression level of PSTPIP2, reagents for partially or completely knocking out the PSTPIP2 gene, and the like.

[0043] As an alternative embodiment of the present invention, the PSTPIP2 inhibitor is shRNA targeting the PSTPIP2 gene. The inventors can understand that according to the PSTPIP2 gene sequence provided in the present invention, such interfering RNA molecules can be prepared. There is no particular limitation on the method for preparing the interfering RNA molecules, including but not limited to: chemical synthesis method, in vitro transcription method, etc. The interfering RNA can be delivered into cells by using an appropriate transfection reagent, or can also be delivered into cells by using a variety of techniques known in the art.

[0044] As an alternative embodiment of the present invention, the PSTPIP2 inhibitor is 4in1 shPSTPIP2. The 4in1 gene interference expression system is a highly efficient gene interference technology developed by Professor Zhu Ping of the Chinese Academy of Sciences. It realizes the highly efficient down-regulation of the target gene by cloning 4 shRNA sequences acting on different mRNA sites of the target gene into the same shRNA vector. Moreover, by using the 4in1 shRNA vector construction technology, there is no need to screen the sequences, which greatly reduces the experimental workload.

[0045] Therefore, the present invention provides a lentivirus-mediated 4in1 shPSTPIP2, which is an inhibitor of PSTPIP2, targeting the mRNA of endogenous PSTPIP2 and thus inhibiting its function. The 4in1 shPSTPIP2 fragment is further applied to the preparation of a drug for the treatment of Kawasaki disease by inhibiting PSTPIP2 in peripheral blood immune cells, so as to solve the problems of limited current treatment methods and treatment costs of Kawasaki disease.

[0046] As an alternative of the present invention, the 4in1 shPSTPIP2 comprises shRNA1, shRNA2, shRNA3 and shRNA4, and the nucleotide sequences of shRNA1, shRNA2, shRNA3 and shRNA4 are shown as SEQ ID NO: 1, 2, 3 and 4 respectively.

[0047] The nucleotide sequence of the 4in1 shPSTPIP2 fragment is specifically: SEQ ID NO: 1 shRNA1: GCAAGTCCGTAAGAGTTTAGATTCAAGAGATCTAAACTCTTACGGACTTGCTTTTTT; SEQ ID NO: 2 shRNA2: GGAACGCACAGTTCAAGAAAGTTCAAGAGACTTTCTTGAACTGTGCGTTCCTTTTTT; SEQ ID NO: 3 shRNA3: GGATGCCAAGAAGAATTATGATTCAAGAGATCATAATTCTTCTTGGCATCCTTTTTT; SEQ ID NO: 4 shRNA4: GGCAGAGTGAACACATTAAGGTTCAAGAGACCTTAATGTGTTCACTCTGCCTTTTTT.

[0048] Drug The present invention also provides a drug for treating Kawasaki disease, and the drug can inhibit the expression of PSTPIP2 gene or protein.

[0049] As a preferred embodiment of the present invention, the drug comprises 4in1 shPSTPIP2, and a pharmaceutically acceptable carrier or excipient.

[0050] As used herein, the term "pharmaceutically acceptable carrier or excipient" refers to a carrier for administering a therapeutic agent, including various excipients and diluents. This term refers to such pharmaceutical carriers: they are not necessarily the active ingredient itself and have no excessive toxicity after administration. Suitable carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in a composition may contain liquids, such as water, saline, buffers. Additionally, auxiliary substances may also be present in these carriers, such as fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffering substances, etc. The carrier may also contain cell transfection reagents.

[0051] After learning about the use of an inhibitor of the PSTPIP2 protein or its coding gene, various methods well-known in the art can be used to administer the down-regulator or its coding gene, or its pharmaceutical composition, to a mammal or a human.

[0052] Preferably, gene therapy means can be adopted. For example, an inhibitor of PSTPIP2 can be directly administered to a subject by methods such as injection; or, an expression unit (such as an expression vector or a virus, etc., or siRNA) carrying an inhibitor of PSTPIP2 can be delivered to the target site through a certain route and made to express an active PSTPIP2 inhibitor. The specific situation depends on the type of the down-regulator, and these are all well-known to those skilled in the art.

