A biocontrol strain htbs01 for preventing and treating malus robusta branch diseases, and screening method and application thereof

Abstract

The present application provides a kind of preventing and treating malus robusta branch disease biocontrol strain HTBS01 and its screening method and application.The biocontrol strain HTBS01 belongs to Baciilus subtilis, and the preservation number is CGMCC No.24547, which can be used to prevent and treat malus robusta branch diseases such as wheel pattern disease, rough bark disease, rot disease, etc.Inhibition rate of biocontrol strain HTBS01 to malus robusta wheel pattern disease, rough bark disease pathogen is more than 90% in indoor antagonism test, and the inhibition rate to rot disease pathogen is 66.67%.Forest biocontrol test shows that the control efficiency of biocontrol strain HTBS01 to rough bark disease of malus robusta of different ages is 18%-38%, and the control efficiency to rot disease is 47%-50%.The biocontrol strain HTBS01 provided in the present application can reduce the use of pesticides, is safe and non-toxic, and realizes the dual purpose of prevention and treatment of malus robusta branch diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a biocontrol strain HTBS01 for preventing and treating twig and trunk diseases of Malus chinensis, and a screening method and application thereof. Background Art

[0002] Begonia Malus micromalus ), a plant of the Magnoliaceae, Rosaceae, and Malus genus, is a traditional famous flower unique to my country. Its tree posture is steep and its flowers are bright. It is an excellent early spring flower and tree, and occupies an important position in my country's garden landscaping. Its application was recorded as early as the Spring and Autumn Period and the Warring States Period. In China, the culture of crabapple contains profound social, artistic, and scientific connotations. Crabapple is widely used in literary masterpieces, ancient paintings, poems, and plant landscaping, which is full of humanistic colors. At present, in the daily maintenance of Xifu crabapple, diseases of branches and trunks are particularly difficult to prevent and control. They are called crabapple cancers. For example, rot disease, ring disease, and rough bark disease are all weak parasites that mainly damage the cortex of branches and trunks. The pathogens spread and invade from dead stumps, cuts, wounds, and dead buds, causing disease. The trunks are covered with scars, the crowns are incomplete, and even dead trees are left, seriously affecting the landscape. In addition, since the Chinese crabapple is an excellent standard apple rootstock, as well as a good material for potted plants and cut flowers, it is widely planted and is one of the five cultivated species of the genus Malus. Therefore, strengthening the etiological research and prevention and control of Chinese crabapple branch and trunk diseases will help improve the overall health level and application effect of Malus plants.

[0003] The pathogen of Xifu crabapple trunk rot is the fungus Blackrot, which belongs to the genus Blackrot of the subdivision Ascomycota. Valsa , whose asexual generation belongs to the genus Ascocystis of the subphylum Deuteromycotina Cytospora It is a weak parasitic fungus with latent infection characteristics. The branches of crabapple that appear disease-free may have been invaded and colonized by the pathogen, but when the branches are healthy, the pathogen is in a latent state. Only when the bark loses its vitality will the pathogen spread and cause bark rot. The rot disease occurs most severely during the dormant period of crabapple. When the temperature rises in early spring, the spread accelerates and the disease enters its peak period. The bark of the diseased part changes from normal gray-green to reddish brown, slightly raised, water-soaked, and slightly elastic. Later, the cortex rots, oozing reddish-brown mucus, and wet rot. The pathogen of the ring rot disease of the branches of Xifu crabapple is the genus Botrytis. Botryosphaeria After infection, it often produces a large number of tumor-like protrusions. These lesions are connected, resulting in rough bark and necrosis of branches. Xifu crabapple branch rough bark disease is a newly discovered branch disease that occurs and spreads rapidly, found in plants of different ages. The disease manifests as typical tumors on the branches. As the tumors continue to increase and crack, they eventually develop into rough bark symptoms, causing the tree to weaken and making chemical control ineffective.

