Aeromonas dakara wecA gene deletion strain, refilling strain and construction method and application of Aeromonas dakara wecA gene deletion strain and refilling strain

By constructing the wecA gene deletion strain and the backfilling strain of Aemonas daka, the multiple roles of the wecA gene in regulating the virulence of Aemonas daka are revealed, the shortcomings in its pathogenic mechanism research are solved, new prevention and control and treatment strategies are provided, and the survival rate and immune protection effect of the strain are enhanced.

CN120290613APending Publication Date: 2025-07-11HAINAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510470777.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-15
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, research on the pathogenic mechanism and epidemiological characteristics of Aeromonas daka is relatively scarce, resulting in the failure to fully pay attention to its pathogenicity, affecting the scientific nature of clinical treatment and prevention and control strategies.

Method used

Homologous recombination technology was used to construct the wecA gene deletion strain and backfilling strain of Aemonas daka. The biological function of the wecA gene in Aemonas daka was analyzed through biological characteristics, including enhancing the strain's sensitivity to polymyxin B, affecting LPS synthesis, enhancing hemolytic activity and swimmering ability, significantly upregulating the transcription level of flagellar-related genes, enhancing resistance to hydrogen peroxide, and reducing adhesion and toxicity to host cells.

Benefits of technology

It significantly reduced the virulence of the strain on C. elegans and zebrafish, improved the survival rate and immune protection effect of the strain, provided a potential target for new antibacterial strategies, and deepened the understanding of the pathogenic mechanism of Aeromonas Dhaka.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290613A_ABST
    Figure CN120290613A_ABST
Patent Text Reader

Abstract

The invention provides a wecA gene deletion strain and a wecA gene supplementation strain as well as a construction method and application of the wecA gene deletion strain and the wecA gene supplementation strain, a we cA gene recombinant suicide plasmid pRE112-delta wecA is constructed by adopting a seamless cloning method, the wecA gene deletion strain delta wecA is obtained by jointing an aeromonas dakara strain with E.coli WM3064 containing the pRE112-delta wecA, and a corresponding gene supplementation strain C delta wecA is also constructed. According to the invention, a wecA gene deletion strain and a wecA gene supplementation strain are designed and constructed through systematic experiments, and multiple effects of the wecA gene in virulence regulation and control of Aeromonas dakara C160501, especially important functions in the aspects of LPS synthesis, host-pathogen interaction, immunoregulation and the like, are proved; especially, the strain with wecA gene deletion can reduce the toxicity of caenorhabditis elegans and zebra fish, and generates a relative protection rate of 46.7%-55.6% for zebra fish. The invention not only deepens the understanding of the virulence pathogenic mechanism of the Aeromonas dakara wecA, but also provides a potential target for developing a novel antibacterial strategy of the Aeromonas dakara.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology and relates to a wecA gene deletion strain and a complementation strain of Aeromonas dhakensis, and methods for constructing and applying the same. Background Art

[0002] Aeromonas dhakensis is a Gram-negative short bacillus of the genus Aeromonas in the family Aeromonadaceae. It has a wide range of host infection abilities, can infect humans, animals and aquatic organisms, and exhibits extremely high pathogenicity.

[0003] In many past studies, Aeromonas dhakensis was often misidentified as Aeromonas hydrophila, resulting in its pathogenicity not being fully emphasized, which has had an adverse impact on the timeliness of clinical treatment and the scientific selection of treatment strategies. In recent years, the isolation frequency of Aeromonas dhakensis in human infection cases has gradually increased (Zheng Zhen, Gong Yan, Lu Lequn, et al. Nursing care of a patient with rare Aeromonas dhakensis infection complicated with large-area skin tissue defect [J]. Contemporary Nurses (First Ten Days), 2022, 29(02): 153-156.). At the same time, with the continuous expansion of the alligator farming scale and the deterioration of the ecological environment, the number of alligator disease cases caused by bacterial pathogens has shown an upward trend, which not only endangers the sustainable and healthy development of the aquaculture industry, but also poses a potential threat to human public health safety. However, the research on the pathogenic mechanism and epidemiological characteristics of Aeromonas dhakensis is still relatively scarce, and it is urgently necessary to attract the high attention of the academic community to promote in-depth research on this bacterium, so as to explore more effective prevention, control and treatment strategies. Summary of the Invention