[0053] Furthermore, the 4in1 shPSTPIP2 includes shRNA1, shRNA2, shRNA3 and shRNA4, and the nucleotide sequences of shRNA1, shRNA2, shRNA3 and shRNA4 are respectively shown as SEQ ID NO: 1, 2, 3 and 4.

[0054] Specifically in application, the 4in1 shPSTPIP2 fragment is effectively connected to an expression vector. The "effective connection" means that the connection of the 4in1 shPSTPIP2 fragment of the present invention to the expression vector enables the resulting nucleic acid construct to transcribe the 4in1 shPSTPIP2 fragment of the present invention in cells or animals.

[0055] Preferably, the expression vector is a lentiviral interfering gene expression plasmid, and more preferably, the 4in1 lentiviral interfering gene expression plasmid pLent-4in1-shRNA-CMV-copGFP-P2A-Puro is selected.

[0056] The 4in1 shPSTPIP2 nucleic acid construct can be effectively connected to the lentiviral vector by adding restriction enzyme cleavage sites compatible with the expression vector at both ends thereof and synthesizing the forward sequence and the reverse sequence.

[0057] In an alternative mode, the 4in1 shPSTPIP2 nucleic acid construct (also called shP STPIP2 lentivirus) can be prepared by the following method, which includes: 1) Select the lentiviral vector pLent-CMV-copGFP-P2A-Puro; the competent cell is selected as the Escherichia coli strain DH5α; the resistance is Amp; the promoter is the CMV promoter, which is connected to the 5′ end of the 4in1 shPSTPIP2 sequence; 2) Synthesize the 4in1 shPSTPIP2 fragment for the target gene, then construct a lentiviral expression vector, amplify the lentiviral expression vector in large quantities, package a large amount of lentiviral vectors in 293T cells, concentrate and purify the lentivirus, and finally measure the virus titer (not less than 10^8 TU / mL).

[0058] The above construction method can also be directly commissioned to a commercial synthesis company to complete.

[0059] In the present invention, mice are first irradiated with X-rays to clear their own bone marrow, and then bone marrow infected with shPSTPIP2 lentivirus or control virus (shNC lentivirus) is injected through the tail vein. After that, LCWE is injected intraperitoneally, and then the phenotypes of Kawasaki disease mice induced by LCWE are observed, providing a new method for treating Kawasaki disease.

[0060] The dosage form of the drug of the present invention can be in the form of an oral preparation, such as tablets, capsules, pills, powders, granules, suspensions, syrups, etc.; it can also be in the form of an injection dosage form, such as injection solutions, powder injections, etc., through intravenous, intraperitoneal, subcutaneous or intramuscular routes. All dosage form forms used are well-known to those of ordinary skill in the pharmaceutical art.

[0061] The drugs of the present invention can be administered to a subject by routes known in the art, including but not limited to oral, parenteral, subcutaneous, intramuscular, intravenous, intraperitoneal, intrahepatic, intramyocardial, intrarenal, vaginal, rectal, buccal, sublingual, intranasal, transdermal, etc.

[0062] The dosage administered will depend on the age, health and weight of the recipient, the type of co-administered drugs, the frequency of treatment, the route of administration, etc. The drug can be administered in a single daily dose, or the total daily dose can be administered in divided doses two, three or four times a day. The drug can be administered before, during or after surgery. The dose can be administered once or multiple times, and the dosing time can be from a single day to several months or longer.

[0063] The present invention also provides a kit containing the drug described above or directly containing an inhibitor of the PSTPIP2 protein or its coding gene. In addition, the kit may further include an instruction manual for the use method of the drug in the kit.

[0064] Drug screening After learning about the close correlation between the expression of PSTPIP2 and the occurrence and development of Kawasaki disease, substances that inhibit the expression or activity of the PSTPIP2 protein or its coding gene can be screened based on this feature. Drugs that are truly useful for treating Kawasaki disease can be found from the substances described above.