[0004] To control twig and trunk diseases of Chinese crabapple, production primarily relies on the use of chemical fungicides, resulting in significant annual expenditures on pesticides, capital, and labor. Long-term use of fungicides can lead to the development of resistance in pathogens, complicating disease control. Furthermore, the long-term and extensive use of chemical pesticides inevitably pollutes the environment and harms human health. Therefore, the search for new, safe, non-toxic, and effective methods for controlling twig and trunk diseases of Chinese crabapple is urgent. Currently, research reports on biocontrol agents as alternatives to chemical agents are increasing year by year, and the use of biocontrol agents for biological disease control is an inevitable trend. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to address the deficiencies of the above-mentioned existing technologies and provide a biocontrol strain HTBS01 for preventing and treating twig diseases of Malus chinensis, as well as a screening method and application thereof, which can achieve the dual purpose of preventing and treating twig diseases of Malus chinensis.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is: a biocontrol strain HTBS01 for preventing and treating the branch and trunk diseases of the Chinese crabapple, the biocontrol strain HTBS01 belongs to Bacillus subtilis Baciilus subtilis , the deposit number is: CGMCC No.24547.

[0007] The present invention also provides a method for screening the biocontrol strain HTBS01 for preventing and treating the twig and trunk diseases of Malus chinensis, the method comprising the following steps:

[0008] S1. Surface disinfection of samples: Take samples of healthy and diseased tissues of Malus chinensis branches and trunks from different seasons and perform surface disinfection to obtain disinfected samples;

[0009] S2. Sample grinding and separation: Place the disinfected sample obtained in S1 into a sterilized mortar, add sterilized quartz sand and sterile water to fully grind, take the ground juice, add sterile water, mix well, and let it stand to obtain a sample solution;

[0010] S3, gradient dilution: gradient dilution of the sample solution obtained in S2 with sterile water to obtain dilution solution;

[0011] S4. Plate culture: Take the dilution obtained in S3 and spread it on beef extract plates. Culture at a temperature of 28°C-30°C. After colonies grow on the plates, pick a single colony, streak it, and purify it to obtain strain HTBS01.

[0012] Preferably, the surface disinfection in S1 is disinfected with 75% alcohol by volume for 30 s-60 s, then treated with 1.0% NaClO solution by mass for 10 min-15 min, and finally rinsed three times with sterile water.

[0013] Preferably, the gradient dilution concentration in S3 is 1×10 -2 ~1×10 -9 .

[0014] The present invention also provides an application of the biocontrol strain HTBS01 in preventing and controlling diseases of Malus chinensis branches and trunks.

[0015] Preferably, the crabapple branch and trunk diseases include crabapple rough bark disease, crabapple rot disease and crabapple ring rot disease.

[0016] Preferably, when the biocontrol strain HTBS01 is used to control crabapple branch and trunk diseases, it is prepared into a spore suspension or powder.

[0017] Preferably, the spore suspension is prepared by the following method: strain HTBS01 is inoculated into a beef extract liquid culture medium, shaken and cultured at a temperature of 30°C-32°C and a rotation speed of 180 rpm-200 rpm for 36 h-48 h, and after spore formation is observed, centrifuged at 5000 rpm-8000 rpm for 3 min-5 min, the precipitate is collected, and the precipitate is suspended in sterile water to obtain a spore concentration of not less than 1×10 9 CFU / mL of spore suspension.

[0018] Preferably, the powder is prepared by the following method: the spore suspension is adsorbed with peat or calcium powder and then dried.

[0019] Compared with the prior art, the present invention has significant technical effects:

[0020] 1. The biocontrol strain HTBS01 obtained by the present invention by separation and purification from the healthy tissue of Xifu Begonia disease belongs to Bacillus subtilis in the genus Bacillus Baciilus subtilis It can prevent and control diseases of crabapple branches and trunks such as ring rot, rough bark disease, and rot. Indoor antagonism tests have shown that the inhibition rate of the biocontrol strain HTBS01 on the pathogens of crabapple ring rot and rough bark disease reached more than 90%, and the inhibition rate of strain HTBS01 on the pathogen of crabapple rot disease was 66.67%; the results of forest biocontrol tests showed that the prevention effect of the biocontrol strain HTBS01 preparation on the rough bark disease of crabapple of different ages was 18%-38%, and the prevention and control effect on the rot disease of crabapple of different ages was 47%-50%.

[0021] 2. The biocontrol strain HTBS01 provided by the present invention can reduce the use of pesticides, is safe and non-toxic, and achieves the dual purpose of preventing and treating diseases of the branches and trunks of the Chinese crabapple.

