A 7-amino-deacetylcephalosporanic acid producing strain, its preparation method and application

Abstract

The application belongs to the technical field of biology, and discloses a 7-amino-deacetylcephalosporin producing bacterium as well as a preparation method and application thereof. The 7-amino-deacetylcephalosporin producing bacterium is obtained by knocking out acetoxy synthase / hydroxylase genes and acetyltransferase genes in cephalosporium acremonium and introducing related genes for synthesizing 7-amino-3-deacetoxycephalosporin. The 7-amino-deacetylcephalosporin producing bacterium can be used to directly prepare high-yield and high-purity 7-amino-deacetylcephalosporin through microbial fermentation.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, in particular to the technical field of engineering bacteria construction, and specifically relates to a 7-aminodesacetylcephalosporanic acid producing bacterium and a preparation method and application thereof. Background Art

[0002] 7-Aminodeacetylcephalosporanic acid (7-ADCA) is a key intermediate in the synthesis of various semi-synthetic cephalosporin antibiotics, such as cephalexin, cefadroxil, and cefaclor. Because it retains the β-lactam ring, a crucial structural unit for antibacterial activity, 7-ADCA exhibits broad-spectrum antimicrobial potential, thus playing a vital role in the pharmaceutical industry. With the increasing prevalence of antibiotic resistance, the demand for the development of new cephalosporins continues to grow, driving the demand for high-quality, high-yield 7-ADCA.

[0003] Traditionally, 7-ADCA has been primarily prepared through chemical or enzymatic methods. For example, it can be produced through multi-step chemical hydrolysis of cephalosporin C or enzymatic conversion from 7-aminocephalosporanic acid (7-ACA). However, chemical methods often require the use of hazardous reagents such as strong acids or bases, resulting in harsh reaction conditions and the generation of large amounts of toxic and hazardous waste, causing serious environmental pollution. Furthermore, the complex reaction steps and low yields make it difficult to achieve green and clean production on an industrial scale. While microbial catalysis or enzymatic methods can alleviate environmental pollution issues to a certain extent, they still face numerous technical bottlenecks in terms of catalytic efficiency, substrate adaptability, and control of reaction conditions.

[0004] In recent years, with the rapid development of synthetic biology and metabolic engineering, a growing number of researchers have begun to optimize the biosynthetic pathway of 7-ADCA by constructing efficient genetically engineered strains. This approach has the potential to not only simplify the production process, reduce energy consumption and material costs, but also significantly reduce the burden on the environment, aligning with the industrial trend of green and sustainable development. Summary of the Invention

[0005] One objective of the present invention is to provide a method for producing a highly productive 7-ADCA recombinant Cephalosporium acremonium strain. The method involves knocking out the acetoxycephalosporin C synthetase / hydroxylase gene and the acetyltransferase gene in Acremonium chrysogenum and introducing an expandase and acylase enzyme to produce the 7-aminodesacetylcephalosporanic acid-producing strain.

[0006] Specifically, the amino acid sequence encoded by the deacetoxycephalosporin C synthetase / hydroxylase gene has the NCBI accession number P11935.1; more specifically, the sequence of the deacetoxycephalosporin C synthetase / hydroxylase gene is shown in SEQ ID NO. 2 or a degenerate sequence thereof.

[0007] Specifically, the amino acid sequence encoded by the expandase gene is any one of the expandases shown in SEQ ID NO. 12-18.

[0008] Preferably, the amino acid sequence of the acylase is shown in SEQ ID NO. 4, or has the NCBI number ABP51959.1, P15558.2, Q05053.2, AAC34685.2, WP_092168096.1, or a mutant thereof.

[0009] Preferably, the mutant is a mutant having one or more substitution mutations selected from the group consisting of L409Q, Q679S, S360Q, D154V, A210K, H499V, P316A, Y579E, Q125M, Q372Y, A138S, I660N, and M263A, based on the amino acid sequence shown in SEQ ID NO. 4.