[0065] Accordingly, in one aspect, the present invention provides the use of a PSTPIP2 protein or its encoding gene as a target in screening for candidate drugs for the preparation of drugs for treating Kawasaki disease.

[0066] In addition, the present invention also provides a method for screening candidate drugs for treating Kawasaki disease, the method comprising the following steps: treating a system expressing or containing PSTPIP2 with a candidate substance; and detecting the expression or activity of PSTPIP2 in the system; if the candidate substance can inhibit the expression or activity of PSTPIP2, it indicates that the candidate substance can be a potential substance for drugs for treating Kawasaki disease. The system expressing PSTPIP2 is preferably a cell (or cell culture) system, and the cell can be a cell endogenously expressing PSTPIP2; or can be a cell recombinantly expressing PSTPIP2.

[0067] In a preferred embodiment of the present invention, when performing the screening, in order to more easily observe the change in the expression or activity of PSTPIP2, a control group can also be set, and the control group can be a system expressing PSTPIP2 without adding the candidate substance.

[0068] As a preferred embodiment of the present invention, the method further comprises: performing further cell experiments and / or animal tests on the obtained potential substance to further select and determine substances that are truly useful for treating Kawasaki disease.

[0069] On the other hand, the present invention also provides potential substances for treating Kawasaki disease obtained by the screening method. These preliminarily screened substances can form a screening library, so that people can finally screen out substances that can inhibit the expression and activity of PSTPIP2, and thus obtain substances useful for treating Kawasaki disease.

[0070] Application in the diagnosis and prognosis evaluation of Kawasaki disease In the present invention, it is revealed that there is an important regulatory role in the occurrence and development of Kawasaki disease. For example, it is demonstrated in the examples that the expression level of PSTPIP2 is significantly positively correlated with the occurrence and development of Kawasaki disease.

[0071] Based on the above new findings of the present inventors, PSTPIP2 can be used as a marker for the diagnosis and prognosis evaluation of Kawasaki disease: (i) for the typing, differential diagnosis, and / or susceptibility analysis of Kawasaki disease; (ii) for evaluating the drugs for treating Kawasaki disease, drug efficacy, prognosis, and selecting appropriate treatment methods in relevant populations. For example, populations with abnormal expression of the PSTPIP2 gene can be isolated, so as to perform more targeted treatment.

[0072] The prognosis of Kawasaki disease in a subject providing the sample to be evaluated can be predicted by determining the expression or activity of PSTPIP2 in the sample to be evaluated, and appropriate drugs can be selected for treatment. Generally, a threshold value of PSTPIP2 can be defined. When the expression of PSTPIP2 is higher than the defined threshold value, a treatment regimen for inhibiting PSTPIP2 can be considered. The above-mentioned threshold value is easy to determine for those skilled in the art. For example, the threshold value of abnormal PSTPIP2 expression can be obtained by comparing the expression of PSTPIP2 in normal human cells or tissues with that in patient cells or tissues.

[0073] Therefore, the present invention provides the use of PSTPIP2 protein or its coding gene for preparing a reagent or kit for diagnosing or prognosticating Kawasaki disease.

[0074] Various techniques known in the art can be used to detect the presence and expression of the PSTPIP2 gene, and these techniques are all included in the present invention. For example, existing techniques such as Southern blotting, Western blotting, DNA sequence analysis, PCR, etc. can be used, and these methods can be used in combination.

[0075] The present invention also provides a reagent for detecting the presence and expression of PSTPIP2 protein or its coding gene in an analyte. Preferably, when detecting at the gene level, primers specifically amplifying PSTPIP2 or a probe specifically recognizing PSTPIP2 can be used to determine the presence of the PSTPIP2 gene; when detecting at the protein level, an antibody or ligand specifically binding to the protein encoded by PSTPIP2 can be used to determine the expression of the PSTPIP2 protein.

[0076] The design of a specific probe for the PSTPIP2 gene is a technique well-known to those skilled in the art. For example, a probe is prepared which can specifically bind to a specific site on the PSTPIP2 gene and does not specifically bind to other genes other than the PSTPIP2 gene, and the probe is provided with a detectable signal.