[0022] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the phylogenetic tree of strain HTBS01 and other Bacillus subtilis strains constructed based on the gyrA gene sequence in Example 1 of the present invention;

[0024] Figure 2 This is a graph showing the inhibitory effect of the biocontrol strain HTBS01 on the pathogen of Malus chinensis ring rot in Example 4 of the present invention, wherein the left side is a blank control and the right side is the inoculated strain HTBS01;

[0025] Figure 3 This is a graph showing the inhibitory effect of the biocontrol strain HTBS01 on the pathogen of Malus xifuensis rough bark disease in Example 4 of the present invention, wherein the left side is a blank control and the right side is the inoculated strain HTBS01;

[0026] Figure 4 This is a graph showing the inhibitory effect of the biocontrol strain HTBS01 on the pathogen of Malus rot in Example 4 of the present invention, wherein the left side is a blank control and the right side is the inoculated strain HTBS01. DETAILED DESCRIPTION

[0027] Example 1

[0028] This example is about the acquisition and identification of strains.

[0029] (1) Acquisition of strains

[0030] Healthy and diseased tissue samples of Malus chinensis branches and trunks were collected in different seasons at the Summer Palace. The samples were surface disinfected with 75% alcohol for 30 seconds, treated with 1.0% NaClO solution for 10 minutes, and finally rinsed three times with sterile water. 10 g of the surface-disinfected sample was placed in a sterilized mortar and ground thoroughly with a small amount of sterilized quartz sand and 90 mL of sterile water. 1 mL of the ground juice was taken and added to a centrifuge tube containing 9 mL of sterile water, mixed evenly, and allowed to stand. After standing, the samples were diluted with a gradient concentration of 1×10 -2 , 1×10 -3 , 1×10 -4 , 1×10 -5 , 1×10 -6 , 1×10 -7 , 1×10 -8 and 1×10 -9 , and diluted with sterile water in sequence; 100 μL of the dilutions of different concentrations were taken to apply to beef extract plates, 3 plates were applied for each concentration gradient, and cultured at 30°C. After colonies grew on the plates, single colonies were picked according to their morphological characteristics, and the biocontrol strains were obtained after streaking and purification, and stored at -20°C in 25% glycerol tubes.

[0031] (2) Identification method of strains

[0032] The gyrA gene fragment of the biocontrol strain was amplified by PCR using the genomic DNA of the biocontrol strain as a template. The primer sequences were gyrA-42F: CAGTCAGGAAATGCGTACGTCCTT (SEQ ID NO. 1) and gyrA-1066R: CAAGGTAATGCTCCAGGCATTGCT (SEQ ID NO. 2).

[0033] The PCR reaction system is as follows:

[0034] Table 1 PCR reaction system

[0035]

[0036] The PCR reaction procedure is as follows:

[0037] Table 2 PCR reaction procedure

[0038]

[0039] The PCR amplification product was tested for correct target band size using 1% agarose gel electrophoresis. The PCR amplification product was sent to Bio-Tech Co., Ltd. for sequencing, and the strain's gyrA gene fragment was obtained. The length was 928 bp, and the sequence is shown in SEQ ID NO.3.

[0040] SEQ ID NO.3:

[0041] TGTGTCTCGTGCTCTTCCAGATGTTCGTGACGGTTTAAAACCGGTTCACAGACGGATTTTATACGCAATGAATGATTTGGGCATGACAAGTGACAAACCTTATAAAAAATCCGCGCGTATCGTTGGAGAAGTTATCGGGAAATACCACCCGCACGGTGATTCAGCGGTATATGAATCCATGGTCAGAATGGCTCAGGATTTCAACTACCGTTATATGCTCGTTGACGGTCACGGAAACTTCGGTTCTGTTGACGGAGACTCAGCGGCGGCCATGCGTTATACAGAAGCAAGAATGTCTAAAATCTCAATGGAGATTCTTCGTGACATCACAAAAGACACAATCGATTACCAGGATAACTATGACGGGTCAGAAAGAGAACCTGTCGTTATGCCTTCAAGGTTCCCGAATCTGCTCGTGAACGGTGCTGCCGGCATTGCGGTAGGTATGGCAACAAACATTCCTCCGCACCAGCTGGGAGAAATCATTGACGGTGTACTTGCTGTCAGTGAGAATCCGGACATTACAATTCCAGAGCTTATGGAAGTCATTCCAGGGCCTGATTTCCCGACCGCGGGTCAAATCTTGGGACGCAGCGGTATCCGGAAAGCATACGAATCAGGCCGAGGCTCTATCACGATCCGGGCAAAAGCTGAGATCGAACAAACATCTTCGGGTAAAGAAAGAATTATCGTTACAGAGTTACCTTACCAAGTAAATAAGGCGAAATTAATTGAGAAAATTGCTGATCTCGTAAGGGACAAAAAGATAGAGGGTATCACAGATCTGCGTGATGAGTCAGATCGTACAGGTATGAGAATTGTCATTGAAATCAGACGCGATGCCAATGCGAATGTCATCTTAAACAATCTGTACAAACAAACTGCTCTACAAACATCTTTTGGCATCAACCTGCTTGCACTTGTTGAT。