[0010] Specifically, the introduction of the acylase is introducing the coding gene encoding the acylase into A. aculeatus, and the expression vector is introduced in the form of an expression cassette, which includes a promoter and a terminator, preferably, the promoter is the endogenous gpda promoter of A. aculeatus.

[0011] Further, the introduction is site-directed or random.

[0012] Further, the acetyltransferase gene encoding the amino acid sequence with the NCBI accession number X65583.1 is also knocked out or inactivated in A. aculeatus.

[0013] Preferably, the introduction is inserting the acylase gene into the position of the acetyltransferase in A. aculeatus, and integrating the acylase gene into the genome of A. aculeatus, and the amino acid sequence encoded by the acetyltransferase gene has the NCBI accession number X65583.1, specifically, the sequence of the acetyltransferase gene is shown in SEQ ID NO. 1 or SEQ ID NO. 3 or a degenerate sequence thereof.

[0014] Further, a target site shown in SEQ ID NO. 5 is designed on the acetyltransferase gene, preferably, the target site is a knockout target site.

[0015] Further, the vector backbone of the expression vector is plasmid pAN or pUC57.

[0016] Further, the screening marker of the expression vector is a nourseothricin resistance gene.

[0017] In the specific embodiment, the 7-amino-desacetylcephalosporanic acid synthesis pathway related gene is obtained by gene editing or homologous recombination.

[0018] The application also provides a 7-amino-desacetylcephalosporanic acid production strain obtained by the above preparation method.

[0019] The application further provides an application of the 7-amino-desacetylcephalosporanic acid production strain in preparing 7-amino-desacetylcephalosporanic acid.

[0020] The application also provides a method for preparing 7-amino-desacetylcephalosporanic acid, comprising the following steps: fermenting the 7-amino-desacetylcephalosporanic acid production strain to obtain 7-amino-desacetylcephalosporanic acid; and optionally, further comprising a step of collecting the 7-amino-desacetylcephalosporanic acid.

[0021] The application knocks out acetoxy synthase / hydroxylase gene and acetyltransferase gene in Acremonium chrysogenum, introduces expandase and acylase gene to obtain a 7-amino-desacetylcephalosporanic acid production strain. High yield and high purity 7-ADCA can be directly prepared by microbial fermentation. The yield of 7-ADCA of the recombinant strain SWC2414-L409Q can reach 436 mg / L in fermentation experiment, and the yield can reach 1000 mg / L in engineering strain fermentation experiment, achieving industrial fermentation synthesis of 7-ADCA. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The structural formula of 7-amino-desacetylcephalosporanic acid.

[0023] Figure 2 The synthesis pathway of 7-amino-desacetylcephalosporanic acid.

[0024] Figure 3 The plasmid pAN7-cefG map.

[0025] Figure 4 The verification schematic diagram of Ac-ΔcefG::cefCPCA. DETAILED DESCRIPTION

[0026] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0027] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0028] The method for detecting the concentration of 7-amino-deacetylcephalosporanic acid in the following examples is not particularly limited, and any method known to those skilled in the art can be used.

[0029] The 7-amino-deacetylcephalosporanic acid-producing strain and the method for producing 7-amino-deacetylcephalosporanic acid thereof according to the present application will be further described in detail below in conjunction with specific examples. The technical solutions of the present application include but are not limited to the following examples.

[0030] Example 1, construction of gene editing tools

[0031] In order to achieve the synthesis of 7-ADCA in the cephalosporium acremonium strain, it is necessary to first knock out the deacetoxycephalosporin C synthase / hydroxylase gene in the strain, and then introduce the expandase (i.e. deacetoxycephalosporin C synthase, H7, E727M2, E727M3, E727M5, E735M2, E735M3, E735M5) shown in SEQ ID NO. 4 and SEQ ID NO. 7-12 in patent CN202110676893.1, to construct a DAOC strain (as described in patent CN202411773160.X). On this basis, the present application further knocks out the acetyltransferase and introduces the acylase gene to optimize the metabolic pathway. The structural formula of the 7-ADCA is shown in Figure 1 The synthesis pathway is shown in Figure 2