[0077] The method of using an antibody specifically binding to the PSTPIP2 protein to detect the expression of the PSTPIP2 protein in an analyte is also a technique well-known to those skilled in the art.

[0078] The present invention also provides a kit for detecting the presence and expression of the PSTPIP2 gene in an analyte, and the kit includes: primers specifically amplifying the PSTPIP2 gene; a probe specifically recognizing the PSTPIP2 gene; or an antibody or ligand specifically binding to the protein encoded by the PSTPIP2 gene.

[0079] In addition, the kit may further include various reagents required for DNA extraction, PCR, hybridization, color development, etc., including but not limited to: extraction solution, amplification solution, hybridization solution, enzymes, control solution, color development solution, washing solution, etc.

[0080] In addition, the kit may further include an instruction manual and / or nucleic acid sequence analysis software, etc.

[0081] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. All conventional reagents used in the following embodiments are commercially available, and the biological experiments conducted are all conventional biological experiments in this field and can be carried out according to the corresponding experimental manuals or kit instructions.

[0082] Experimental materials and methods involved in the following embodiments 1. Experimental animals All experimental procedures were carried out in accordance with the Regulations on the Administration of Laboratory Animals of the Ministry of Health of the People's Republic of China (Document No. 55, 2001). Male C57BL / 6J mice were purchased from the Experimental Animal Center of Nanjing Medical University. All animal experiments were approved by the Laboratory Animal Management Committee of Nanjing Medical University. All experimental animals were housed in the barrier facilities of the Experimental Animal Center of Nanjing Medical University, raised in a clean environment, at a temperature of (21±2) °C, a humidity of (35±2) %, with a 12h:12h light-dark cycle, free access to food and water, and the drinking water was distilled water prepared by the Experimental Animal Center.

[0083] 2. Viruses and drugs shPSTPIP2 lentivirus, with the negative control being shNC lentivirus, were both commissioned to be prepared by Vigene Biosciences Co., Ltd. Both used the pLent-CMV-copGFP-P2A-Puro lentiviral expression vector; the competent cells were selected as the Bacillus strain DH5α; the resistance was Amp.

[0084] 3. Some related reagents and kits BCA Protein Assay Kit (Takara).

[0085] 4. Statistical analysis method All data in the embodiments were expressed as mean ± standard deviation. The difference analysis between two groups was performed using a t-test, and p<0.05 was used as the reference standard for statistical differences.

[0086] Example 1: Construction of a Kawasaki disease model mouse In this example, first, the Lactobacillus cell wall extract LCWE was prepared, and then a Kawasaki disease model mouse was constructed by intraperitoneal injection, specifically including the following steps: 1) Prepare MRS liquid medium (lactic acid bacteria medium), inoculate 5 μL of Lactobacillus casei (CICC 6105) into 0.5 mL of MRS medium, and incubate statically at 37 °C for 24 hours to obtain culture solution I.

[0087] 2) Inoculate the above 0.5 mL of culture solution I into 50 mL of MRS liquid medium, and incubate at 37 °C overnight to obtain culture solution II.

[0088] 3) Take 10 mL of culture solution II and inoculate it into 500 mL of MRS liquid medium, and incubate at 37 °C for 24 - 48 hours.

[0089] 4) Collect bacteria in the logarithmic growth phase, centrifuge at 4 °C and 5000 rpm for 20 min, take the bacterial precipitate, and wash it three times with PBS.

[0090] 5) Weigh the mass of the bacterial precipitate, resuspend and lyse it thoroughly with 10 - fold volume of 4% SDS, and shake it overnight at 250 rpm on a shaker at 37 °C. Then centrifuge at 10000 rpm for 40 min, discard the supernatant, and wash the obtained bacterial precipitate with PBS repeatedly 10 times.

[0091] 6) Incubate with 2 - 10 - fold volume of RNase (Thermo Fisher Scientific, catalog number: EN0531), DNase (Roche, catalog number: 10104159001), and trypsin (Sigma - Aldrich, catalog number: T1426) (250 μg / mL) at 37 °C for 4 hours each to remove the adhesives on the bacterial cell wall. After digestion with each enzyme, wash it 4 times repeatedly with 2 - fold volume of PBS, then centrifuge at 10000 rpm for 40 min, discard the supernatant, and retain the bacterial precipitate.