[0042] The sequencing results were compared for sequence homology on the NCBI website (http: / / www.ncbi.nlm.nih.gov / ), and a phylogenetic tree was constructed using MEGA5.0 software based on the neighbor-joining method ( Figure 1 ). The phylogenetic tree results showed that the biocontrol strain was Bacillus subtilis BZJN1 (MG018617.1) is on the same branch, indicating that the biocontrol strain is Bacillus subtilis The strain was identified as Bacillus subtilis ( Baciilus subtilis ), and named it HTBS01.

[0043] (3) Deposit of strain HTBS01

[0044] The biocontrol strain HTBS01 belongs to Bacillus subtilis ( Baciilus subtilis ), was deposited on March 18, 2022 in the General Microbiology Center of China Culture Collection Administration (CGMCC for short, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), with the deposit number CGMCC No.24547.

[0045] Example 2

[0046] When the biocontrol strain HTBS01 is used to control the twig and trunk diseases of Malus chinensis, the biocontrol strain HTBS01 needs to be prepared into a spore suspension or powder. This example provides a method for preparing a spore suspension and powder of the biocontrol strain HTBS01.

[0047] (1) Preparation of spore suspension of biocontrol strain HTBS01: The biocontrol strain HTBS01 was inoculated into beef extract liquid culture medium (composed of 3 g beef extract, 10 g peptone, 5 g NaCl and 1000 mL water, pH 7.2), cultured at 32°C and 180 rpm for 48 h, and after spore formation was observed, centrifuged at 8000 rpm for 5 min, the precipitate (spores) was collected, and suspended in sterile water to obtain a spore concentration of 1×10 9 CFU / mL of spore suspension.

[0048] (2) Preparation method of biocontrol strain HTBS01 powder: The spore suspension is adsorbed with peat or calcium powder and dried to obtain a powdered preparation of Bacillus subtilis HTBS01.

[0049] Example 3

[0050] This example describes a method for preparing a spore suspension and powder of the biocontrol strain HTBS01.

[0051] (1) Preparation of spore suspension of biocontrol strain HTBS01: The biocontrol strain HTBS01 was inoculated into beef extract liquid culture medium (composed of 3 g beef extract, 10 g peptone, 5 g NaCl and 1000 mL water, pH 7.0), cultured at 30°C and 200 rpm for 36 h, and after spore formation was observed, the suspension was centrifuged at 5000 rpm for 5 min, the precipitate (spores) was collected, and the precipitate was suspended in sterile water to obtain a spore concentration of 1.4 × 10 9 CFU / mL of spore suspension.

[0052] (2) Preparation method of biocontrol strain HTBS01 powder: The spore suspension is adsorbed with peat or calcium powder and dried to obtain a powdered preparation of Bacillus subtilis HTBS01.

[0053] Example 4

[0054] This example shows the antagonistic effect of the biocontrol strain HTBS01 on the pathogens of Malus chinensis branch and trunk diseases.

[0055] Activation of the pathogen of crabapple ring rot (Botrytis cinerea) on PDA plates Botryosphaeria Pathogens were used as target bacteria and punched into 5 mm cakes on pathogen plates using a 5 mm borer. The antagonistic effect of the isolated bacteria was tested using the plate standoff method. A 5 mm diameter cake of pathogens was inoculated in the center of a PDA plate. The biocontrol strain HTBS01 was inoculated 2 cm above and below the center of the cake. A blank control plate was inoculated with only the pathogen. The plates were incubated in a 28°C incubator for 4-7 days. When the blank control colonized the entire plate, the control growth (colony radius) and treatment growth (inhibited growth radius after inoculation) of the pathogen were measured. The inhibition rate of HTBS01 against the causative agent of Malus chinensis ring rot was determined: inhibition rate (%) = (control growth - treatment growth) / control growth × 100%.

