Lactate dehydrogenase mutants, biomaterials, catalysts and applications

Abstract

The present invention discloses a lactate dehydrogenase mutant, a biomaterial, a catalyst and an application thereof, belonging to the field of protein engineering. Petrotoga mobilis The wild-type lactate dehydrogenase derived from the present invention has one or more amino acid residue mutations at positions 234, 248, and 251. The mutants obtained significantly improve the regeneration efficiency of the reduced coenzyme NADH. The preferred mutant S234R / G248C / Y251R has a catalytic efficiency that is 1.64 times that of the wild-type lactate dehydrogenase. At the same time, the present invention effectively expands the reaction condition range of lactate dehydrogenase. The mutants can efficiently catalyze the synthesis of NADH under the conditions of 20-40°C and pH 7-11.

Description

Technical Field

[0001] The present invention relates to the field of protein engineering, and in particular to a lactate dehydrogenase mutant, a biomaterial, a catalyst and applications. Background Art

[0002] Lactate dehydrogenase (LDH) is a key oxidoreductase widely present in organisms. It can reversibly catalyze the conversion between lactate and pyruvate, accompanied by the conversion between the reduced coenzyme NADH and the oxidized coenzyme NAD+. The direction of its reaction is dynamically regulated by substrate concentration, pH and coenzyme levels. For example, the optimal pH for the conversion of lactate to pyruvate is alkaline, while the reverse reaction tends to be acidic. In addition, NAD + The catalytic activity was also significantly affected by the ratio of NADH to NADH and the auxiliary effect of metal ions.

[0003] The industrial application value of LDH is reflected in many fields: in food fermentation, lactic acid bacteria convert pyruvate generated by glycolysis into lactic acid through LDH, giving yogurt and kimchi unique flavor and antiseptic properties; in environmental management, LDH can degrade industrial wastewater containing lactic acid and promote the decomposition of organic pollutants. Even more promising is its use as a coenzyme regeneration tool enzyme - using cheap lactic acid as a hydrogen donor, LDH can convert NAD into + The reduction of LDH to high-value NADH is of great significance in NADH-dependent industrial catalysis, such as biopharmaceuticals and chiral compound synthesis. For example, the production of steroid drugs consumes a large amount of NADH. If the coenzyme is recycled and regenerated through LDH, production costs can be significantly reduced.

[0004] However, the current LDH-based NADH regeneration system faces a core bottleneck of low catalytic efficiency: LDH has a high efficiency in NAD + The affinity and conversion number of NADH are far below the ideal level, and the NADH regeneration rate is difficult to meet industrial needs. Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a lactate dehydrogenase mutant with high catalytic activity; the second purpose is to provide biomaterials and catalysts related to the mutant; the third purpose is to provide the use of the mutant and catalyst in the catalytic synthesis of NADH.

[0006] Technical solution: The lactate dehydrogenase mutant described in the present invention is based on the wild-type lactate dehydrogenase amino acid sequence shown in SEQ ID NO: 1, and has one or more amino acid residue mutations at positions 234, 248, and 251, wherein the reference sequence of the wild-type lactate dehydrogenase amino acid sequence is GenBank: ABX32580.1.

[0007] Preferably, in the amino acid mutations, the serine residue at position 234 is mutated to an arginine residue, the glycine residue at position 248 is mutated to a cysteine ​​residue, and the tyrosine residue at position 251 is mutated to an arginine residue.

[0008] Preferably, the lactate dehydrogenase mutant has an amino acid sequence as shown in any one of SEQ ID NOs: 2-7.

[0009] The nucleotide sequence of the present invention is based on the wild-type lactate dehydrogenase nucleotide sequence, contains corresponding base mutations, and encodes the amino acid sequence of the aforementioned lactate dehydrogenase mutant.

[0010] Preferably, the wild-type lactate dehydrogenase nucleotide sequence is as shown in SEQ ID NO: 8 Petrotoga mobilis Source: Lactate dehydrogenase codon-optimized nucleotide sequence.

[0011] The recombinant vector of the present invention comprises the aforementioned nucleotide sequence.