[0092] 7) Weigh the mass of the bacterial precipitate, resuspend it with 4 - fold volume of PBS, sonicate it in an ice bath for 2 hours, and centrifuge at 4 °C and 15000 rpm for 1 hour to obtain Lactobacillus cell wall extract LCWE.

[0093] 8) Determine the rhamnose content in LCWE by the sulfuric acid - phenol colorimetric method, and adjust its final concentration to 1 mg / mL with PBS, and store it at - 80 °C for standby.

[0094] 9) Purchase 10 C57BL / 6 mice at 3 - 4 weeks old, and randomly divide them into 2 groups: experimental group and control group, with 5 mice in each group.

[0095] 10) Treat the mice in each group as follows: Experimental group: Inject 500 μL of LCWE into the peritoneal cavity of each mouse; Control group: Inject 500 μL of PBS into the peritoneal cavity of each mouse; The mice were sacrificed 14 days after injection. Plasma and PBMC were isolated from the mice, and the heart tissues were paraffin-embedded and stained with H&E. The results are shown in Figure 1 .

[0096] As Figure 1 shown, 14 days after LCWE injection, the content of inflammatory factors in the plasma of mice was detected by ELISA technology. The results showed that compared with the control group Ctrl, after LCWE injection, the content of IL-6 in the plasma of mice increased by 3.9 times ( Figure 1 A). In addition, by staining the paraffin sections of heart tissues with H&E, it was found that the infiltration of inflammatory cells around the coronary arteries in the mice injected with LCWE was significantly increased ( Figure 1 B). The above results indicate that the mouse model of Kawasaki disease induced by Lactobacillus cell wall extract LCWE was successfully constructed. (p<0.001).

[0097] Example 2: Role of PSTPIP2 in the occurrence of Kawasaki disease To explore the role of PSTPIP2 in the occurrence of Kawasaki disease, the above-mentioned mouse model of Kawasaki disease induced by LCWE was used in this example for further exploration experiments. After extracting PBMC from the model mice, the expression of PSTPIP2 was detected by Western blotting, specifically including: 1) Collect 100 μL of fresh anticoagulated blood from the control group and the Kawasaki disease model group mice, add 200 μL of red blood cell lysate, gently mix and place at room temperature for 5 minutes, then centrifuge at 2000 rpm for 5 minutes, discard the supernatant, and take the precipitate.

[0098] 2) Repeat the above step 1) until no obvious red blood cell precipitate is seen to obtain PBMC cell precipitate.

[0099] 3) Add 500 μL of PBS to the obtained PBMC cell precipitate to wash the PBMC cell precipitate, then centrifuge at 2000 rpm for 5 minutes, and discard the supernatant.

[0100] 4) Add 100 μL of cell lysate (Beyotime, catalog number: P0013B) containing 1 mM PMSF (Beyotime, catalog number: ST507), place on ice and lyse for 30 minutes to obtain the lysate.

[0101] 5) Centrifuge the obtained lysate at 12000 g for 15 minutes, transfer the obtained cell supernatant to a new EP tube, place on ice and wait for protein concentration determination, and discard the precipitate.

[0102] 6) The BCA Protein Assay Kit from Takara was used for protein concentration determination. That is, a standard curve was plotted after gradient dilution of the 2 g / mL BSA standard in the kit. The specific operations are as follows: Take 2 μL of the protein sample into a new 200 μL EP tube, add 10 μL of deionized water for dilution, and mix well; Take 10 μL of the mixed protein sample and add it to a 96-well plate; Prepare the BCA reaction solution according to the system of BCA Reagent A: BCA Reagent B = 49:1, and use it immediately after preparation; Add 200 μL of the BCA reaction solution to each sample well and incubate at room temperature for 30 minutes; Measure the absorbance value of each well with an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 562 nm; Plot a standard curve with the standard protein concentration as the abscissa and the absorbance value as the ordinate to obtain the equation of the standard curve. Calculate the protein concentration in the sample according to the standard curve.

