Pinellia ternata NAC transcription factor PtNAC61 and coding gene and application thereof
By cloning and overexpressing the PtNAC61 gene of Pinellia NAC transcription factor, the problem of Pinellia saccharide is easily destroyed under drought stress, and the effect of improving its drought resistance and yield is achieved.
Patent Information
- Application Number
- CN202510512632.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-04-23
AI Technical Summary
Pinellia ternata is prone to seedlings under drought stress, resulting in a decrease in yield. Existing studies lack understanding of the molecular mechanism of its drought stress response, which seriously restricts its industrial development.
The PtNAC61 gene, a NAC transcription factor of Pinellia, was cloned and overexpressed, and introduced into Pinellia by Agrobacterium-mediated transformation method, improving its tolerance to drought stress and anti-aging ability of leaves.
Delay the aging of Pinellia leaves, improve their tolerance to drought, enhance drought resistance, and promote the increase in Pinellia production.
Smart Images

Figure CN120289602A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a Pinellia ternata NAC transcription factor PtNAC61, its encoding gene and applications. Background Art
[0002] Plants are often affected by abiotic factors such as drought, high temperature, and high salt during their growth and development. Among them, drought is one of the important environmental limiting factors affecting plant growth and development and yield. Drought can cause plant wilting, reduced growth rate, damage to plants, and premature senescence, resulting in reduced crop yield. During the long-term evolution process, higher plants have evolved various mechanisms based on morphology, development, physiology, and biochemistry to adapt to changes in the external environment. The response of plants to various stress conditions is often the result of the combined action of multiple levels, multiple pathways, and multiple genes, regulating the response to stress through different mechanisms at different levels. With the continuous development of biotechnology, it has been found that the improvement of plant stress tolerance is closely related to the regulation of the expression of stress-related functional genes by transcription factors. The research on transcription factors has become one of the key points in the study of plant gene functions.
[0003] Transcription factors, also known as trans-acting factors, are a class of regulatory proteins that play a role in resisting biotic and abiotic stresses. They can specifically bind to cis-acting elements in the promoters of eukaryotic genes, thereby activating or inhibiting the transcription and expression of downstream genes, and playing an important role in the growth and development of plants. Analyzing from the protein structure, transcription factors generally contain four functional domains, namely the DNA-binding domain, the transcriptional regulatory domain (including the activation and inhibition domains), the oligomerization site, and the nuclear localization signal. With the continuous development of experimental techniques and the broadening of research directions, more and more results have proved that transcription factors are widely involved in a series of physiological activities such as plant biotic and abiotic stress responses, plant growth and development, and morphogenesis.
[0004] NAC is a plant-specific transcription regulatory factor discovered in recent years and widely exists in various plants. The name NAC is derived from the first letters of the NAM (no apical meristem) gene of Petunia hybrida, the ATAF1 / 2 genes of Arabidopsis thaliana, and the CUC2 (cup-shaped cotyledon) gene. The NAC transcription factor family has a highly conserved NAC domain, which consists of 150 - 160 highly conserved amino acid residues. There is a highly conserved DNA domain at its N-terminus, which is divided into five sub-domains A - E, and a highly variable transcriptional regulatory domain at the C-terminus. NAC transcription factors can specifically bind to the sequence (CATGTG) in the promoter, namely NACRS, thereby initiating gene transcription.
[0005] NAC transcription factors are induced by various environmental factors such as abiotic stresses like drought, high temperature, wounding, etc., as well as biotic stresses and different growth and development stages of the plant itself, and directly or indirectly participate in the regulatory network therein, thereby enhancing the tolerance of plants to adversity. Currently, most of the research on the NAC transcription factor family comes from model plants such as Arabidopsis thaliana, rice, tobacco, etc., and there are not many research reports on other species. For example, in tomatoes (Transcriptome analysis of tomato cold-tolerant germplasm under low temperature stress and identification of related gene functions - DOI: 10.7666 / d.D01404343), it was found that transgenic plants overexpressing ShNAC were more sensitive to drought than wild-type plants, and this gene is a negative regulator of drought resistance in tomato plants. In Arabidopsis thaliana, ATAF1 is induced by drought stress and ABA, positively regulates leaf senescence, the drought tolerance of ataf1 mutants is enhanced, and the marker genes COR47 / RD17, ERD10, KIN1, etc. related to drought stress response are up-regulated. ANAC016 positively regulates drought stress tolerance by inhibiting the expression of AREB1, while ANAC017 may accelerate senescence-related processes such as autophagy by regulating the expression of the target gene ANAC016, promoting leaf senescence and cell death. In rice, overexpression of OsNAC2 can enhance the drought resistance of rice, and at the same time it can also induce the expression of ABA biosynthesis or signal genes, thereby enhancing the expression of SAGs and promoting leaf senescence. In tobacco, NtNAC028 is induced by drought, high salt and ABA, and overexpression of this gene in tobacco reduces the tolerance to drought and high salt stresses. Further research found that NtNAC028 can positively regulate tobacco leaf senescence. These research results indicate that NAC transcription factors positively regulate leaf senescence when plants respond to drought stress.