[0056] HTBS01 strain is effective against the pathogen of Xifu crabapple rough bark disease (Quercus substomiae) Nothophoma quercina ), rot pathogens ( black rot fungi Valsa mali Miyabe & G. Yamada ) is studied using the same method as above.

[0057] The inhibitory effect of strain HTBS01 on the pathogen of Malus chinensis ring rot is as follows Figure 2 The inhibitory effect of strain HTBS01 on the pathogen of Malus xifuensis rough bark disease is as follows: Figure 3 The inhibitory effect of strain HTBS01 on the pathogen of Malus rot is as follows: Figure 4The results of inhibition rate calculation showed that the inhibition rate of strain HTBS01 against the pathogens of Malus multiflora ring rot and rough bark disease reached over 90%, and the inhibition rate of strain HTBS01 against the pathogen of Malus multiflora rot disease was 66.67%.

[0058] Example 5

[0059] This example is an evaluation of the biocontrol effect of Bacillus subtilis HTBS01 preparation in forests.

[0060] 1. Test location

[0061] Location 1: The Water Drill School at the Summer Palace. Fourteen crabapple trees are of uniform shape and age, all twenty years old. All trees are paved except for the weir, where hostas are planted. Due to their proximity to buildings and paved surfaces, their growing space is limited, resulting in weak growth. Branch and trunk diseases, as well as rust and leaf spot diseases, are common on the leaves.

[0062] Location 2: The Begonia plot of the Gengzhitu tree in the Summer Palace. The 12 young crabapple trees have the same shape, and cool-season lawns are planted under the plants. The growing environment is relatively open and unobstructed. Branch diseases, rust, and leaf spot disease often occur.

[0063] 2. Test time

[0064] Using the same method, a forest prevention test was conducted on the same crabapple plants for two consecutive years from 2019 to 2020.

[0065] 3. Test methods

[0066] The control group included 7 crabapple trees in Shuicao School and 6 crabapple trees in Gengzhitu. Each tree was a replicate and was managed as usual.

[0067] The treatment groups included seven trees of the Shuicaoxuetang variety and six trees of the Gengzhitu crabapple variety, with each tree serving as a replicate. Treatment methods: Each tree was treated with 400g of HTBS01 powder. 40cm-deep holes were drilled in the east, south, west, and north directions, two-thirds of the way along the canopy. Each hole was filled with 100g of HTBS01 powder and an appropriate amount of water, and then covered with soil. Applications were made once in spring and autumn (March-April in spring, September-October in autumn). During the growing season (April-September), a 1000-fold dilution of HTBS01 powder was sprayed monthly. All treatment groups received HTBS01 powder in addition to standard management measures. Other maintenance and management practices were the same as those in the control group.

[0068] 4. Investigation of disease occurrence:

[0069] Survey time: April and mid-November to investigate the occurrence of branch and trunk rough bark disease and branch and trunk rot

[0070] (2) Investigation of rough bark disease on branches and trunks

[0071] A tree-by-tree survey was conducted, with each tree divided into three locations: the main trunk, the central trunk, and the branches. The location and severity of disease in the branches were investigated. The classification method for disease location was: the "main trunk" refers to the part of the tree below the first branch, the "central trunk" refers to the part above the first branch, and the "branch" refers to all branches other than the main trunk and central trunk.

[0072] There are six levels of severity for pellagra:

[0073] Level 0: The tree is disease-free;

[0074] Grade 1: The main trunk and central trunk have tumors or rough skin, and the affected area accounts for 1-15% of the total area of ​​the part;

[0075] Level 3: The main trunk and central trunk have tumors or rough bark, and the affected area accounts for 16-30% of the total area of ​​the part, or the main branches are affected;

[0076] Level 5: The main trunk and central trunk have tumors or rough skin with an area of ​​31-45% of the total area of ​​the part, or the side branches have obvious tumors;

[0077] Level 7: The main trunk and central trunk have diseased tumors or rough bark with an area of ​​46-60% of the total area of ​​the part, and the side branches have obvious diseased tumors; or the main trunk and central trunk have diseased tumors or rough bark with an area of ​​more than 60% of the total area of ​​the part, but the side branches are not diseased.

[0078] Level 9: The main trunk, central trunk and main branches have diseased tumors or rough bark, and the area of ​​diseased areas accounts for more than 60% of the total area of ​​the part, and there are obvious diseased tumors on the side branches.

