Application of OsbZIP39 gene in regulating salt tolerance in rice
By overexpressing the OsbZIP39 gene in rice, the problem of rice sensitivity to salt stress was solved, the salt tolerance of rice was significantly improved, and technical support was provided for the utilization of salinized land and the increase of rice yield.
Patent Information
- Application Number
- CN202510766019.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-10
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-06-10
AI Technical Summary
Rice is very sensitive to salt stress, and existing technologies make it difficult to effectively improve its salt tolerance, which limits the utilization of salinized land and the increase in rice yield.
By overexpressing the OsbZIP39 gene, the expression level and activity of the OsbZIP39 protein in rice are increased, the OsbZIP39 protein promoter or related biological materials are introduced into rice tissues, and gene transformation is performed using Ti plasmids, Ri plasmids, plant virus vectors, microinjection and other methods to enhance the salt tolerance of rice.
It significantly improves the salt tolerance of rice, provides a technical means to quickly create new salt-tolerant rice varieties, and enhances the rice's ability to survive salt stress.
Smart Images

Figure CN120272522B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of modern agricultural technology and specifically relates to OsbZIP39 Application of genes in regulating salt tolerance in rice. Background Art
[0002] Salt stress is one of the major abiotic stresses that limits plant growth and crop yield. Oryza sativa Rice (L.) is an important food crop that is highly sensitive to salt stress. According to statistics, the global area of saline-alkali land is approximately 800 million hectares, with enormous potential for comprehensive development and utilization. Therefore, improving rice salt tolerance is of great practical significance for fully utilizing salinized land for rice production, unleashing rice productivity, and further increasing rice yields.
[0003] Therefore, it is necessary to screen and identify genetic genes that are important for the directional genetic improvement of rice salt tolerance and to develop new technical methods for breeding salt-tolerant rice. Summary of the Invention
[0004] In order to solve the above technical problems, the technical solution adopted by the present invention is:
[0005] The first aspect of the present invention provides the use of an OsbZIP39 protein promoter in improving salt tolerance in rice.
[0006] In some embodiments of the present invention, the OsbZIP39 protein promoter includes an agent that targets and increases the expression level of the OsbZIP39 protein.
[0007] In some embodiments of the present invention, the amino acid sequence of the OsbZIP39 protein is shown in SEQ ID NO: 3.
[0008] The second aspect of the present invention provides overexpression OsbZIP39 Application of genes in improving salt tolerance in rice.
[0009] In some embodiments of the present invention, the OsbZIP39 The genomic nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0010] In some embodiments of the present invention, the OsbZIP39 The CDS sequence of the gene is shown in SEQ ID NO: 2.
[0011] The third aspect of the present invention provides the use of biological materials related to overexpression of OsbZIP39 protein in breeding rice varieties with improved salt tolerance.
[0012] In some embodiments of the present invention, the amino acid sequence of the OsbZIP39 protein is shown in SEQ ID NO: 3.
[0013] In some embodiments of the invention, the biological material does not include propagation material.
[0014] In some embodiments of the present invention, the biological material comprises a nucleic acid molecule, a vector, or a cell.
[0015] In some embodiments of the present invention, the nucleic acid molecule includes a nucleic acid molecule encoding the protein shown in SEQ ID NO:3.
[0016] In some embodiments of the present invention, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO:2.
[0017] In some embodiments of the present invention, the vector includes an overexpression vector, including but not limited to pIPKB003 and other conventional overexpression vector tools in the art.
[0018] In some embodiments of the present invention, the cell comprises at least one of Escherichia coli and Agrobacterium tumefaciens, wherein Escherichia coli is a common host cell for constructing vectors and plasmids in the art, and Agrobacterium tumefaciens is a common tool for delivering DNA molecules to plants in the art.
[0019] In the third aspect of the present invention, those skilled in the art will appreciate that due to the degeneracy of codons, other OsbZIP39 The technical solution of modifying the gene but still encoding the protein with the amino acid sequence as shown in SEQ ID NO: 3 can also achieve the same or similar technical effects as the present invention and still fall within the scope of protection of the present invention.
[0020] A fourth aspect of the present invention provides a method for cultivating a rice variety with improved salt tolerance, comprising increasing the salt tolerance of the rice. OsbZIP39 The step of measuring the expression level and / or activity of a gene.
[0021] In some embodiments of the present invention, the method for increasing the yield of rice OsbZIP39 The step of measuring the expression level and / or activity of the gene is to introduce the biological material related to overexpression of OsbZIP39 protein described in the third aspect of the present invention into rice tissues or rice cells.
[0022] In some embodiments of the invention, the biological material does not include propagation material.
[0023] In some embodiments of the present invention, the introduction method comprises using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.
