Lactic dehydrogenase mutant, biological material, catalyst and application
The mutant LDH with specific amino acid mutations significantly enhances NADH regeneration efficiency, addressing the low catalytic efficiency of existing LDH systems by achieving a 1.64-fold improvement in catalytic performance across a range of temperatures and pH values.
Patent Information
- Application Number
- CN202510779877.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-06-12
AI Technical Summary
Current LDH-based NADH regeneration systems suffer from low catalytic efficiency, with suboptimal NAD+ affinity and conversion rates that fail to meet industrial demands.
A mutant lactate dehydrogenase (LDH) with specific amino acid mutations at positions 234, 248, and 251 (S234R/G248C/Y251R) is developed, enhancing the catalytic efficiency for NAD+ reduction to NADH.
The mutant LDH exhibits a 1.64-fold increase in NADH regeneration rate compared to the wild-type, effectively catalyzing NADH synthesis under varied conditions from 20-40°C and pH 7-11.
Smart Images

Figure CN120272450A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of protein engineering, and particularly to a lactate dehydrogenase mutant, a biological material, a catalyst and applications thereof. Background Art
[0002] Lactate dehydrogenase (LDH) is a key redox enzyme widely present in organisms, which can reversibly catalyze the conversion between lactate and pyruvate, and can be accompanied by the mutual conversion between reduced coenzyme NADH and oxidized coenzyme NAD+. The reaction direction is dynamically regulated by substrate concentration, pH and coenzyme level. For example, the optimal pH for the conversion of lactate to pyruvate is slightly alkaline, while the reverse reaction favors an acidic environment. In addition, the NAD + / NADH ratio and the auxiliary effect of metal ions also significantly affect its catalytic activity.
[0003] The industrial application value of LDH is reflected in multiple fields: in food fermentation, lactic acid bacteria convert pyruvate generated by glycolysis into lactic acid through LDH, giving yogurt and pickles unique flavors and preservative properties; in environmental treatment, LDH can degrade industrial wastewater containing lactic acid and promote the decomposition of organic pollutants. More promising is its use as a coenzyme regeneration tool enzyme - using cheap lactic acid as a hydrogen donor, LDH can reduce NAD + to high-value NADH, which is of great significance in industrial catalysis dependent on NADH such as biopharmaceuticals and chiral compound synthesis. For example, the production of steroid drugs consumes a large amount of NADH. If coenzyme recycling and regeneration are achieved through LDH, the production cost can be significantly reduced.
[0004] However, the current NADH regeneration system based on LDH faces a core bottleneck of low catalytic efficiency: the affinity of LDH for NAD + and the turnover number are far lower than the ideal level, and the NADH regeneration rate is difficult to meet the industrial demand. Summary of the Invention
[0005] Object of the Invention: The object of the present invention is to provide a lactate dehydrogenase mutant with high catalytic activity; the second object is to provide biological materials and catalysts related to the mutant; the third object is to provide the applications of the mutant and the catalyst in the catalytic synthesis of NADH.
[0006] Technical Solution: The lactate dehydrogenase mutant described in the present invention is based on the amino acid sequence of the wild-type lactate dehydrogenase shown in SEQ ID NO: 1, and has a mutation of one or more amino acid residues at positions 234, 248, and 251, wherein the reference sequence of the amino acid sequence of the wild-type lactate dehydrogenase is GenBank: ABX32580.1.
[0007] Preferably, in the amino acid mutations, the serine residue at position 234 is mutated to an arginine residue, the glycine residue at position 248 is mutated to a cysteine residue, and the tyrosine residue at position 251 is mutated to an arginine residue.
[0008] Preferably, the lactate dehydrogenase mutant has an amino acid sequence shown in any one of SEQ ID NO: 2-7.
[0009] The nucleotide sequence of the present invention, based on the wild-type lactate dehydrogenase nucleotide sequence, contains corresponding base mutations and encodes the amino acid sequence of the aforementioned lactate dehydrogenase mutant.
[0010] Preferably, the wild-type lactate dehydrogenase nucleotide sequence has the Petrotoga mobilis codon-optimized nucleotide sequence of the source lactate dehydrogenase.
[0011] The recombinant vector of the present invention contains the aforementioned nucleotide sequence.
[0012] The recombinant microorganism of the present invention contains the aforementioned nucleotide sequence or recombinant vector.