[0079] Calculation method of disease index and control effect of rough bark disease of branches and trunks:

[0080] Disease index = (∑ (number of diseased plants at each level × severity at each level) / (highest disease level × total number of plants surveyed)) × 100;

[0081] Control effect (%) = (disease index of control area - disease index of treated area) / disease index of control area × 100.

[0082] (3) Investigation of branch and trunk rot

[0083] For each lesion, the cause (saw cut, frostbite / sunburn, branch, wound, other), location (main trunk, central trunk, main branch, side branch) and type of lesion (recurrent lesion, new lesion, healed lesion) should be recorded.

[0084] There are six levels of rot severity:

[0085] Level 0: The tree is disease-free (Note: the lesions that have been cured are counted as level 0);

[0086] Level 1: There are lesions on the side branches or at the junction of the side branches and the main branches, but no lesions on the main branches;

[0087] Level 3: There are diseased spots on the main branches or the branches between the main branches and the main trunk, but no diseased spots on the central trunk;

[0088] Level 5: There are 1-2 diseased spots on the main trunk and central trunk; the width of the lesions is less than half of the tree circumference;

[0089] Level 7: There are more than 3 diseased spots on the main trunk and central trunk, or the width of the diseased spots is half of the tree circumference or more.

[0090] Level 9: The main trunk, central trunk, and main branches all have disease spots, or there are dead main branches and side branches.

[0091] Calculation method of disease index and prevention effect of branch rot disease:

[0092] Disease index = (∑ (number of diseased plants at each level × severity at each level) / (highest disease level × total number of plants surveyed)) × 100;

[0093] Control effect (%) = (disease index of control area - disease index of treated area) / disease index of control area × 100.

[0094] (4) Data statistics

[0095] SAS software was used for statistical analysis and multiple comparisons of the data. The effects of probiotics on crabapple rejuvenation and disease prevention were evaluated for two consecutive years. The results are shown in Table 3.

[0096] Table 3 Control effect of biocontrol strain HTBS01 powder on twig rot and rough bark disease of Malus chinensis

[0097]

[0098] The results of the forest biocontrol test of Bacillus subtilis HTBS01 powder showed that the average prevention effect of HTBS01 powder on the rot disease of the 20-30-year-old crabapple trees in Shuicaoxuetang was 47.13%, and the average prevention effect on the rot disease of the 10-20-year-old crabapple trees in Gengzhitu was 50.32%; the average prevention effect of HTBS01 powder on the rough bark disease of the 20-30-year-old crabapple trees in Shuicaoxuetang was 18.48%, and the average prevention effect on the rough bark disease of the 10-20-year-old crabapple trees in Gengzhitu was 38.10%.

[0099] The present invention provides a biocontrol strain HTBS01 for preventing and controlling crabapple branch diseases, as well as a screening method and application thereof. The strain can be used to prevent and control crabapple branch diseases such as ring rot, rough bark disease, and rot. The strain can effectively reduce the use of pesticides, is safe and non-toxic, and achieves the dual purpose of preventing and treating crabapple branch diseases.

[0100] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent variation made to the above embodiment based on the essence of the invention technology shall still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A biocontrol strain HTBS01 for preventing and treating diseases of Malus chinensis branches and trunks, characterized in that: The biocontrol strain HTBS01 belongs to Bacillus subtilis ( Baciilus subtilis ), the deposit number is: CGMCC No.24547.

2. An application of the biocontrol strain HTBS01 according to claim 1 in preventing and treating Malus chinensis branch and trunk diseases, characterized in that: The Xifu crabapple branch and trunk diseases include crabapple rough bark disease, crabapple rot disease and crabapple ring rot disease.

3. The use according to claim 2, characterized in that When the biocontrol strain HTBS01 is used to prevent and control crabapple branch and trunk diseases, it is prepared into a spore suspension or powder.

4. The use according to claim 3, characterized in that The spore suspension is prepared by the following method: strain HTBS01 is inoculated into a beef extract liquid culture medium, shaken and cultured at a temperature of 30°C-32°C and a rotation speed of 180 rpm-200 rpm for 36 h-48 h, and after spore formation is observed, centrifuged at 5000 rpm-8000 rpm for 3 min-5 min, and the precipitate is collected and suspended in sterile water to obtain a spore concentration of not less than 1×10 9 CFU / mL of spore suspension.

5. The use according to claim 3, characterized in that The powder is prepared by the following method: the spore suspension is adsorbed by using peat or calcium powder and then dried.

Images