[0103] 7) After measuring the protein concentration, add 5× protein Loading buffer, and boil in a water bath for 10 minutes. Immediately place the protein on ice after completion, and then perform a protein immunoblotting experiment later or store it at -20 °C.

[0104] 8) Prepare the SDS-polyacrylamide gel: Install the glass plates on the gel-making rack, and then quickly add the prepared lower-layer separating gel solution into the glass plates. After adjusting the appropriate liquid level height, seal the gel with anhydrous ethanol. After the lower-layer gel solidifies, pour out the anhydrous ethanol, rinse it with deionized water, blot the residual liquid with absorbent paper, then add the upper-layer stacking gel solution, insert a 1.5 mm, 10-well comb, and pull out the comb after the gel solidifies.

[0105] 9) Western blot: Vertically place the prepared SDS-polyacrylamide gel into the electrophoresis tank, fill it with electrophoresis buffer, and calculate the corresponding volume for loading according to the measured protein concentration with a total protein loading amount of 40 μg. After adding the sample to the sample well, first electrophorese at 80 V to allow the protein sample to pass through the stacking gel. After the sample enters the separating gel and the protein Maker bands are clearly separated, adjust the voltage to 120 V and continue electrophoresis for 1 - 2 hours until the Loading reaches the bottom of the separating gel, then turn off the power supply.

[0106] 10) Transfer of membrane (wet transfer method): Take out the pre-cooled transfer buffer and pour it into the transfer cassette. Immerse the transfer plate, sponge pad, and filter paper for transfer in the transfer buffer in sequence. After the protein gel electrophoresis is completed, peel the gel from the gel plate. Using the prestained protein Marker as a reference, cut out the gel area where the target protein is located and place it on the filter paper. Cut the PVDF membrane according to the size of the gel and place it in methanol for activation. Place the activated PVDF membrane on the gel, remove the air bubbles, then cover it with a moist filter paper and sponge in sequence, and clamp the transfer plate. Align the positive and negative electrodes, put it into the transfer tank, fill it with the transfer buffer, add an ice bath, cover the lid, and transfer the membrane in an ice bath at a constant current of 300 mA for 1 hour.

[0107] 11) Membrane blocking: After the transfer of the membrane is completed, immerse the PVDF membrane with the attached protein completely in 5% (w / v) skim milk powder prepared with TBST buffer (formula shown in Appendix 1), place it on a shaker at room temperature, incubate at 50 rpm for 1 hour to block the non-specific protein binding sites on the PVDF membrane. 12) Incubation with primary antibody: After the membrane blocking is completed, pour out the milk, add an appropriate amount of TBST buffer and rinse 3 times. Prepare 5 mL of primary antibodies PSTPIP2 (Abcam, catalog number: ab155543) and TUBULIN (Cell Signaling, catalog number: 2148) using the primary antibody dilution solution; add the primary antibodies to the corresponding membranes respectively, and place them on a rotary mixer at 4 °C overnight; 13) Incubation with secondary antibody: Recover the primary antibody, place the membrane in a membrane washing tank containing an appropriate amount of TBST buffer, place it on a shaker to wash the membrane at 180 rpm for 10 minutes, wash 3 times; prepare the secondary antibody (Cell Signaling, catalog number: 7074) with TBST buffer at a ratio of 1:4000, add the secondary antibody, place it on a shaker, and incubate at room temperature at a rotation speed of 50 rpm for 1 hour; 14) Exposure: Discard the secondary antibody, wash the membrane at 180 rpm for 10 minutes, wash 3 times and then perform exposure. Prepare the ECL chemiluminescence solution at a ratio of 1:1, evenly drip the ECL solution on the membrane, react at room temperature for 15 seconds and then use the Biorad chemiluminescence imager for exposure. The results are shown in Figure 2 。

[0108] As Figure 2 shown, the expression of PSTPIP2 in PBMC of mice in the Kawasaki disease model induced by LCWE was significantly up-regulated ( Figure 2 A). At the same time, after quantification by gray scale analysis, compared with the control group, the protein expression level of PSTPIP2 in PBMC of mice injected with LCWE was up-regulated by 2.4 times, and there was a significant statistical difference ( Figure 2 B). (P < 0.01).