[0006] Pinellia ternata (Thunb.) Breit., a plant of the Araceae family, is a traditional precious Chinese medicinal herb in China. Its tuber is used as medicine, with effects such as relieving cough, reducing adverse qi and stopping vomiting, and anti-tumor. In recent years, with the changes in the climate environment and the intensification of overexploitation and deforestation, the wild resources of Pinellia ternata have gradually decreased, and artificial cultivation has become the main way to obtain Pinellia ternata medicinal materials. However, with the advancement of the internationalization of traditional Chinese medicine, the supply of Pinellia ternata medicinal materials is seriously in short supply, and the wild and artificial cultivation yields can only meet one-third of the market demand. The low cultivation yield of Pinellia ternata is mainly due to its special habits. It is afraid of drought and waterlogging, and is shade-tolerant and sun-fearing. Especially during the period from Grain in Ear to Summer Solstice, the sunlight is strong, the temperature rises, and the soil lacks water. The above-ground part of Pinellia ternata will then lodge, wither, and die, commonly known as "seedling collapse", which greatly shortens the growth time of Pinellia ternata and results in a reduction in its yield. According to statistics, the agricultural losses caused by drought every year globally are approximately equivalent to 60% of the total of various meteorological disasters. At the same time, drought is also one of the important environmental limiting factors causing seedling collapse in Pinellia ternata. Moderate soil drought (water content 55%) for more than one week can cause seedling collapse in Pinellia ternata. Therefore, in the production of Pinellia ternata, preventing seedling collapse is a very important yield-increasing technology. At present, there is a lack of understanding of the molecular mechanism of the response of Pinellia ternata to drought stress, and the development of artificial regulation technologies is slow, which seriously restricts the development of the Pinellia ternata industry. Research shows that the essence of drought-induced seedling collapse in Pinellia ternata is programmed cell death caused by cell senescence. Therefore, by analyzing the molecular mechanism of the response of Pinellia ternata to drought stress, seedling collapse in Pinellia ternata can be prevented or postponed to delay leaf senescence and produce a stay-green trait, ultimately achieving the goal of increasing the yield of Pinellia ternata. As an important class of regulatory proteins in plants, NAC transcription factors play important roles in the response to abiotic stresses such as drought and high temperature and the process of plant leaf senescence. Compared with other model crops, there are still few reports on the biological functions and action mechanisms of NAC genes in Pinellia ternata, which seriously restricts the discovery and utilization of this type of gene. Summary of the Invention
[0007] Aiming at the deficiencies of existing research, the purpose of the present invention is to provide a Pinellia ternata NAC-like transcription factor PtNAC61, its encoding gene, and its application.
[0008] The present invention realizes the above purpose through the following technical solutions:
[0009] The present invention provides a Pinellia ternata NAC-like transcription factor PtNAC61, and the Pinellia ternata NAC-like transcription factor PtNAC61 is a protein as described in the following (1) or (2):
[0010] (1) A protein consisting of the amino acid residue sequence in SEQ ID NO.1;
[0011] (2) A protein derived from (1), which has the function of Pinellia ternata NAC transcription factor, and has substitution and / or deletion and / or addition of one to ten amino acid residues in the amino acid residue sequence of SEQ ID NO.1;
[0012] As a further optimized embodiment of the present invention, the amino acid sequence of the Pinellia ternata NAC transcription factor PtNAC61 is as shown in SEQ ID NO.1, and consists of 297 amino acid residues.