[0013] The catalyst of the present invention contains the aforementioned lactate dehydrogenase mutant.
[0014] Use of the lactate dehydrogenase mutant or catalyst of the present invention in the synthesis of NADH.
[0015] Preferably, the reaction temperature of the catalysis is 20-40 °C and the pH is 7-11.
[0016] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: 1. By mutating the active site of the Petrotoga mobilis source lactate dehydrogenase, the finally obtained mutant significantly improves the regeneration efficiency of the reduced coenzyme NADH. The catalytic efficiency of the preferred mutant S234R / G248C / Y251R is 1.64 times that of the wild-type lactate dehydrogenase; 2. Effectively expands the reaction conditions of lactate dehydrogenase. The mutant can efficiently catalyze the synthesis of NADH under the conditions of 20-40 °C and pH 7-11. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 Comparison chart of the relative activities of the lactate dehydrogenase mutants in Examples 1-7 for catalyzing the reduction of the oxidized coenzyme NAD + to the reduced coenzyme NADH;
[0018] Figure 2Relative activity comparison chart of the lactate dehydrogenase mutant S234R / G248C / Y251R catalyzing the reduction of oxidized coenzyme NAD to reduced coenzyme NADH at different temperatures; +
[0019] Figure 3 Relative activity comparison chart of the lactate dehydrogenase mutant S234R / G248C / Y251R catalyzing the reduction of oxidized coenzyme NAD to reduced coenzyme NADH at different pH values. + Detailed implementation manners
[0020] The technical solution of the present invention will be further described below.
[0021] Example 1: Construction of wild-type lactate dehydrogenase and preparation of crude enzyme solution
[0022] The codon-optimized wild-type gene of lactate dehydrogenase with the sequence shown in SEQ ID NO: 8 was synthesized by Suzhou GeneScript Biotech Co., Ltd. and constructed on the pET22b vector to obtain pET22b-LDH. Among them, the pET22b vector was provided by GeneScript Biotech Co., Ltd. Petrotoga mobilis
[0023] pET22b-LDH was transformed into E.coli DH5α strain. The recombinant bacterium E.coli DH5α / pET22b-G6PD was inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin, and cultured at 37 °C and 220 rpm for 12 h.
[0024] After the culture, the cells were centrifuged at 12000 rpm for 1 min and the cells were collected. Using a high-purity plasmid miniprep kit, the pET22b-LDH plasmid was extracted as a template for iterative mutagenesis, which was used for the construction of subsequent LDH mutants.
[0025] At the same time, pET22b-LDH was transferred into E.coli BL21(DE3) to construct the recombinant mutant expression strain E.coli BL21(DE3) / pET22b-LDH. The successfully constructed recombinant mutant expression strain was spread on a plate containing ampicillin with a final concentration of 100 μg / mL and cultured at 37 °C for 18 h.
[0026] After the culture, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and cultured at 37 °C at 200 rpm for 18 h. Then, it was transferred to 500 mL of LB medium containing ampicillin with a final concentration of 100 μg / mL at an inoculation amount of 1%. When the OD 600 When it reached 0.6, isopropyl-β-D-thiogalactoside (IPTG) with a final concentration of 0.5 mM was added, and induction was carried out at 18 °C for 14 h.
[0027] After centrifugation at 4000 rpm for 20 min, the bacterial cells were obtained, resuspended in 50 mM Tris-HCl buffer with pH = 8, and 1 mL of the bacterial solution with OD 600 = 30 was taken. Under ice bath conditions, ultrasonic treatment was carried out at 65 W, with each working for 2 s and an interval of 5 s, and the total working time was 30 min to break the cells. Then centrifugation was carried out at 12000 rpm for 20 min at 4 °C. The supernatant was collected and filtered through a 0.22 μm aqueous filter head to obtain the crude enzyme solution of the reaction.
[0028] The amino acid sequence of wild-type lactate dehydrogenase is shown in SEQ ID NO: 1.