[0012] The recombinant microorganism of the present invention comprises the aforementioned nucleotide sequence or recombinant vector.

[0013] The catalyst of the present invention comprises the aforementioned lactate dehydrogenase mutant.

[0014] Application of the lactate dehydrogenase mutant or catalyst of the present invention in synthesizing NADH.

[0015] Preferably, the catalytic reaction temperature is 20-40° C. and the pH is 7-11.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. Petrotoga mobilis The active site of the source lactate dehydrogenase was mutated, and the resulting mutant significantly improved the regeneration efficiency of the reduced coenzyme NADH. The preferred mutant S234R / G248C / Y251R had a catalytic efficiency 1.64 times that of the wild-type lactate dehydrogenase. 2. The reaction conditions of lactate dehydrogenase were effectively expanded. The mutant can efficiently catalyze the synthesis of NADH under the conditions of 20-40°C and pH 7-11. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The lactate dehydrogenase mutant of Example 1-7 catalyzes the oxidation-type coenzyme NAD + Comparison of relative activities of reduced coenzyme NADH;

[0018] Figure 2The lactate dehydrogenase mutant S234R / G248C / Y251R catalyzes the oxidation of coenzyme NAD at different temperatures + Comparison of relative activities of reduced coenzyme NADH;

[0019] Figure 3 The lactate dehydrogenase mutant S234R / G248C / Y251R catalyzes the oxidation of coenzyme NAD at different pH + Comparison of relative activities of NADH reduced to reduced coenzyme. DETAILED DESCRIPTION

[0020] The technical solution of the present invention is further described below.

[0021] Example 1: Construction of wild-type lactate dehydrogenase and preparation of crude enzyme solution

[0022] The sequence shown in SEQ ID NO: 8 is from Petrotoga mobilis The codon-optimized lactate dehydrogenase wild-type gene was synthesized by Suzhou Jinweizhi Company and constructed on the pET22b vector to obtain pET22b-LDH, wherein the pET22b vector was provided by Jinweizhi Company.

[0023] pET22b-LDH was transformed into E. coli DH5α strain, the recombinant bacteria E. coli DH5α / pET22b-G6PD was inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and cultured with shaking at 37°C and 220 rpm for 12 h.

[0024] After the culture was completed, the bacteria were centrifuged at 12000 rpm for 1 min and the cells were collected. The pET22b-LDH plasmid was extracted using a high-purity plasmid extraction kit as a template for iterative mutagenesis for the subsequent construction of LDH mutants.

[0025] At the same time, pET22b-LDH was transferred into E. coli BL21 (DE3), construction of recombinant mutant expression strain E. coli BL21(DE3) / pET22b-LDH. The successfully constructed recombinant mutant expression strain was spread on a plate containing ampicillin at a final concentration of 100 μg / mL and cultured at 37°C for 18 h.

[0026] After the incubation, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin. The tube was cultured at 37 °C and 200 rpm for 18 h. A 1% inoculum was transferred to 500 mL of LB medium with a final concentration of 100 μg / mL ampicillin. The inoculum was then inoculated at OD 600=0.6, add isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM, and induce at 18°C ​​for 14 h.

[0027] After centrifugation at 4000 rpm for 20 min, the cells were obtained and resuspended in 50 mM Tris-HCl buffer (pH = 8). 1 mL of OD 600 = 30% of the bacterial suspension was sonicated at 65W for 2 seconds with a 5-second interval for 30 minutes on ice to disrupt the cells. The cells were then centrifuged at 12,000 rpm for 20 minutes at 4°C. The supernatant was collected and filtered through a 0.22 μm water filter to obtain the crude enzyme solution.

[0028] The amino acid sequence of wild-type lactate dehydrogenase is shown in SEQ ID NO: 1.