[0024] In some embodiments of the present invention, increasing OsbZIP39 The steps of measuring the expression level and / or activity of a gene are as follows:
[0025] 1) The sequence shown in SEQ ID NO: 2 is OsbZIP39 The full-length CDS sequence of the gene was designed and amplified OsbZIP39 Primer sequences of the full-length CDS sequence of the gene;
[0026] 2) Using rice cDNA as a template, perform PCR amplification to obtain PCR products;
[0027] 3) After the PCR product is purified, homologous recombination is used to reconstruct the overexpression vector;
[0028] 4) The overexpression vector was transformed into rice through Agrobacterium-mediated transformation.
[0029] In some embodiments of the present invention, the rice variety includes Zhonghua 11.
[0030] In some embodiments of the present invention, the sequences of the primers are shown in SEQ ID NO: 4 and SEQ ID NO: 5.
[0031] The beneficial effects of the present invention are:
[0032] The present invention first discovered OsbZIP39 The application of genes in regulating rice salt tolerance traits. OsbZIP39 Overexpression of genes can significantly improve the salt tolerance of rice, providing a simple and effective technical means for the rapid creation of new salt-tolerant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:
[0034] Figure 1 for OsbZIP39 Expression results of overexpression plants.
[0035] Figure 2 for OsbZIP39 Results of the salt tolerance experiment of overexpression plants, where A is the growth status of the plants before salt treatment, B is the growth status of the plants after salt treatment, and C is the statistical results. DETAILED DESCRIPTION
[0036] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.
[0037] Example 1 Construction of pIPKB003-OsbZIP39 expression vector and acquisition of OsbZIP39 protein overexpressing plants
[0038] from OsbZIP39 The primers were designed based on the CDS sequence of the gene and the OsbZIP39 The full-length CDS of OsbZIP39 The full-length CDS sequence of the gene was connected to the pPIPKB003 vector, and then the pIPKB003-OsbZIP39 vector was transformed into rice Zhonghua 11 using Agrobacterium-mediated transformation to obtain OsbZIP39 Overexpressing rice plants.
[0039] OsbZIP39 The genomic sequence of the gene is:
[0040]
[0041] Its CDS sequence is:
[0042]
[0043] The encoded protein sequence is:
[0044] N-terminal-MAEPALLDPTAAFDLRLYPAHLFDHELPLAGGGGGDDDDDLPLDGLEFDLPGDFS-C-terminal (SEQ ID NO: 3).
[0045] 1. The steps for constructing the pIPKB003-OsbZIP39 expression vector are as follows:
[0046] The pIPKB003 expression vector for gene overexpression is driven by the rice actin promoter. The vector is double-digested with HindIII and SalI restriction endonucleases to design amplification. OsbZIP39 Primers for the CDS.
[0047] The primer sequence information is as follows:
[0048] 003F: CGCGGGGCTGCAGGAATTCAAGCTTATGGCGGAGCCGGCCCTGCT (SEQ ID NO: 4).
[0049] 003R: AACATATCCAGTCACTATGGTCGAC TTAGTTCACAAGATGTGGGC (SEQ ID NO: 5).
[0050] In the primers, the underlined parts are the homology arms required for ligation using homologous recombination.
[0051] PCR amplification was performed using the cDNA of Zhonghua 11 as a template and primers 003F and 003R to obtain a PCR product. The pIPKB003 vector was double-digested with HindIII and SalI restriction endonucleases to obtain a digestion product. The PCR and digestion products were purified separately and then recombined using the following homologous recombination-ligation method to obtain the pIPKB003-OsbZIP39 expression vector.
[0052] The reaction system is shown in Table 1.
[0053] Table 1
[0054]
[0055] Note: The homologous recombination enzyme is the Uniclone One Step SeamLessCloning Kit from Beijing Jinsha Biotechnology Co., Ltd., with the catalog number SC612.
[0056] 2. Identification
[0057] Take 10 μL of the ligation product and transform competent E. coli. Screen on LB plates containing 50 μg / mL kanamycin. Identify single clones by colony PCR. Select positive clones, extract plasmids, and send for sequencing. Select plasmids from sequencing-positive clones as the recombinant overexpression vector pIPKB003-OsbZIP39.
[0058] Example 2 pIPKB003-OsbZIP39 transformed rice callus and identification of positive seedlings
[0059] 1. Agrobacterium transformation
[0060] The correctly sequenced recombinant vector pIPKB003-OsbZIP39 was transformed into the competent Agrobacterium GV3101 strain by electroporation, and the bacteria were preserved for future use after verification by colony PCR.