[0013] The present invention also provides a PtNAC61 gene encoding the Pinellia ternata NAC transcription factor PtNAC61, and the nucleotide sequence of the PtNAC61 gene is any one of the following (1) to (4):
[0014] (1) The DNA sequence as shown in SEQ ID NO.2;
[0015] (2) A polynucleotide encoding the amino acid sequence shown in SEQ ID NO.1;
[0016] (3) A DNA sequence having more than 90% homology with the DNA sequence in SEQ ID NO.2 and encoding the same functional protein; for example, using the cloned PtNAC61 gene as a probe, screening the gene or homologous gene of the present invention from cDNA and genomic libraries, or using the PCR method to amplify the gene of the present invention or any DNA sequence homologous thereto from the Pinellia ternata genome, mRNA and cDNA.
[0017] (4) A nucleotide sequence that can hybridize with the DNA sequence defined in SEQ ID NO.2 under high-stringency conditions, and the high-stringency conditions are a solution of 0.1×SSPE or 0.1×SSC, 0.1% SDS, and hybridization and membrane washing are carried out at 65°C.
[0018] As a further optimized embodiment of the present invention, the nucleotide sequence of the PtNAC61 gene is as shown in SEQ ID NO.2, consists of 894 bases, and can encode a complete open reading frame.
[0019] The present invention also provides an application of the PtNAC61 gene in simultaneously regulating plant senescence and plant stress resistance.
[0020] As a further optimized embodiment of the present invention, overexpression of the PtNAC61 gene can delay plant leaf senescence and improve plant drought resistance.
[0021] As a further optimized embodiment of the present invention, the plant is a monocotyledonous plant or a dicotyledonous plant.
[0022] As a further optimization scheme of the present invention, the monocotyledonous plant is Pinellia ternata.
[0023] The present invention also provides a method for obtaining a drought-resistant and green-holding plant. After introducing the PtNAC61 gene described in any one of claims 3-4 into a target plant by using a plant expression vector, a drought-resistant and green-holding plant is obtained. The drought resistance and green-holding traits of the drought-resistant and green-holding plant are higher than those of the target plant.
[0024] As a further optimization scheme of the present invention, the plant is Pinellia ternata; the plant expression vector is pCAMBIA1301; the expression vector carrying the PtNAC61 gene of the present invention can be introduced into plant cells by means of Ti plasmid, plant virus vector, direct DNA transformation, or biotechnology methods such as electroporation. When using PtNAC61 to construct a plant expression vector, any enhanced promoter or inducible promoter can be added before its transcription start nucleotide.
[0025] The present invention has the following beneficial effects:
[0026] 1) The present invention isolated and cloned the PtNAC61 gene from Pinellia ternata, introduced it into Pinellia ternata by Agrobacterium-mediated transformation method to obtain transgenic plants, and then verified that the transgenic Pinellia ternata has improved tolerance to drought stress and improved leaf anti-aging ability. It provides an important gene resource for plant stress-resistant genetic engineering, has important significance for improving the yield of medicinal plants, and provides a theoretical basis and utilization value for the application of this gene in other medicinal plants to improve stress resistance and green-holding property.
[0027] 2) The present invention carried out the identification of NAC family genes in Pinellia ternata and the functional analysis of their resistance to drought stress and delay of leaf senescence, which helps to analyze the mechanism of drought-induced wilting of Pinellia ternata, improve the yield and cultivation adaptability, provides an important gene resource for plant stress-resistant genetic engineering, and has important significance for improving the yield of medicinal plants. Description of the Drawings
[0028] Figure 1 It is a comparison diagram of the amino acid sequence homology of the conserved region of the PtNAC61 protein, a NAC transcription factor of Pinellia ternata of the present invention, and the NAC family transcription factors of other species;
[0029] Figure 2 It is an evolutionary tree after the amino acid sequence alignment of the PtNAC61 protein, a NAC transcription factor of Pinellia ternata of the present invention, and other NAC transcription factors;
[0030] Figure 3 It is a subcellular localization map of the PtNAC61 protein, a NAC transcription factor of Pinellia ternata of the present invention;
[0031] Figure 4It is the hygromycin PCR detection map of the transgenic Pinellia ternata plants with PtNAC61 gene; M: DL2000 Marker; OE1; OE2; OE3; OE4; +: Using the pCAMBIA1301 plasmid as the template; -: Using water as the template.