[0004] The purpose of the present invention is to provide a wecA gene deletion strain and a complementation strain of Aeromonas dhakensis, and methods for constructing and applying the same. The homologous recombination technology is used to perform gene editing on Aeromonas dhakensis strain C160501, and the wecA gene deletion strain (ΔwecA) and the gene complementation strain (CΔwecA) are successfully constructed. Through biological characteristic analysis, the biological function of the wecA gene in Aeromonas dhakensis is preliminarily clarified.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] The present invention provides a method for constructing a wecA gene deletion strain of Aeromonas dhakensis, including: constructing a wecA gene recombinant suicide plasmid pRE112-ΔwecA by seamless cloning method, and conjugating the Aeromonas dhakensis strain with E. coli WM3064 containing pRE112-ΔwecA to obtain the wecA gene deletion strain ΔwecA.

[0007] Preferably, the construction of the recombinant suicide plasmid pRE112-ΔwecA of the wecA gene by seamless cloning method further includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, and using two pairs of primers wecA-up-F / R and wecA-down-F / R to amplify the upstream and downstream homologous arms of the wecA gene respectively; extracting the pRE112 plasmid DNA, and using the primers reverse pRE112-F / R for PCR amplification to linearize the plasmid; ligating the pRE112 plasmid with the wecA upstream and downstream homologous arm fragments to construct the recombinant suicide plasmid pRE112-ΔwecA; the primer sequences are as follows:

[0008] wecA-up-F: TGGTCAAAGAGGAGGAGTATTCATCG,

[0009] wecA-up-R: TCATGCACCGTCACCGTCATCTG;

[0010] wecA-down-F: CAGCAACGGGGTTGTGAACTGGAA,

[0011] wecA-down-R: GGAGTGCGCGACACTATGGTTGA;

[0012] reverse pRE112-F: TCTAGAAGAAGCTTGGGATCGGGC,

[0013] reverse pRE112-R: GAGCTCTCCCGGGAATTCATGC.

[0014] The present invention also provides an Aeromonas dhakensis wecA gene deletion strain, which is obtained by the above construction method.

[0015] The present invention provides a construction method for the Aeromonas dhakensis wecA gene complementation strain, including: constructing the wecA gene complementation plasmid pBBR1MCS-2-ΔlacZα::wecA by seamless cloning method, and conjugating the Aeromonas dhakensis strain with E. coli WM3064 containing pBBR1MCS-2-ΔlacZα::wecA to obtain the wecA gene complementation strain CΔwecA.

[0016] Preferably, the construction of the wecA gene complementation plasmid pBBR1MCS-2-ΔlacZα::wecA using the seamless cloning method further includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, and amplifying the wecA gene fragment using the primers seamless wecA-F / R; extracting the pBBR1MCS-2 plasmid DNA, and performing PCR amplification using the primers reverse pBBR1MCS-2-F / R to linearize the plasmid; ligating the pBBR1MCS-2 plasmid and the wecA gene fragment to construct the complementation plasmid pBBR1MCS-2-ΔlacZα::wecA; the primer sequences are as follows:

[0017] seamless wecA-F: TCACCGAGCAGGGATTCG,

[0018] seamless wecA-R: GCGGATGGCTGACCAATACT;

[0019] reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG,

[0020] reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT.

[0021] The present invention also provides an Aeromonas dhakensis wecA gene complemented strain, which is obtained by the above construction method.

[0022] The present invention also provides the application of the deletion of the Aeromonas dhakensis wecA gene, including: significantly enhancing the sensitivity of the strain to polymyxin B, affecting LPS synthesis, significantly enhancing the hemolytic activity of the strain, significantly enhancing the swimming ability of the strain, significantly upregulating the transcriptional level of flagella-related genes, significantly enhancing the resistance of the strain to hydrogen peroxide, significantly reducing the adhesion rate of the strain to EPC cells, and weakening the toxicity of the strain to EPC cells.

[0023] Preferably, the application further includes: significantly increasing the survival rate of Caenorhabditis elegans under the infection of Aeromonas dhakensis.

[0024] Preferably, the application further includes: reducing the pathogenicity of the strain to zebrafish and significantly enhancing the protective effect of the strain in the zebrafish immune protection test.

[0025] More preferably, the deletion of the Aeromonas dhakensis wecA gene can significantly upregulate the expression of multiple immune-related genes, including: immunoglobulin M (IgM), intestinal mucin 2 (mucin-2), tumor necrosis factor α (TNF-α), myeloid differentiation factor 88 (MyD88), and interleukin family members (IL-1β, IL-6, IL-8, and IL-10).