[0032] In order to insert the acylase gene into the position of the cefG (acetyltransferase) gene, an editing tool pAN7-cefG gene knockout plasmid was designed and constructed. The sequence of the cefG gene is shown in SEQ ID NO. 1. The target sequence of the cefG gene was designed as sgRNA, as shown in SEQ ID NO. 5: 5'-ACTTGGCCCCGTACGGGCGC-3', and a corresponding primer pair was designed:

[0033] P1cefG-F: agccctgggttcgattcccagattacgcaACTTGGCCCCGTACGGGCGCt (SEQ ID NO. 6),

[0034] P1cefG-R: ttgctatttctagctctaaaacGCGCCCGTACGGGGCCAAGT (SEQ ID NO. 7),

[0035] ​PCR amplification was performed using the pAN7 plasmid as a template, and the amplification product was recovered. Subsequently, the plasmid was used to prepare host bacteria competent cells, and E. coli DH5α was preferably used as the host bacteria. Colony PCR was performed by picking single colonies for verification, and the plasmid that passed the preliminary verification was sequenced for verification. Finally, the sgRNA plasmid capable of specifically recognizing the cefG gene was obtained.

[0036] To further realize the transformation of the plasmid in A. terreus, the bleomycin resistance gene was replaced with a nourseothricin resistance gene, and the construction and PCR verification were performed according to the above method. The plasmid that passed the preliminary verification was sequenced for verification, and the specific sgRNA plasmid capable of recognizing the cefG gene and the cas9 protein expression cassette plasmid were obtained. The specific plasmid map is shown in Figure 3 , named pAN7-cefG. This modification not only improves the applicability of the plasmid in A. terreus, but also provides important tool support for subsequent gene editing and metabolic engineering.

[0037] Example 2, construction of homologous repair fragments

[0038] To achieve precise editing of the target gene, fungal genomic DNA extraction kit was used to extract genomic DNA from A. terreus (as described in patent CN202411773160.X). Based on this template, specific primer pairs were designed as shown in SEQ ID NO. 8-SEQ ID NO. 11:

[0039] cefG-LA-F: GACAAGATTGCGATGATGTGGAT (SEQ ID NO. 8);

[0040] cefG-LA-R: GGTGGGCGACGTGTGGCTGTAGGTGA (SEQ ID NO. 9);

[0041] cefG-RL-F: AGGCTATGGAGGTGTCAGCCTGCCGGT (SEQ ID NO. 10);

[0042] cefG-RL-R: GTGAAATGTGCTATGTTGCATCAAGTACC (SEQ ID NO. 11), which are used to amplify the left homologous arm (LA) and right homologous arm (RL) gene fragments, respectively, with lengths of 705 bp and 869 bp.

[0043] Next, the corresponding acylase NCBI number is P15558.2 (from Pseudomonas sp. SE83 strain), Q05053.2 (from Pseudomonas sp. V22 strain), AAC34685.2 (from Pseudomonas sp. 130 strain), WP_092168096.1 (from Bosea sp. OK403 strain, XY408), and ABP51959.1 (from Pseudomonas sp. GK16 strain, SEQ ID NO. 4) as a template to amplify the corresponding acylase fragment, and homologous recombination to obtain LA-XY408-RL, LA-SE83-RL, LA-P130-RL, LA-V22-RL, LA-GK16-RL, etc. Acylase fragments containing homologous arm fragments.