[0032] Figure 5 It is the PCR detection result map of the transgenic plants with PtNAC61 gene;
[0033] Figure 6 It is the semi-quantitative detection result map of the transgenic plants with PtNAC61 gene;
[0034] Figure 7 It is the experimental result map that the transgenic Pinellia ternata plants with PtNAC61 gene improve the drought stress tolerance of Pinellia ternata;
[0035] Figure 8 It is the experimental result map that the transgenic Pinellia ternata plants with PtNAC61 gene delay leaf senescence. Specific implementation manners
[0036] The present application will be further described in detail below with reference to the accompanying drawings. It is necessary to point out here that the following specific implementation manners are only used to further illustrate the present application and cannot be understood as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.
[0037] 1. Materials
[0038] (1) Restriction endonucleases XbaI and BamHI, ligase, pEASY-Blunt Simple, DNA Marker, Taq DNA polymerase, dNTPs, etc. were purchased from Takara Company;
[0039] (2) The reverse transcription kit was purchased from Promega Company;
[0040] (3) The plasmid extraction kit, gel extraction kit and genomic extraction kit were purchased from TransGen Biotech Co., Ltd.;
[0041] (4) All primers used were synthesized by Shanghai Sangon Biotech Co., Ltd.; Sequencing was carried out by General Biosystems Co., Ltd.;
[0042] The methods used in this example are all conventional methods known to those skilled in the art unless otherwise specified. The reagents and other materials used are all commercially available products unless otherwise specified.
[0043] 2. Methods
[0044] 2.1 Obtaining of the NAC family gene PtNAC61 of Pinellia ternata
[0045] 2.1.1. Drought stress treatment: Select uniform and plump Pinellia ternata tubers and sow them in flower pots filled with nutrient soil. Sprinkle distilled water in due course to keep the soil moist. When the seedlings grow to the three-leaf stage, use the plants with normal irrigation as the control and conduct natural drought stress treatment for 3, 5, 7, 10, 12, and 14 days respectively. At different time periods of the treatment, use scissors to cut the leaves of the same part of the Pinellia ternata seedlings in the experimental group and the control group respectively, and take three samples for each treatment stage. After sampling, immediately freeze the samples in liquid nitrogen and store them in a -80°C refrigerator for later use.
[0046] 2.1.2. RNA extraction: For the Pinellia ternata materials obtained in the above step 2.1.1, after adding liquid nitrogen and grinding, quickly transfer them to a 1.5 mL centrifuge tube (pre-cooled with liquid nitrogen). Transfer the well-ground Pinellia ternata materials to the 0.5 mL mark, add 1 mL of Trizol, and let it stand at room temperature for 10 minutes to allow sufficient lysis. Centrifuge at 12,000 rpm at 4°C for 5 minutes and discard the precipitate. Add chloroform at 200 μL of chloroform / mL of Trizol, tighten the centrifuge tube cap, and vigorously shake it by hand for 15 seconds. After thorough emulsification, let it stand at room temperature for 15 minutes. Centrifuge at 12,000 rpm at 4°C for 15 minutes. Carefully take out the centrifuge tube from the centrifuge, aspirate the upper aqueous phase and transfer it to another centrifuge tube. Add isopropanol at 0.5 mL of isopropanol / mL of Trizol and mix well, then let it stand at room temperature for 10 minutes. Centrifuge at 12,000 rpm at 4°C for 15 minutes. Discard the supernatant, and the RNA precipitates at the bottom of the tube. Carefully discard the supernatant, add 75% ethanol at 1 mL of 75% ethanol / mL of Trizol, gently shake the centrifuge tube to suspend the precipitate, centrifuge at 12,000 rpm at 4°C for 5 minutes, discard the ethanol, place it upside down on paper, and let it dry at room temperature. Add an appropriate amount of RNase-free water to dissolve the precipitate. If necessary, use a pipette to blow and beat the precipitate. After the RNA is fully dissolved, take an appropriate amount to detect its concentration and purity, and store the rest at -80°C for later use.