[0029] Example 2: Construction of lactate dehydrogenase mutant S234R and preparation of crude enzyme solution
[0030] 1. Recombinant Escherichia coli E.coli Construction of BL21(DE3) / pET22b-LDH-S234R
[0031] Gene mutation was carried out by the method of whole plasmid PCR to obtain the target mutant gene. The primers are as follows:
[0032] Upstream primer of S234R, SEQ ID NO: 9: GGCATTGCCCGCGCCACCACCGCCTTAGTGG
[0033] Downstream primer of S234R, SEQ ID NO: 10: GTGGTGGCGCGGGCAATGCCGTAATTGGT
[0034] The PCR system is shown in Table 1, and the reaction conditions are shown in Table 2.
[0035] Table 1 PCR reaction system
[0036]
[0037] Table 2 PCR reaction conditions
[0038]
[0039] After the PCR amplification was completed, the amplification product was detected by 0.9% agarose gel electrophoresis. The result showed that the amplification product was a single band with a size of about 6000 bp. The amplification product was purified and recovered using a DNA recovery and purification kit.
[0040] The purified gene fragment was digested with DpnI enzyme to remove the template and then recombined with a recombinase. The recombinant product was transformed intoE.coli In DH5α competent cells, they were spread on an LB plate containing 100 μg / mL ampicillin and cultured at 37 °C for 12 h.
[0041] After culturing, single colonies were picked and transferred to LB liquid culture containing 100 μg / mL ampicillin, and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing to verify the correctness of the mutation sites. After verification, part of the bacterial liquid was stored at -80 °C for later use, and part of the bacterial liquid was used to extract the recombinant plasmid pET22b-LDH-S234R, which was stored in a -20 °C refrigerator.
[0042] The successfully sequenced recombinant expression plasmid pET22b-LDH-S234R was transferred into E.coli BL21(DE3) to construct a recombinant mutant expression strain E.coli BL21(DE3) / pET22b-LDH-S234R.
[0043] 2. Cultivation of the recombinant mutant expression strain and preparation of crude enzyme solution
[0044] The successfully constructed recombinant mutant expression strain E.coli BL21(DE3) / pET22b-LDH-S234R was spread on a culture plate containing 100 μg / mL ampicillin at a final concentration and cultured at 37 °C for 18 h.
[0045] After culturing, single colonies were picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and cultured at 37 °C at 200 rpm for 18 h. Then, it was transferred to 500 mL of LB medium containing 100 mg / mL ampicillin at a final concentration at an inoculation amount of 1%, and IPTG with a final concentration of 0.5 mM was added when OD 600 = 0.6, and induced at 18 °C for 14 h.
[0046] After centrifugation at 4000 rpm for 20 min, the cells were obtained, resuspended with 50 mM Tris-HCl buffer at pH = 8. Take 1 mL of bacterial liquid with OD 600 = 30, and under ice bath conditions, ultrasonicate at 65 W for 2 s every 5 s, with a total working time of 30 min to break the cells, and then centrifuge at 12000 rpm for 20 min at 4 °C. The supernatant was collected and filtered through a 0.22 μm aqueous filter head to obtain the crude enzyme solution containing the lactate dehydrogenase mutant S234R.
[0047] The amino acid sequence of the lactate dehydrogenase mutant S234R is shown in SEQ ID NO: 2.
[0048] Example 3: Construction of Lactate Dehydrogenase Mutant G248C and Preparation of Crude Enzyme Solution
[0049] For the construction of the G248C mutant and the preparation of the crude enzyme solution, on the basis of Example 2, the primers were changed in step 1, and the other conditions remained unchanged. The primers are as follows:
[0050] G248C upstream primer, SEQ ID NO: 11: TTAAGAATGAGTGCCGCGTTTATACCCCG
[0051] G248C downstream primer, SEQ ID NO: 12: TAAACGCGGCACTCATTCTTAATAATGCTTTC
[0052] The amino acid sequence of lactate dehydrogenase mutant G248C is as shown in SEQ ID NO: 3.
[0053] Example 4: Construction of Lactate Dehydrogenase Mutant Y251R and Preparation of Crude Enzyme Solution
[0054] For the construction of the Y251R mutant and the preparation of the crude enzyme solution, on the basis of Example 2, the primers were changed in step 1, and the other conditions remained unchanged. The primers are as follows:
[0055] Y251R upstream primer, SEQ ID NO: 13: GGCCGCGTTCGCACCCCGAGTGTGCTGCTG
[0056] Y251R downstream primer, SEQ ID NO: 14: CACTCGGGGTGCGAACGCGGCCCTCATTCTT
[0057] The amino acid sequence of lactate dehydrogenase mutant Y251R is as shown in SEQ ID NO: 4.