[0044] Example 3, Transformation of Cephalosporium acremonium Strains with Cephalosporin C Acylase and Verification of Recombinant Transformants

[0045] The donor DNA and the above-mentioned editing tool are co-transfected into the protoplasts of Cephalosporium acremonium (such as recombinant strains SWC01-SWC41 containing different types and copies of expandase as described in patent CN202411773160.X), and are coated on a selective medium for screening. The medium is composed of a selective upper basic medium (with added nourseothricin) and a lower MMSN basic medium (containing 0.95M sucrose, 0.6 / 1.2% agar, 0.05% glucose, 0.02% ASP+N, 2mM magnesium sulfate heptahydrate, 0.01% trace element solution). The trace element solution formula includes EDTA, ZnSO 4 7H2O, MnCl2·4H2O, etc. After treatment, the culture dish is inverted and incubated at 30°C for 5 days, and the results are observed.

[0046] The transformed A. terreus strains were selected from the regeneration plates, inoculated into PDA solid medium for continuous culture until the mycelium was raised and the surface was wrinkled. Then, the mycelium was transferred to liquid PDA medium for 4 days of culture. The genomic DNA was extracted by liquid nitrogen grinding method, and subsequent PCR amplification and sequencing analysis were performed. The PCR experiment designed positive control (plasmid DNA as template), negative control (A. terreus starting strain genomic DNA as template) and experimental group (recombinant transformant genomic DNA as template). If cephalosporin C acylase has been successfully integrated, it is expected that about 1026 bp of target resistance gene fragments can be amplified in the experimental group. Finally, the obtained PCR products were sent for sequencing identification, and the correct transformants were evaluated for fermentation performance. The recombinant transformants with verified success were preserved in glycerol. According to the type of introduced plasmid (i.e. the type of acylase and the copy number and type of expandase), the verified successful recombinant transformants were renamed. The acylases were XY408, SE83, P130, V22, GK16, the expandases were H7, E727M2, E727M3, E727M5, E735M2, E735M3, E735M5 (as shown in SEQ ID NO. 12-SEQ ID NO. 18), the number of expandases represented the copy number, PgpdA, Pacv, Ptefl, PtrpC, Pipns were different types of promoters, for example, 727M2-SE83 was expandase 727M2 single copy, acylase SE83, corresponding acylase NCBI number P15558.2, the recombinant transformant containing the gene fragment was named SWC2401; H7-H7-H7-H7-XY408 was expandase H7 with 4 copies, acylase XY408, corresponding acylase NCBI number WP_092168096.1, the recombinant transformant containing the gene fragment was named SWC2413; and so on, as shown in Table 1.