[0047] 2.1.3. Reverse transcription: Operate according to the steps provided by the promega reverse transcription kit. The reverse transcription system is as follows: Total RNA
[0048] 1 μg, 4 μL of 25 mM MgCl2, 2 μL of Reverse Transcription 10× Buffer, 2 μL of 10 mM dNTP Mixture, 0.5 μL of RNase inhibitor (40 U / μL), 1 μL of Oligo(dT)15 Primer (500 μg / μL), 0.6 μL of AMV Reverse Transcriptase (25 U / μL), add Nuclease-Free Water to 20 μL. Mix gently, incubate at 42 °C for 40 min, then heat at 95 °C for 5 min, and place at 4 °C for 15 min to terminate the reaction, thus obtaining the corresponding reverse transcription product cDNA.
[0049] 2.1.4, Amplification: Search the Pinellia ternata genome and transcriptome databases to obtain the putative coding sequence of PtNAC61. Design specific primers using Primer Premier 5.0 software. The primer sequences are as follows:
[0050] SEQ ID NO.3: PtNAC61-F: ATGGCGACGGGGATGGC;
[0051] SEQ ID NO.4: PtNAC61-R: TCAGAGGCTTCCGTGCCTCT.
[0052] Using the Pinellia ternata cDNA obtained in step 2.1.3 above as a template, a coding region containing a complete open reading frame with a length of 894 bp was obtained by RT-PCR, recovered, ligated to the pEASY-Blunt Simple vector, and sequenced.
[0053] The sequencing results showed that the nucleotide sequence of the PtNAC61 gene was identical to the nucleotide sequence shown in SEQ ID NO.2 and encoded a protein with the amino acid residue sequence shown in SEQ ID NO.1.
[0054] 2.2 Sequence homology and homology analysis of Pinellia ternata PtNAC61
[0055] According to the sequence sequencing results, sequence alignment was performed in the Pinellia ternata database, and it was found that the cloned gene sequence had the closest homology with the NAC family transcription factors. The transcription factor PtNAC61 was compared with other reported NAC transcription factor families
[0056]
[0057] The protein sequences of the members were aligned to analyze the highly conserved domain sequences at their N - termini. To further analyze the phylogenetic relationship between PtNAC61 and other NAC - type transcription factors with known functions, the NAC proteins of different plants were analyzed for their phylogenetic relationship with PtNAC61, and the results are as Figure 1 and 2 shown.
[0058] 2.3 Subcellular localization of PtNAC61
[0059] 2.3.1 Construction of the subcellular localization vector of PtNAC61
[0060] To understand the expression of the PtNAC61 protein, a subcellular localization fusion expression vector was constructed. Using pCAMBIA1305 (p1305) as the backbone, GFP green fluorescent protein as the reporter gene, and mCherry red fluorescent protein as
[0061] the nuclear localization signal gene, the p1305 - 35S - PtNAC61 - GFP fusion expression vector was constructed. Remember that when designing the primers for this gene
[0062] sequence, the stop codon of the gene should be removed. XbaI and BamHI were used as the restriction enzyme sites for the upstream and downstream primers. The primer sequences
[0063] are as follows:
[0064] SEQ ID NO.5: RH - F: GTCCGGAGCTAGCTCTAGAATGGCGACGGGGATGGC;
[0065] SEQ ID NO.6: RH - R: CCTTGCTCACCATGGATCCGAGGCTTCCGTGCCTCTTCC.
[0066] 2.3.2 Transient expression in tobacco
[0067] 1) Select healthy tobacco plants that have grown for 3 - 4 weeks. The growth state of the tobacco is very important and must be healthy and vigorous. Generally, long - day growth is required. If grown in an incubator, it needs to be taken out a few days in advance before infection to adapt to the external environment;
[0068] 2) Select the competent cells of Vidi Biotechnology GV3101 (pSoup-p19). Take the competent cells out of the -80°C refrigerator and thaw them at room temperature or on ice. Add 1 μg of pCAMBIA1305, p1305-35S-PtNAC61-GFP, and mCherry plasmids to each 100 μL of the freshly thawed competent cell suspension respectively, gently mix well, let it stand on ice for 5 min, quickly freeze it in liquid nitrogen for 5 min, incubate it in a 37°C water bath for 5 min, and then in an ice bath for 5 min. Under sterile conditions, add 700 μL of antibiotic-free YEP liquid medium, shake and culture it at 28°C on a shaker for 2 - 3 h. After centrifuging the bacterial liquid at 5000 rpm for 1 min, take about 100 μL of the supernatant, gently resuspend the bacterial cells by pipetting, add it to the YEP solid medium plate containing kanamycin and rifampicin, use a sterile spreader to evenly spread the cells, invert the plate after the liquid in the plate is completely absorbed, and culture it at 28°C for 2 - 3 days.