[0109] Example 3: Knockdown of PSTPIP2 expression in PBMC blocks the occurrence of early inflammation in Kawasaki disease In this example, the effect of knocking down the expression of PSTPIP2 in PBMC on the early inflammatory response of murine Kawasaki disease was explored. The specific process is as Figure 3 shown, including the following steps: 1) Collect donor bone marrow cells from 8 - 10 - week - old C57BL / 6J mice, and infect them with shPSTPIP2 or control shNC lentivirus for 12 hours to obtain bone marrow cells infected with shPSTPIP2 lentivirus and shNC lentivirus respectively.

[0110] 2) Irradiate 5 - week - old C57BL / 6J mice at a dose of 1000 rads. Four hours later, divide the mice into three groups: ① Lenti - shNC control group, ② Lenti - shNC+LCWE group, and ③ Lenti - shPSTPIP2+LCWE group, and treat the mice in each group as follows: ① Lenti - shNC control group: Inject 5*10 6 bone marrow cells infected with shNC lentivirus into the tail vein of each mouse; ② Lenti - shNC+LCWE group: Inject 5*10 6 bone marrow cells infected with shNC lentivirus into the tail vein of each mouse; ③ Lenti - shPSTPIP2+LCWE group: Inject 5*10 6 bone marrow cells infected with shPSTPIP2 lentivirus into the tail vein of each mouse.

[0111] 3) Transfer the mice in each group after bone marrow transplantation to the Experimental Animal Center of Nanjing Medical University, and raise them in a clean environment at a temperature of (21±2) °C, a humidity of (35±2)%, with 12h:12h day - night intermittent lighting, free access to food and water, and the drinking water is distilled water prepared by the Experimental Animal Center.

[0112] 4) According to the description in Example 1, inject LCWE into the peritoneal cavity of the transplanted mice in groups ② and ③, take blood from the orbital vein once 7 days after injection, sacrifice the mice 14 days after injection, and collect separated plasma and PBMC.

[0113] 5) Use ELISA to detect the plasma separated in step 4, and use Trizol to extract the RNA of PBMC. The results are shown in Figure 4 . At the same time, measure the content of inflammatory factors and the mRNA expression level in the plasma of mice on the 7th and 14th days after injecting LCWE. The results are shown in Figure 5 and Figure 6 .

[0114] AsFigure 4 As shown, after extracting mouse PBMCs, RT-PCR was first used to detect the expression of PSTPIP2 to verify its knockdown efficiency. The results showed that on the 14th day after LCWE injection, compared with the mice in the Lenti-shNC+LCWE group, the knockdown efficiency of PSTPIP2 in the PBMCs of the mice in the Lenti-shPSTPIP2+LCWE group reached more than 75%.

[0115] As Figure 5 shown, on the 7th day of LCWE injection, compared with the mice in the Lenti-shNC+LCWE group, the content of IL-6 in the plasma of the mice in the Lenti-shPSTPIP2+LCWE group decreased by 1.7-fold ( Figure 5 A), and the content of IL-1β decreased by 12-fold ( Figure 5 B). After 14 days of LCWE injection, the content of IL-6 in the plasma of the mice in the Lenti-shPSTPIP2+LCWE group decreased by 2-fold compared with that in the Lenti-shNC+LCWE group.

[0116] As Figure 6 shown, after 14 days of LCWE injection, the mRNA expression levels of the inflammatory factors IL-6, IL-1β, and TNFα in the PBMCs of the mice in the Lenti-shPSTPIP2+LCWE group were significantly lower than those in the mice in the Lenti-shNC+LCWE group, decreasing by 4.2-fold, 3.4-fold, and 4.3-fold respectively ( Figure 6 A, B, and C).

[0117] The above results suggest that: In the Kawasaki disease mouse model, the expression of PSTPIP2 in PBMCs was significantly upregulated, and it induced the formation of early inflammation in Kawasaki disease by promoting the generation of inflammatory factors.