[0061] A single correctly identified colony of Agrobacterium tumefaciens GV3101 / pIPKB003-OsbZIP39 was inoculated into 2-3 mL of liquid culture medium containing 100 μg / mL spectinomycin and 50 μg / mL rifampicin. The culture was shaken overnight at 28°C. The next day, the culture was transferred to a larger volume of liquid culture medium containing antibiotics and shaken. After several transfers, the cells were harvested and resuspended to an OD600 between 0.8 and 1.0. The recombinant GV3101 / pIPKB003-OsbZIP39 was transformed into Zhonghua 11 using Agrobacterium-mediated transfection. The embryos were then infected with Agrobacterium tumefaciens GV3101. These embryos were then placed on selective medium and screened multiple times to obtain resistant callus. The resistant callus was then regenerated into seedlings, yielding the T0 generation of transformed seedlings. The rice Agrobacterium transformation method was carried out according to the literature (Zhao, W., Zheng, S.&Ling, HQ. An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice cultivarHandao297. Plant Cell Tiss Organ Cult 106, 475–483 (2011).
[0062] 2. Identification of T0 generation plants with OsbZIP39 overexpression
[0063] RNA was extracted from leaves of T0 transgenic rice plants and Zhonghua 11 and reverse transcribed into cDNA. OsbZIP39 Real-time quantitative PCR (qPCR) was performed to detect whether the gene was overexpressed. Using Zhonghua 11 as a control, two effective overexpression lines with higher expression levels than Zhonghua 11 were identified and named OsbZIP39-OE-1 and OsbZIP39-OE-2 (The results are as follows Figure 1 shown).
[0064] This design amplifies OsbZIP39 The qPCR primers and sequence information are as follows:
[0065] OsbZIP39qPCR-F: GTCAATGCTACCGAGAAAATCC (SEQ ID NO: 6);
[0066] OsbZIP39qPCR-R: GAGTGGAATCGCTTCATTGTAC (SEQ ID NO: 7).
[0067] Example 3 Different strains OsbZIP39 Functional verification of salt tolerance in overexpressing plants
[0068] Select wild type Zhonghua 11 (WT), OsbZIP39-OE strain( OE-1, OE-2 ) Use greenhouse hydroponic method. The seeds were sterilized with 10% H2O2 for 10 minutes, and then the H2O2 on the surface of the seeds was rinsed with distilled water. The seeds were evenly placed in a culture dish with sterilized filter paper, and germinated in the dark at 37°C in a constant temperature incubator for 2 days, and germinated for one day at 28°C. The germinated seeds were placed in a hydroponic box with a filter and grown for 7 days. The nutrient solution in the hydroponic box was replaced every 2 days. The growth conditions were 28 / 25°C (day / night, about 70% relative humidity), the photoperiod was 14h / 10h (day / night), and the light intensity was 400μmol·m -2 ·s -1 Rice seedlings with good growth and 3-leaf stage were selected and subjected to salt stress treatment with 120 mM NaCl for 10 days, followed by 5 days of recovery.
[0069] The nutrient solution formula is shown in Table 2.
[0070] Table 2 Nutrient solution formula
[0071]
[0072] The working solution should be prepared and used immediately. 1.25 mL of each mother solution is required for each liter of working solution, and the pH should be adjusted to 5.5.
[0073] The results are as follows Figure 2 shown.
[0074] Before salt treatment ( Figure 2 Middle A), WT and OsbZIP39-OE strains are similar. However, after salt treatment ( Figure 2 (B) Compared with the WT, the OsbZIP39-OE line exhibited significantly better growth. The survival rate of the OsbZIP39-OE line was significantly higher than that of the WT (approximately 8.3% for the WT, 83.3% for OsbZIP39-OE-1, and 66.6% for OsbZIP39-OE-2), indicating that overexpression of the OsbZIP39 gene significantly improves salt stress tolerance in rice.
[0075] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.
Claims
1. Overexpression OsbZIP39 The application of the gene in improving the salt tolerance of rice is characterized by: described OsbZIP39 The nucleotide sequence of the gene is shown in SEQ ID NO:
2.
2. Overexpression OsbZIP39 The use of a gene reagent in breeding rice varieties with improved salt tolerance is characterized by: described OsbZIP39 The nucleotide sequence of the gene is shown in SEQ ID NO: 2; The reagents are: 1) A vector comprising the nucleotide sequence shown in SEQ ID NO: 2; The vector comprises an overexpression vector; or 2) a cell comprising the vector described in 1); The cells include at least one of Escherichia coli and Agrobacterium.
3. A method for cultivating rice varieties with improved salt tolerance, characterized by: Including increasing rice OsbZIP39 Steps for determining gene expression levels; The method for increasing the OsbZIP39 The step of increasing the expression level of the gene is to overexpress the gene in claim 2 OsbZIP39 Gene reagents are introduced into rice tissues or rice cells.
4. The method according to claim 3, wherein: The introduction method includes using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.
Citation Information
Patent Citations
Transcription factor TFSALT1 for improving salt resistance of rice, and application thereof
CN106011152A
Application of rice OsbZIP39 gene in improving cadmium resistance of rice
CN114591982A