[0069] 3) Pick several monoclonal colonies and place them in separate 2 mL centrifuge tubes. Add 1 mL of YEP liquid medium containing kanamycin and rifampicin, and shake and culture them at 28°C on a shaker for about 3 h. Take the bacterial liquid for PCR detection. After performing 1.0% agarose gel electrophoresis on the PCR products, select the correct bacterial liquid and add it to a 50 mL centrifuge tube containing about 10 mL of YEP liquid medium with kanamycin and rifampicin, and shake and culture it at 28°C on a shaker for 12 - 16 h.
[0070] 4) Measure OD600. When the OD600 of Agrobacterium is > 1.6, it can be injected. Calculate the volume of each Agrobacterium bacterial liquid added. The calculation formula is: V = 3 / OD600.
[0071] 5) Mix the calculated Agrobacterium bacterial liquid well and centrifuge it at 4000 rpm / min at room temperature for 15 min.
[0072] 6) Discard the supernatant and resuspend the bacterial cells with 2 ml of tobacco treatment solution (200 μL of 0.5 M MES, 100 μL of 1 M MgCl2, 10 μL of 100 mM AS, 9.69 mL of sterile water).
[0073] 7) Let it stand at room temperature in the dark for 1 - 1.5 h.
[0074] 8) Use a 5 mL syringe without a needle to inject different areas on the back of the tobacco leaves.
[0075] 9) Incubate it under weak light at room temperature for 36 - 48 h and observe it with a laser confocal microscope.
[0076] The results are as Figure 3 shown: The subcellular localization experiment shows that the PtNAC61 protein is localized in the nucleus.
[0077] 2.4 Detection of Transgenic Pinellia ternata with PtNAC61
[0078] The plant expression vector pCAMBIA1301-PtNAC61 was constructed and introduced into the petioles of Pinellia ternata through Agrobacterium-mediated genetic transformation. After pre-culture, infection, co-culture, and screening for hygromycin-resistant calli, transgenic plants were obtained through differentiation, rooting, hydroponics, and transplantation. Then, genomic DNA was extracted from the leaves of the transgenic plants, and the specific method is as follows:
[0079] 1) Put 100 mg of young leaves of fresh Pinellia ternata plants into a mortar and grind thoroughly with liquid nitrogen;
[0080] 2) Add 250 μL of RB1 solution and quickly invert and mix well;
[0081] 3) Add 30 μL of 10% SDS and 15 μL of RNaseA to the lysis solution and mix well;
[0082] 4) Incubate in a water bath at 60 °C for 15 min;
[0083] 5) Centrifuge at 13000 rpm for 5 min and transfer the supernatant to a clean centrifuge tube;
[0084] 6) Add 100 μL of solution PB1, mix well, place on ice for 5 min, and centrifuge at 13000 rpm for 5 min;
[0085] 7) Transfer the supernatant to a clean centrifuge tube, add 375 μL of solution BB1, and mix well;
[0086] 8) Pour all the mixed solution onto the adsorption column, centrifuge at 13000 rpm for 1 min, and discard the filtrate;
[0087] 9) Add 500 μL of solution CB1, centrifuge at 13000 rpm for 1 min, and discard the filtrate;
[0088] 10) Add 500 μL of solution WB1, centrifuge at 13000 rpm for 1 min, discard the filtrate, and repeat once;
[0089] 11) Centrifuge at 13000 rpm for 2 min to completely remove WB1;
[0090] 12) Transfer the adsorption column to a clean centrifuge tube, add 70 μL of preheated deionized water to the center of the column, let it stand at room temperature for 2 min, and centrifuge at 13000 rpm for 2 min to elute the DNA;
[0091] 13) Take 5 μL of the sample and load it on a 1% agarose gel to detect the quality of the extracted DNA.
[0092] Using this as a template, the target fragment was amplified with hygromycin gene primers, and the primer sequences are as follows:
[0093] SEQ ID NO.7: HygR-F: ACTCACCGCGACGTCTGT;
[0094] SEQ ID NO.8: HygR-R: TTTCTTTGCCCTCGGACG.