[0029] Example 2: Construction of lactate dehydrogenase mutant S234R and preparation of crude enzyme solution

[0030] 1. Recombinant Escherichia coli E. coli Construction of BL21(DE3) / pET22b-LDH-S234R

[0031] Gene mutation was performed using whole plasmid PCR to obtain the target mutant gene. The primers are as follows:

[0032] S234R upstream primer, SEQ ID NO: 9: GGCATTGCCCGCGCCACCACCGCCTTAGTGG

[0033] S234R downstream primer, SEQ ID NO: 10: GTGGTGGCGCGGGCAATGCCGTAATTGGT

[0034] The PCR system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0035] Table 1 PCR reaction system

[0036]

[0037] Table 2 PCR reaction conditions

[0038]

[0039] After PCR amplification, the amplified product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplified product was a single band with a size of approximately 6000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0040] The purified gene fragment was digested with DpnI enzyme to remove the template and recombined with recombinase. E. coli DH5α competent cells were spread on LB plates containing 100 μg / mL ampicillin and cultured at 37°C for 12 h.

[0041] After the incubation period, a single colony was picked and cultured in LB liquid containing 100 μg / mL ampicillin. The culture was then sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing to verify the correctness of the mutation site. Once verified, a portion of the culture was stored at -80°C for future use, while another portion was used to extract the recombinant plasmid pET22b-LDH-S234R and stored at -20°C.

[0042] The recombinant expression plasmid pET22b-LDH-S234R that was successfully sequenced was transferred into E. coli BL21 (DE3), construction of recombinant mutant expression strain E. coli BL21(DE3) / pET22b-LDH-S234R.

[0043] 2. Cultivation of recombinant mutant expression strains and preparation of crude enzyme solution

[0044] The successful recombinant mutant expression strain E. coli BL21(DE3) / pET22b-LDH-S234R was plated onto a culture plate containing ampicillin at a final concentration of 100 μg / mL and cultured at 37°C for 18 h.

[0045] After the incubation, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin. The tube was cultured at 37°C and 200 rpm for 18 h. A 1% inoculum was transferred to 500 mL of LB medium with a final concentration of 100 mg / mL ampicillin. The inoculum was then inoculated at OD 600 =0.6, IPTG was added to a final concentration of 0.5 mM, and the cells were induced at 18 °C for 14 h.

[0046] After centrifugation at 4000 rpm for 20 min, the cells were obtained and resuspended in 50 mM Tris-HCl buffer (pH = 8). 1 mL of OD 600 = 30% of the bacterial suspension was sonicated at 65W for 2 seconds with a 5-second interval for 30 minutes on ice to disrupt the cells. The cells were then centrifuged at 12,000 rpm for 20 minutes at 4°C. The supernatant was collected and filtered through a 0.22 μm water filter to obtain the crude enzyme solution containing the lactate dehydrogenase mutant S234R.

[0047] The amino acid sequence of the lactate dehydrogenase mutant S234R is shown in SEQ ID NO: 2.

[0048] Example 3: Construction of lactate dehydrogenase mutant G248C and preparation of crude enzyme solution

[0049] The construction of the G248C mutant and the preparation of the crude enzyme solution were based on Example 2, except that the primers in step 1 were changed and the other conditions remained unchanged. The primers were as follows:

[0050] G248C upstream primer, SEQ ID NO: 11: TTAAGAATGAGTGCCGCGTTTATACCCCG

[0051] G248C downstream primer, SEQ ID NO: 12: TAAACGCGGCACTCATTCTTAATAATGCTTTC

[0052] The amino acid sequence of the lactate dehydrogenase mutant G248C is shown in SEQ ID NO: 3.

[0053] Example 4: Construction of lactate dehydrogenase mutant Y251R and preparation of crude enzyme solution

[0054] The construction of the Y251R mutant and the preparation of the crude enzyme solution were based on Example 2, except that the primers in step 1 were changed and the other conditions remained unchanged. The primers were as follows:

[0055] Y251R upstream primer, SEQ ID NO: 13: GGCCGCGTTCGCACCCCGAGTGTGCTGCTG

[0056] Y251R downstream primer, SEQ ID NO: 14: CACTCGGGGTGCGAACGCGGCCCTCATTCTT

[0057] The amino acid sequence of the lactate dehydrogenase mutant Y251R is shown in SEQ ID NO:4.