[0047] The recombinant transformant containing 727M2-SE83 gene type is named as SWC2401; the recombinant transformant containing 727M3-SE83 gene type is named as SWC2402, the recombinant transformant containing H7-SE83 gene type is named as SWC2403, the recombinant transformant containing H7-H7-SE83 gene type is named as SWC2404, the recombinant transformant containing PgpdA-727M2-727M2-SE83 gene type is named as SWC2405, the recombinant transformant containing Pacv-727M2-727M2-SE83 gene type is named as SWC2406, the recombinant transformant containing Pacv-H7-H7-SE83 gene type is named as SWC2407, the recombinant transformant containing 727M2-727M2-P130 gene type is named as SWC2408, the recombinant transformant containing 727M2-727M2-727M2-V22 gene type is named as SWC2409, the recombinant transformant containing LA-727M2-727M2-727M2-727M2-P130 gene type is named as SWC2410, the recombinant transformant containing H7-H7-P130 gene type is named as SWC2411, the recombinant transformant containing H7-H7-H7-P130 gene type is named as SWC2412, the recombinant transformant containing H7-H7-H7-H7-XY408 gene type is named as SWC2413, the recombinant transformant containing PgpdA-727M2-GK16 gene type is named as SWC2414, the recombinant transformant containing Ptefl-727M2-P130 gene type is named as SWC2415, the recombinant transformant containing PtrpC-727M2-V22 gene type is named as SWC2416, the recombinant transformant containing Pacv-727M2-V22 gene type is named as SWC2417, the recombinant transformant containing Pipns-727M2-P130 gene type is named as SWC2418, the recombinant transformant containing PgpdA-H7-SE83 gene type is named as SWC2419, the recombinant transformant containing Ptefl-H7-V22 gene type is named as SWC2420, the recombinant transformant containing PtrpC-H7-X408 (the H7 single copy is expanded as an acylase, and the XY408,The recombinant transformant containing the gene type of the promoter PtrpC is named SWC2421, the recombinant transformant containing the gene type of Pacv-H7-X408 is named SWC2422, the recombinant transformant containing the gene type of Pipns-H7-V22 is named SWC2423, the recombinant transformant containing the gene type of PgpdA-727M2-727M2-V22 is named SWC2424, the recombinant transformant containing the gene type of PgpdA-727M2-727M2-727M2-V22 is named SWC2425, the recombinant transformant containing the gene type of PgpdA-727M2-727M2-727M2-727M2-V22 is named SWC2426, the recombinant transformant containing the gene type of PgpdA-H7-H7--GK16 is named SWC2427, the recombinant transformant containing the gene type of PgpdA-H7-H7-H7-P130 is named SWC2428, the recombinant transformant containing the gene type of PgpdA-H7-H7-H7-H7-P130 is named SWC2429, the recombinant transformant containing the gene type of Pacv-727M2-727M2-P130 is named SWC2430, the recombinant transformant containing the gene type of Pacv-727M2-727M2-727M2-P130 is named SWC2431, the recombinant transformant containing the gene type of Pacv-727M2-727M2-727M2-727M2-P130 is named SWC2432, the recombinant transformant containing the gene type of Pacv-H7-H7-P130 is named SWC2433, the recombinant transformant containing the gene type of Pacv-H7-H7-H7-SE83 is named SWC2434, the recombinant transformant containing the gene type of Pacv-H7-H7-H7-H7-727M2-SE83 is named SWC2435, the recombinant transformant containing the gene type of Pipns-727M2-727M2-GK16 is named SWC2436, the recombinant transformant containing the gene type of Pipns-727M2-727M2-727M2-P130 is named SWC2437, the recombinant transformant containing the gene type of Pipns-727M2-727M2-727M2-727M2-XY408 is named SWC2438, the recombinant transformant containing the gene type of Pipns-H7-H7-SE83 is named SWC2439, the recombinant transformant containing the gene type of Pipns-H7-H7-H7-V22 is named SWC2440, the recombinant transformant containing the gene type of Pipns-H7-H7-H7-H7-P130 is named SWC2441.

[0048] Table 1, verification of successful recombinant transformants corresponding to recombinant bacteria

[0049] ;

[0050]

[0051] Example 4, fermentation verification of recombinant transformants

[0052] The recombinant A. terreus verified to be correct in Example 3 was activated and cultured, and a streaking was performed on a PDA solid medium plate containing a final concentration of 300 ug / mL of nourseothricin using an inoculation needle, and after treatment with a sealing film, the culture plate was inverted and cultured in an incubator at 30°C for 12-14 days. When the streaked plate grew large monoclone mycelium and the surface was obviously raised, the monoclone was picked up using an inoculation loop, and a colony band of 3x4 cm in size was drawn on another culture plate, and the culture was continued for 12-14 days. The colony band grown from the plate was inoculated in a 100 mL shake flask containing 20 mL of seed medium (corn syrup 30 g·L -1 , sucrose 35 g·L -1 , glucose 5 g·L -1 , methionine 0.5 g·L -1 , ammonium sulfate 8 g·L -1 , calcium carbonate 5 g·L -1 , soybean oil 5 g·L -1 , natural pH) at 230 rpm and 28°C for 4 days. Then, it was transferred to a 7.5 L fermenter containing 3 L of fermentation medium (corn syrup 60 g·L -1 , soybean oil 60 g·L -1 , glucose 40 g·L -1 , starch 30 g·L -1 , dextrin 20 g·L -1 , alpha-amylase 0.2 g·L -1 , D / L methionine 6 g·L -1 , ammonium sulfate 30 g·L -1 , magnesium sulfate 3 g·L -1 , calcium carbonate 5 g·L -1 , potassium dihydrogen phosphate 7 g·L -1 , trace elements (ferrous sulfate 0.3 g·L -1 , copper sulfate 0.02 g·L -1 , zinc sulfate 0.02 g·L -1 , manganese sulfate 0.01 g·L -1 ) at a pH of 7.4 using sodium hydroxide, and fermentation was performed.