[0095] The PCR reaction conditions were as follows: pre-denaturation: 94°C, 5 min; denaturation: 94°C, 30 s, annealing: 55°C, 30 s, extension: 72°C, 1 min 30 s, 30 cycles; 72°C, 10 min. After the reaction, the PCR products were detected by 1.0% agarose gel electrophoresis, and the results were as Figure 4 shown. M: DL2000 Marker; 1: OE1; 2: OE2; 3: OE3; 4: OE4; 5: OE5; +: positive control with pCAMBIA1301 plasmid as the template; -: negative control with water as the template. Figure 4 It can be seen that both the transgenic plants and the positive control could amplify the target band, while the negative control did not amplify the band, indicating that the expression vector carrying the PtNAC61 gene had been successfully introduced into the Pinellia ternata genome.
[0096] 2.5 PCR Detection and Semi-quantitative Detection of PtNAC61 Transgenic Plants
[0097] 2.5.1, PCR Detection
[0098] Genomic DNA was extracted from the leaves of the transgenic plants in step 2.4 above, and PCR detection was performed on the PtNAC61 gene. The amplification program was: pre-denaturation: 94°C, 5 min; denaturation: 94°C, 30 s, annealing: 60°C, 30 s, extension: 72°C, 1 min 30 s, 30 cycles; 72°C, 10 min. The results were as Figure 5 shown. All transgenic plants could amplify the target band (the PtNAC61 amplification band was 894 bp), while the negative control did not amplify the band, indicating that the PtNAC61 gene had been successfully introduced into the Pinellia ternata genome.
[0099] 2.5.2, Semi-quantitative Detection
[0100] RNA was extracted from some leaves of the transgenic plants in step 2.4 above and reverse-transcribed into cDNA. Using Pinellia ternata 18srRNA as the internal reference gene, semi-quantitative primers were designed according to the nucleotide sequence of the PtNAC61 gene:
[0101] SEQ ID NO.9: Pt18s-F: CGCATATAAATAAACGGAGGAA;
[0102] SEQ ID NO.10: Pt18s-R: GACGCTTCTACAGACTACA;
[0103] SEQ ID NO.11: PtNAC61-RT-F: GCACGGATAACGACATCAACG;
[0104] SEQ ID NO.12: PtNAC61-RT-R: ATCACTGCCTCACCCGACCC.
[0105] Semi-quantitative detection of the PtNAC61 gene was performed. The amplification program was as follows: pre-denaturation: 94°C, 5 min; denaturation: 94°C, 30 s, annealing: 60°C, 30 s, extension: 72°C, 1 min, for 20 cycles; 72°C, 10 min. The results were as Figure 6 shown. No band could be amplified from the negative control, while the target bands could be amplified from all transgenic plants.
[0106] 2.6 Identification of drought tolerance of PtNAC61 transgenic plants
[0107] Transgenic Pinellia ternata PCR-positive sterile seedlings (overexpressing PtNAC61 gene lines OE3 and OE4) with growth similar to that of wild-type (WT) Pinellia ternata were selected and transplanted into flowerpots filled with sterilized nutrient soil. Appropriate amounts of water were watered daily, and the plants were cultured in a greenhouse at an environmental temperature of 22°C, with 16 h of light and 8 h of darkness. Culturing at room temperature was used as the control. When the seedlings in the drought treatment group reached the three-leaf stage, watering was stopped for natural drought, with 3 replicates. After 7 days of natural drought treatment, the apparent traits of the plants were observed and recorded daily, and their survival rates were statistically analyzed. The results were as Figure 7 shown. After drought treatment, the leaves of wild-type Pinellia ternata showed obvious yellowing, and after drought treatment, the survival rate of transgenic Pinellia ternata was significantly higher than that of wild-type Pinellia ternata. Overexpression of the PtNAC61 gene significantly improved the drought tolerance of Pinellia ternata.
[0108] 2.7 Identification of anti-aging ability of PtNAC61 transgenic plants
[0109] 2.7.1 Observation of senescence phenotypes
[0110] Transgenic Pinellia ternata PCR-positive sterile seedlings (OE3 and OE4) with growth similar to that of wild-type (WT) Pinellia ternata were selected and cultured on MS + Kan + Carb culture plates. After callus grew into seedlings, they were transferred to conical flasks, photographed and recorded (control). Then they were cultured in a greenhouse for 2 months, and the apparent traits of the plant leaves were observed and recorded (senescence). The results were as Figure 8As shown in Figure A, compared with transgenic Pinellia ternata, the leaves of wild-type Pinellia ternata are yellowish and the degree of senescence is more obvious.