[0058] Example 5: Construction of Lactate Dehydrogenase Mutant S234R / G248C and Preparation of Crude Enzyme Solution
[0059] For the construction of the S234R / G248C mutant and the preparation of the crude enzyme solution, on the basis of Example 2, in step 1, the plasmid obtained in Example 2 was used as the template and the primers were changed, and the other conditions remained unchanged. The primers are as follows:
[0060] S234R / G248C upstream primer, SEQ ID NO: 15: TTAAGAATGAGTGCCGCGTTTATACCCCG
[0061] S234R / G248C downstream primer, SEQ ID NO: 16: TAAACGCGGCACTCATTCTTAATAATGCTTTC
[0062] The amino acid sequence of the lactate dehydrogenase mutant S234R / G248C is as shown in SEQ ID NO: 5.
[0063] Example 6: Construction of Lactate Dehydrogenase Mutant S234R / Y251R and Preparation of Crude Enzyme Solution
[0064] For the construction of the S234R / Y251R mutant and the preparation of the crude enzyme solution, on the basis of Example 2, in step 1, using the plasmid obtained in Example 2 as a template and changing the primers, with other conditions remaining unchanged, the primers are as follows:
[0065] S234R / Y251R upstream primer, SEQ ID NO: 17: GGCCGCGTTCGCACCCCGAGTGTGCTGCTG
[0066] S234R / Y251R downstream primer, SEQ ID NO: 18: CACTCGGGGTGCGAACGCGGCCCTCATTCTT
[0067] The amino acid sequence of the lactate dehydrogenase mutant S234R / Y251R is as shown in SEQ ID NO: 6.
[0068] Example 7: Construction of Lactate Dehydrogenase Mutant S234R / G248C / Y251R and Preparation of Crude Enzyme Solution
[0069] For the construction of the S234R / G248C / Y251R mutant and the preparation of the crude enzyme solution, on the basis of Example 2, in step 1, using the plasmid obtained in Example 5 as a template and changing the primers, with other conditions remaining unchanged, the primers are as follows:
[0070] S234R / G248C / Y251R upstream primer, SEQ ID NO: 19: GGCCGCGTTCGCACCCCGAGTGTGCTGCTG
[0071] S234R / G248C / Y251R downstream primer, SEQ ID NO: 20: CACTCGGGGTGCGAACGCGGCCCTCATTCTT
[0072] The amino acid sequence of the lactate dehydrogenase mutant S234R / G248C / Y251R is as shown in SEQ ID NO: 7.
[0073] Test Example 1: Performance Test of Lactate Dehydrogenase Mutants
[0074] 1. Lactate dehydrogenase and its mutants catalyze the oxidation of coenzyme NAD + to be reduced to reduced coenzyme NADH
[0075] Using the crude enzyme solutions containing wild-type lactate dehydrogenase or mutants obtained in Examples 1-7 as catalysts.
[0076] The reaction system is as follows: 10 μL of any of the crude enzyme solutions obtained in Examples 1-7, 2.5 mM oxidized coenzyme NAD + , 2.5 mM lactate, and the reaction buffer is 50 mM Tris-HCl solution with pH = 8, with a total volume of 300 μL. The reaction temperature is controlled at 30 °C by a water bath, and the reaction lasts for 10 min. The absorbance change of the product NADH at 340 nm within 10 min is detected by an enzyme-labeling instrument, and the relative activity is calculated.
[0077] The test results are shown in Table 3 and Figure 1 .
[0078] Table 3 Lactate dehydrogenase is reduced to generate reduced coenzyme NADH.
[0079]
[0080] It can be seen from Figure 1 that the catalytic conversion rates of all mutants are higher than that of wild-type lactate dehydrogenase. In particular, the catalytic efficiency of the mutant S234R / G248C / Y251R is 1.64 times that of wild-type lactate dehydrogenase.
[0081] 2. Optimal temperature for the mutant S234R / G248C / Y251R of lactate dehydrogenase to catalyze the oxidation of coenzyme NAD + to be reduced to reduced coenzyme NADH
[0082] Using the crude enzyme solution containing the mutant S234R / G248C / Y251R obtained in Example 7 as a catalyst.