[0118] By using the lentivirus-mediated 4in1 shRNA technology to knockdown the expression of PSTPIP2 in mouse PBMCs, it inhibited the expression levels of early inflammatory factors in Kawasaki disease and reduced the content of inflammatory factors in the plasma, thereby blocking the occurrence and development of Kawasaki disease.

[0119] Example 4: Drug Screening Settings: Test group: Kawasaki disease model mice (expressing PSTPIP2), and a candidate substance was given; Control group: Kawasaki disease model mice (expressing PSTPIP2), without giving a candidate substance.

[0120] Detect the expression of PSTPIP2 in the test group and the control group respectively, and make a comparison. If the expression of PSTPIP2 in the test group is statistically lower (such as more than 30% lower) than that in the control group, it indicates that the candidate substance is a useful reagent for treating Kawasaki disease.

[0121] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications within the scope of the technical solution of the present invention, which are equivalent embodiments of equivalent changes. However, as long as the content does not depart from the technical solution of the present invention, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. Use of PSTPIP2 protein or its coding gene as a target in the preparation of a drug for treating Kawasaki disease.

2. Use of a PSTPIP2 inhibitor in the preparation of a drug for treating Kawasaki disease.

3. The application according to claim 2, characterized in that, The PSTPIP2 inhibitor includes: (1) shRNA targeting the PSTPIP2 gene; (2) siRNA targeting the PSTPIP2 gene; (3) A reagent that inhibits the transcriptional activity of the PSTPIP2 gene; (4) A reagent that inhibits the transcriptional level of PSTPIP2 mRNA; (5) A reagent that promotes the degradation of PSTPIP2 mRNA; (6) A reagent that inhibits the translation of PSTPIP2 mRNA; (7) A reagent that specifically recognizes a guide nucleic acid of the PSTPIP2 gene and cleaves it to reduce the expression level of PSTPIP2; (8) A reagent for partially or completely knocking out the PSTPIP2 gene; (9) A reagent that inhibits the function of the PSTPIP2 protein; (10) A reagent that promotes the degradation of the PSTPIP2 protein.

4. The application according to claim 3, characterized in that The PSTPIP2 inhibitor is shRNA targeting the PSTPIP2 gene; The PSTPIP2 inhibitor is 4in1 shPSTPIP2.

5. The application according to claim 4, characterized in that, The 4in1 shPSTPIP2 includes shRNA1, shRNA2, shRNA3 and shRNA4, and the nucleotide sequences of shRNA1, shRNA2, shRNA3 and shRNA4 are shown in SEQ ID NO:1, 2, 3 and 4 respectively.

6. A drug for treating Kawasaki disease, characterized in that, The drug can inhibit the expression of the PSTPIP2 gene or protein.

7. The medicament according to claim 6, wherein, The drug includes 4in1 shPSTPIP2, and a pharmaceutically acceptable carrier or excipient; The 4in1 shPSTPIP2 includes shRNA1, shRNA2, shRNA3 and shRNA4, and the nucleotide sequences of shRNA1, shRNA2, shRNA3 and shRNA4 are shown in SEQ ID NO: 1, 2, 3 and 4 respectively.

8. Use of PSTPIP2 protein or its coding gene as a target in screening for a candidate drug for the preparation of a drug for treating Kawasaki disease.

9. A method for screening a candidate drug for treating Kawasaki disease, the method comprising the following steps: (i) Treating a system expressing or containing PSTPIP2 with a test substance; (ii) Detecting the expression of PSTPIP2 in the system; (iii) Selecting a test substance that can inhibit the expression of PSTPIP2 as a candidate drug.

10. Use of a reagent that specifically recognizes the PSTPIP2 protein or its coding gene in the preparation of a reagent or kit for diagnosing or prognosticating Kawasaki disease.

11. The application according to claim 10, wherein The reagent that specifically recognizes the PSTPIP2 protein or its coding gene is selected from: Primers for specifically amplifying the coding gene of the PSTPIP2 protein; Probes for specifically recognizing the coding gene of the PSTPIP2 protein; or Antibodies or ligands that specifically bind to the PSTPIP2 protein.