[0058] Example 5: Construction of lactate dehydrogenase mutant S234R / G248C and preparation of crude enzyme solution

[0059] The construction of the S234R / G248C mutant and the preparation of the crude enzyme solution were based on Example 2. In step 1, the plasmid obtained in Example 2 was used as a template and the primers were changed. The other conditions remained unchanged. The primers were as follows:

[0060] S234R / G248C upstream primer, SEQ ID NO: 15: TTAAGAATGAGTGCCGCGTTTATACCCCG

[0061] S234R / G248C downstream primer, SEQ ID NO: 16: TAAACGCGGCACTCATTCTTAATAATGCTTTC

[0062] The amino acid sequence of the lactate dehydrogenase mutant S234R / G248C is shown in SEQ ID NO: 5.

[0063] Example 6: Construction of lactate dehydrogenase mutant S234R / Y251R and preparation of crude enzyme solution

[0064] The construction of the S234R / Y251R mutant and the preparation of the crude enzyme solution were based on Example 2. In step 1, the plasmid obtained in Example 2 was used as a template and the primers were changed. The other conditions remained unchanged. The primers were as follows:

[0065] S234R / Y251R upstream primer, SEQ ID NO: 17: GGCCGCGTTCGCACCCCGAGTGTGCTGCTG

[0066] S234R / Y251R downstream primer, SEQ ID NO: 18: CACTCGGGGTGCGAACGCGGCCCTCATTCTT

[0067] The amino acid sequence of the lactate dehydrogenase mutant S234R / Y251R is shown in SEQ ID NO: 6.

[0068] Example 7: Construction of lactate dehydrogenase mutant S234R / G248C / Y251R and preparation of crude enzyme solution

[0069] The construction of the S234R / G248C / Y251R mutant and the preparation of the crude enzyme solution were based on Example 2. In step 1, the plasmid obtained in Example 5 was used as a template and the primers were changed. The other conditions remained unchanged. The primers are as follows:

[0070] S234R / G248C / Y251R upstream primer, SEQ ID NO: 19: GGCCGCGTTCGCACCCCGAGTGTGCTGCTG

[0071] S234R / G248C / Y251R downstream primer, SEQ ID NO: 20: CACTCGGGGTGCGAACGCGGCCCTCATTCTT

[0072] The amino acid sequence of the lactate dehydrogenase mutant S234R / G248C / Y251R is shown in SEQ ID NO: 7.

[0073] Test Example 1: Performance test of lactate dehydrogenase mutants

[0074] 1. Lactate dehydrogenase and its mutants catalyze the oxidation of coenzyme NAD + Reduced to reduced coenzyme NADH

[0075] The crude enzyme solution containing wild-type lactate dehydrogenase or mutant obtained in Examples 1-7 was used as a catalyst.

[0076] The reaction system is: 10 μL of any crude enzyme solution obtained in Examples 1-7, 2.5 mM oxidized coenzyme NAD + , 2.5 mM lactic acid, and 50 mM Tris-HCl (pH 8) as the reaction buffer in a total volume of 300 μL. The reaction temperature was controlled at 30°C in a water bath for 10 min. The absorbance change of the product NADH at 340 nm was measured using a microplate reader over the 10-min period, and the relative activity was calculated.

[0077] The test results are shown in Table 3 and Figure 1 .

[0078] Table 3 Lactate dehydrogenase reduces the coenzyme NADH.

[0079]

[0080] Depend on Figure 1 The results showed that the catalytic conversion rates of all mutants were higher than that of wild-type lactate dehydrogenase. In particular, the catalytic efficiency of the mutant S234R / G248C / Y251R was 1.64 times that of the wild-type lactate dehydrogenase.

[0081] 2. Lactate dehydrogenase mutant S234R / G248C / Y251R catalyzes the oxidation of coenzyme NAD + Optimum temperature for reduction to reduced coenzyme NADH

[0082] The crude enzyme solution containing the mutant S234R / G248C / Y251R obtained in Example 7 was used as a catalyst.