[0053] HPLC detection of fermentation product: about 10 mL of fermentation broth was taken from the fermenter for glucose content determination, nitrogen content determination, cell dry weight determination, cell microscopic examination and HPLC determination. The sample preparation conditions for HPLC determination are as follows: 200 ul of fermentation broth and 800 ul of methanol were mixed, vortexed and shaken to terminate the reaction, and the sample was filtered before being injected. The chromatographic column used was ZORBAX SB-C18 Analytical 4.6x150mm 5-Micron, and the mobile phase conditions were as follows: mobile phase A was methanol 4%, mobile phase B was 0.2% phosphate 96%, pH adjusted to 7.4 with sodium hydroxide, and the detection conditions were as follows: UV detector, 254 nm, running for 15 min, injection 10 ul, column temperature 30°C, flow rate 1 mL / min, detection program as shown in Table 2, and the detection results are shown in Table 3. 7-ADCA was detected in the fermentation broth, indicating that the recombinant A. atopovirifaciens transformant obtained by the present application can directly ferment 7-ADCA in one step. If the fermentation process and product purification and extraction steps are further optimized, the 7-ADCA production strain obtained by the present application can fully have the potential for industrial use.

[0054] Table 2, 7-ADCA detection program

[0055]

[0056] Table 3, fermentation transformant verification

[0057] ;

[0058]

[0059] Example 5, acylase mutant screening and fermentation verification

[0060] To further improve the activity of deacylase in A. chrysogenum, a random mutant library was established using the sequence of the acylase gene (CPCA) in SWC2414 in Example 4 as a template to obtain a higher conversion rate of product 7-ADCA by error-prone PCR. The error-prone PCR reaction conditions are as follows: the acylase of Pseudomonas sp. GK16 strain in Example 2 (ABP51959.1) was used as a template, and the system included: 10 ng of template, 50 mM KCl, 2 mM MgCl2, 0.05-0.075 mM MnCl2, 0.2 mM dATP, 0.2 mM dGTP, 1.0 mM dCTP, 1.0 mM dTTP, 0.2 mM upper and lower primers, and 5 U Taq enzyme. The reaction conditions of PCR were: 94°C for 3 min; (94°C for 20 s; 55°C for 20 s; 72°C for 60 s) for 25 cycles; 72°C for 3 min, and a mutant fragment of the acylase gene was obtained. The homologous repair fragment was constructed according to Example 2. The homologous fragment and the editing tool in Example 1 were co-transformed into A. chrysogenum to obtain different mutant strains.

[0061] The different mutant strains were cultured and fermented according to the method of Example 4, and the results are shown in Table 4.

[0062] Table 4, 7-ADCA yield identification

[0063]

[0064] According to the 7-ADCA yield data shown in Table 4, there are significant differences in the 7-ADCA yield of different strains. The 7-ADCA yield of strain SWC2414-L409Q is the highest, reaching 436 mg / L, followed by SWC2414-Q679S with a yield of 432 mg / L, SWC2414-S360Q and SWC2414-D154V with yields of 413 mg / L and 410 mg / L, respectively, and SWC2414-M263A with the lowest yield of 255 mg / L. Overall, these strains perform differently in 7-ADCA production, indicating that gene modification has a significant impact on 7-ADCA yield.

[0065] Example 6, construction of recombinant A. chrysogenum engineering strain (Ac-ΔcefG::cefCPCA)

[0066] The acylase of recombinant strain SWC2414-L409Q in Example 5 was constructed into a pUC57 expression vector, as shown in Figure 4As shown, the pUC57-GK16-L409Q plasmid was obtained. The plasmid was transformed into A. caespitosa. Fermentation culture was carried out according to Example 4, fermentation was carried out in 7.5 L, and the 7-ADCA product was checked at 1000 mg / L.