[0111] 2.7.2 Chlorophyll content detection
[0112] Take 100 mg each of transgenic plants (OE3, OE4) and wild-type plants (WT), cut them into pieces and put them into 5 mL of pre-cooled 95% ethanol. Place them in the dark at 4°C until the leaves are completely decolorized. Centrifuge at 9000 rmp for 2 min at 4°C. Take the supernatant and measure the absorbance values at 649 nm and 665 nm with a spectrophotometer. Substitute the values into the formula to calculate the total chlorophyll content: (6.10A665 + 20.04A649) * V / (1000 * W), where V is the volume of the extraction solution (mL) and W is the fresh weight of the plant (g). The results are as Figure 8 shown in Figure B. The chlorophyll content in wild-type Pinellia ternata is much lower than that in transgenic Pinellia ternata.
[0113] In summary, through phenotypic observation and chlorophyll content detection results, it is proved that overexpression of the PtNAC61 gene can delay the senescence of Pinellia ternata leaves.
[0114] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.
Claims
1. A Pinellia ternata NAC transcription factor PtNAC61, characterized in that, The Pinellia ternata NAC transcription factor PtNAC61 is a protein as described in (1) or (2) below: (1) A protein consisting of the amino acid residue sequence in SEQ ID NO.1; (2) A protein derived from (1), which has undergone substitution and / or deletion and / or addition of one to ten amino acid residues in the amino acid residue sequence in SEQ ID NO.1 and has the function of the Pinellia ternata NAC transcription factor.
2. The Pinellia ternata NAC transcription factor PtNAC61 according to claim 1, wherein The amino acid sequence of the Pinellia ternata NAC transcription factor PtNAC61 is as shown in SEQ ID NO.
1.
3. A PtNAC61 gene encoding the Pinellia ternata NAC transcription factor as described in any one of claims 1-2, characterized in that, The nucleotide sequence of the PtNAC61 gene is any one of the following (1) to (4): (1) The DNA sequence as shown in SEQ ID NO.2; (2) A polynucleotide encoding the amino acid sequence shown in SEQ ID NO.1; (3) A DNA sequence having more than 90% homology with the DNA sequence in SEQ ID NO.2 and encoding the same functional protein; (4) A nucleotide sequence that can hybridize with the DNA sequence defined in SEQ ID NO.2 under high stringency conditions, where the high stringency conditions are a solution of 0.1×SSPE or 0.1×SSC, 0.1% SDS, hybridized at 65°C and the membrane is washed.
4. The PtNAC61 gene according to claim 3, characterized in that, The nucleotide sequence of the PtNAC61 gene is as shown in SEQ ID NO.
2.
5. Use of the PtNAC61 gene as described in any one of claims 3-4 in simultaneously regulating plant senescence and plant stress resistance.
6. The application according to claim 5, wherein Overexpressing the PtNAC61 gene can delay plant leaf senescence and improve plant drought resistance.
7. The application according to claim 6, wherein The plant is a monocotyledonous plant or a dicotyledonous plant.
8. The application according to claim 7, characterized in that, The monocotyledonous plant is Pinellia ternata.
9. A method for obtaining a drought-resistant and stay-green plant, characterized in that, After introducing the PtNAC61 gene as described in any one of claims 3-4 into a target plant using a plant expression vector, a drought-resistant and green-holding plant is obtained, and the drought resistance and green-holding traits of the drought-resistant and green-holding plant are higher than those of the target plant.
10. The method for obtaining drought-resistant stay-green plants according to claim 9, characterized in that, The plant is Pinellia ternata; the plant expression vector is pCAMBIA1301.
Citation Information
Patent Citations
Plant stress-resistance related SbSNAC1 protein, and coding gene and application thereof
CN104177482A
Pinellia ternata cysteine protease and application thereof
CN105368807A
Plant drought resistance-related protein GmNAC8 and encoding gene as well as application thereof
CN105646685A
Pinellia ternata aspartic protease and application thereof
CN106434605A
Pinellia pedatisecta trypsin inhibitor gene, protein encoded thereby, and anti-insect application thereof
CN108517322A
Cited By
Application of PtEXPB2 related biological product in improvement of plant drought stress tolerance
CN121780605A