[0083] The reaction system was: 10 μL of the crude enzyme solution obtained in Example 7, 2.5 mM oxidized coenzyme NAD + , 2.5mM lactic acid, the reaction buffer is 50mM Tris-HCl buffer at pH=8, the total volume is 300μL. The reaction temperature is controlled at 20℃, 25℃, 30℃, 35℃, and 40℃ in a water bath, and the reaction is carried out for 10 minutes. The change in the absorbance value of the product NADH at 340nm within 10 minutes is detected by a microplate reader to compare the relative activity. The test results are shown in Figure 2 .

[0084] Depend on Figure 2It was found that the best catalytic effect was observed at 35°C, and the enzyme activity was good in the range of 20-40°C.

[0085] 3. Lactate dehydrogenase mutant (S234R / G248C / Y251R) catalyzes the oxidation of coenzyme NAD + Optimal pH for reduction to reduced coenzyme NADH

[0086] The crude enzyme solution containing the mutant S234R / G248C / Y251R obtained in Example 7 was used as a catalyst.

[0087] The reaction system was: 10 μL of the crude enzyme solution obtained in Example 7, 2.5 mM oxidized coenzyme NAD + , 2.5mM lactic acid, the reaction buffer is 50mM potassium phosphate buffer at pH=7, 50mM potassium phosphate buffer at pH=7.5, 50mM potassium phosphate buffer at pH=8, 50mM Tris-HCl buffer at pH=8.5, 50mM Tris-HCl buffer at pH=9, 50mM Tris-HCl buffer at pH=9.5, 50mM Gly-NaOH buffer at pH=10, 50mM Gly-NaOH buffer at pH=10.5, or 50mM Gly-NaOH buffer at pH=11, with a total volume of 300μL. The reaction temperature is controlled at 35℃ in a water bath, and the reaction is carried out for 10min. The change in the absorbance value of the product NADH at 340nm within 10min is detected by a microplate reader to compare the relative activity. The test results are shown in Figure 3 .

[0088] Depend on Figure 3 It can be seen that different pH has a significant effect on the catalytic effect of LDH. The best catalytic effect was observed at pH 10.5. In addition, the enzyme catalytic activity was relatively high when the pH was in the range of 7-11.

Claims

1. A lactate dehydrogenase mutant, characterized in that: Based on the amino acid sequence of the wild-type lactate dehydrogenase shown in SEQ ID NO: 1, the serine residue at position 234 is mutated to an arginine residue, or the glycine residue at position 248 is mutated to a cysteine ​​residue, or the tyrosine residue at position 251 is mutated to an arginine residue, or the serine residue at position 234 is mutated to an arginine residue and the glycine residue at position 248 is mutated to a cysteine ​​residue, or the glycine residue at position 248 is mutated to a cysteine ​​residue and the tyrosine residue at position 251 is mutated to an arginine residue, or the serine residue at position 234 is mutated to an arginine residue, the glycine residue at position 248 is mutated to a cysteine ​​residue, and the tyrosine residue at position 251 is mutated to an arginine residue, and the amino acid sequence of the mutant is any one of the sequences shown in SEQ ID NO: 2-7.

2. A nucleotide molecule, characterized in that Based on the wild-type lactate dehydrogenase nucleotide sequence, it contains corresponding base mutations and encodes the amino acid sequence of the lactate dehydrogenase mutant according to claim 1.

3. The nucleotide molecule according to claim 2, characterized in that The wild-type lactate dehydrogenase nucleotide sequence is shown in SEQ ID NO: 8 Petrotoga mobilis Source Codon-optimized nucleotide sequence of lactate dehydrogenase.

4. A recombinant vector, characterized in that The recombinant vector comprises the nucleotide sequence according to claim 2.

5. A recombinant microorganism, characterized in that The recombinant microorganism comprises the nucleotide sequence according to claim 2 or the recombinant vector according to claim 4.

6. A catalyst, characterized in that The catalyst comprises the lactate dehydrogenase mutant according to claim 1.

7. Use of the lactate dehydrogenase mutant according to claim 1 or the catalyst according to claim 6 in synthesizing NADH.

8. The use according to claim 7, characterized in that The catalytic reaction temperature is 20-40° C., and the pH is 7-11.

Images