[0083] The reaction system is as follows: 10 μL of the crude enzyme solution obtained in Example 7, 2.5 mM oxidized coenzyme NAD + , 2.5 mM lactate, and the reaction buffer is 50 mM Tris-HCl buffer with pH = 8, with a total volume of 300 μL. The reaction temperature is controlled at 20 °C, 25 °C, 30 °C, 35 °C, and 40 °C by a water bath, and the reaction lasts for 10 min. The absorbance change of the product NADH at 340 nm within 10 min is detected by an enzyme-labeling instrument to compare the relative activity. The test results are shown in Figure 2 .
[0084] It can be seen from Figure 2It can be obtained that the best catalytic effect was observed at 35 °C, and the enzyme activity was good in the range of 20 - 40 °C.
[0085] 3. Optimal pH of lactate dehydrogenase mutant (S234R / G248C / Y251R) for catalyzing the reduction of oxidized coenzyme NAD + to reduced coenzyme NADH
[0086] The crude enzyme solution containing mutant S234R / G248C / Y251R obtained in Example 7 was used as the catalyst.
[0087] The reaction system was: 10 μL of the crude enzyme solution obtained in Example 7, 2.5 mM oxidized coenzyme NAD + , 2.5 mM lactic acid, and the reaction buffers were 50 mM potassium phosphate buffer at pH = 7, 50 mM potassium phosphate buffer at pH = 7.5, 50 mM potassium phosphate buffer at pH = 8, 50 mM Tris-HCl buffer at pH = 8.5, 50 mM Tris-HCl buffer at pH = 9, 50 mM Tris-HCl buffer at pH = 9.5, 50 mM Gly-NaOH buffer at pH = 10, 50 mM Gly-NaOH buffer at pH = 10.5, or 50 mM Gly-NaOH buffer at pH = 11, with a total volume of 300 μL. The reaction temperature was controlled at 35 °C by a water bath, and the reaction was carried out for 10 min. The absorbance change of the product NADH at 340 nm within 10 min was detected with an enzyme-linked immunosorbent assay reader to compare the relative activities. The test results are shown in Figure 3 .
[0088] It can be obtained from Figure 3 that different pH values have a significant effect on the catalytic action of LDH. The best catalytic effect was observed at pH = 10.5. In addition, the enzyme catalytic activity was relatively high in the range of pH = 7 - 11.
Claims
1. A lactate dehydrogenase mutant, characterized in that, Based on the wild-type lactate dehydrogenase amino acid sequence shown in SEQ ID NO: 1, having one or more amino acid residue mutations, where the serine residue at position 234 is mutated to an arginine residue, the glycine residue at position 248 is mutated to a cysteine residue, and the tyrosine residue at position 251 is mutated to an arginine residue.
2. The lactate dehydrogenase mutant according to claim 1, wherein, The lactate dehydrogenase mutant has an amino acid sequence shown in any one of SEQ ID NOs: 2-7.
3. A nucleotide sequence, characterized in that, Based on the wild-type lactate dehydrogenase nucleotide sequence, containing corresponding base mutations and encoding the amino acid sequence of the lactate dehydrogenase mutant according to any one of claims 1-2.
4. The nucleotide sequence according to claim 3, characterized in that, The wild-type lactate dehydrogenase nucleotide sequence is as shown in SEQ ID NO: 8 Petrotoga mobilis The codon-optimized nucleotide sequence derived from lactate dehydrogenase.
5. A recombinant vector, characterized in that, The recombinant vector contains the nucleotide sequence according to claim 3.
6. A recombinant microorganism, characterized in that, The recombinant microorganism contains the nucleotide sequence according to claim 3 or the recombinant vector according to claim 5.
7. A catalyst, characterized in that, The catalyst contains the lactate dehydrogenase mutant according to any one of claims 1-2.
8. Use of the lactate dehydrogenase mutant according to any one of claims 1-2 or the catalyst according to claim 7 in the synthesis of NADH.
9. The application according to claim 8, characterized in that, The reaction temperature of the catalysis is 20-40 °C and the pH is 7-11.
Citation Information
Patent Citations
D-lactic dehydrogenase mutant, preparation method, coding DNA and D-lactic acid production method and application thereof
CN118516320A
Lactate dehydrogenase mutant, polynucleotide coding the mutant, yeast cell having the polynucleotide, method of the mutant, and method of producing the lactate using the same
KR1020150096270A