[0067] In summary, the 7-amino-deacetylcephalosporanic acid production strain and the preparation method thereof provided by the present application have high efficient conversion of raw materials under mild conditions, not only the yield is significantly improved, but also the method has good environmental friendliness and economic feasibility, and has a broad industrial application prospect.

Claims

1. A method for preparing a 7-aminodesacetylcephalosporanic acid producing strain, characterized in that: The acetoxycephalosporin C synthetase / hydroxylase gene and acetyltransferase gene were knocked out in Cephalosporium acremonium, and the expandase gene and acylase gene were introduced to obtain a 7-aminodesacetylcephalosporanic acid producing strain. Wherein: the amino acid sequence encoded by the deacetyloxycephalosporin C synthetase / hydroxylase gene has an NCBI accession number of P11935.1; the amino acid sequence encoded by the acetyltransferase gene has an NCBI accession number of X65583.1; The amino acid sequence encoded by the expandase gene is SEQ ID NO. 13, and the acylase NCBI number is P15558.2; Or the amino acid sequence encoded by the expandase gene is SEQ ID NO. 14, and the acylase NCBI number is P15558.2; Or the amino acid sequence encoded by the expandase gene is SEQ ID NO.12, and the acylase NCBI number is P15558.2; Or the amino acid sequence encoded by the expandase gene is SEQ ID NO. 13, and the acylase NCBI number is AAC34685.2; Or the amino acid sequence encoded by the expandase gene is SEQ ID NO. 13, and the acylase NCBI number is Q05053.2; Or the amino acid sequence encoded by the expandase gene is SEQ ID NO. 12, and the acylase NCBI number is AAC34685.2; Alternatively, the amino acid sequence encoded by the expandase gene is SEQ ID NO. 12, and the acylase NCBI number is WP_092168096.1; Alternatively, the amino acid sequence encoded by the expandase gene is SEQ ID NO. 13, and the acylase has the NCBI number ABP51959.1, or a mutant thereof; wherein the mutant has only the following substitution mutations based on the amino acid sequence of NCBI number ABP51959.1: L409Q, Q679S, S360Q, D154V, A210K, H499V, P316A, Y579E, Q125M, Q372Y, A138S, I660N, or M263A; Or the amino acid sequence encoded by the expandase gene is SEQ ID NO.12, and the acylase NCBI number is Q05053.2; Or the amino acid sequence encoded by the expandase gene is SEQ ID NO. 12, and the acylase NCBI number is ABP51959.1; Alternatively, the amino acid sequence encoded by the expandase gene is SEQ ID NO. 13, and the acylase NCBI number is WP_092168096.

1.

2. The preparation method according to claim 1, wherein: The acylase is introduced by introducing the gene encoding the acylase into Cephalosporium acremonium in the form of an expression vector of an expression cassette, including a promoter and a terminator.

3. The preparation method according to claim 1, characterized in that The acylase is introduced by inserting the gene encoding the acylase into the position of the acetyltransferase in Cephalosporium acremonium and integrating the gene into the genome of Cephalosporium acremonium.

4. The preparation method according to claim 2, characterized in that The vector backbone of the expression vector is pAN or pUC57.

5. A 7-aminodesacetylcephalosporanic acid producing strain obtained according to any one of claims 1 to 4.

6. Use of the 7-aminodesacetylcephalosporanic acid-producing strain according to claim 5 in the preparation of 7-aminodesacetylcephalosporanic acid.

7. A method for preparing 7-aminodesacetylcephalosporanic acid, comprising the steps of: fermenting the 7-aminodesacetylcephalosporanic acid-producing strain according to claim 5 to obtain 7-aminodesacetylcephalosporanic acid, and collecting the 7-aminodesacetylcephalosporanic acid.

Images