[0026] The beneficial effects of the present invention are as follows:

[0027] The present invention adopts molecular genetics methods. Through the homologous recombination technology mediated by the suicide plasmid pRE112 and the broad-host expression plasmid pBBR1-MCS-2 system, a wecA gene deletion strain (ΔwecA) and its complementary strain (CΔwecA) were successfully constructed to clarify the regulatory mechanism of the wecA gene on the virulence characteristics of Aeromonas dhakensis strain C160501. The wecA gene deletion strain and complementary strain constructed by the systematic experimental design of the present invention confirmed the multiple roles of the wecA gene in the virulence regulation of Aeromonas dhakensis C160501, especially its important functions in aspects such as LPS synthesis, host-pathogen interaction, and immune regulation. In particular, the wecA gene deletion strain can reduce the virulence of Caenorhabditis elegans and zebrafish, and produce a relative protection rate of 46.7%-55.6% against zebrafish. The present invention not only deepens the understanding of the virulence pathogenic mechanism of Aeromonas dhakensis wecA, but also provides potential targets for the development of new antibacterial strategies against Aeromonas dhakensis. Brief Description of the Drawings

[0028] Figure 1 PCR verification of the deletion mutant strain Note: M: DL 5,000bp Marker; 1: C160501 wild strain; 2, 3: ΔwecA deletion strain.

[0029] Figure 2 PCR verification of the genetic stability of the deletion mutant strain Note: M: DL 5,000bp Marker; 1: primary ΔwecA deletion strain; 2-10: passaged ΔwecA deletion strain; 11: C160501 wild strain.

[0030] Figure 3 PCR verification of the complementary strain Note: M: DL 5,000bp Marker; 1, 2: ΔwecA deletion strain; 3, 4: strain with complementary plasmid pBBR1MCS-2-ΔlacZα::wecA; 6: C160501 wild strain; 7: strain with empty plasmid pBBR1MCS-2.

[0031] Figure 4 PCR verification of the strain containing the empty vector Note: M: DL 5,000bp Marker; 1, 2: ΔwecA deletion strain; 3, 4, 7: strain with empty plasmid pBBR1MCS-2; 6: ΔwecA + pBBR1MCS-2 strain.

[0032] Figure 5 Summary graph of the growth curves of each strain.

[0033] Figure 6 Results of the minimum inhibitory concentration detection of polymyxin B

[0034] Figure 7 Changes in protease activity of each strain.

[0035] Figure 8 Changes in hemolytic activity of each strain.

[0036] Figure 9 Changes in motility of each strain.

[0037] Figure 10 Observation of flagella by transmission electron microscopy. Note: Red arrows indicate flagella, and the scale bar represents 2 μm.

[0038] Figure 11 Relative expression levels of flagella-related genes.

[0039] Figure 12 Sensitivity of each strain to hydrogen peroxide.

[0040] Figure 13 Changes in the biofilm-forming ability of each strain

[0041] Figure 14 Results of CLSM observation. Note: FITC green fluorescence signal, PI red fluorescence signal (scale bar 20 μm).

[0042] Figure 15 Sensitivity of each strain to crocodile-derived antimicrobial peptides.

[0043] Figure 16 Adhesion ability of each strain to EPC cells.

[0044] Figure 17 Cytotoxicity of each strain to EPC.

[0045] Figure 18 Virulence of each strain to Caenorhabditis elegans.

[0046] Figure 19 Survival curve of zebrafish.

[0047] Figure 20 Results of qPCR analysis of zebrafish intestinal tissues after immunization. Detailed implementation manners

[0048] To illustrate the present invention more clearly, the present invention will be further described in detail below in conjunction with examples and with reference to the accompanying drawings.

[0049] Examples

[0050] I. Experimental materials

[0051] 1. Strains and plasmids: The wild strain of Aeromonas dhakensis C160501 (A. dhakensis C160501, also known as Aeromonas dhakensis C4-1, abbreviated as C4-1 in the figures) used in this application was isolated from farmed Siamese crocodiles in Hainan Province, and is recorded in the literature (Pu, W., G. Guo, N. Yang, Q. Li, F. Yin, P. Wang, J. Zheng, and J. Zeng. "Three Species of Aeromonas (A. Dhakensis, A. Hydrophila and A. Jandaei) Isolated from Freshwater Crocodiles (Crocodylus Siamensis) with Pneumonia and Septicemia." Lett Appl Microbiol 68, no. 3 (2019): 212-18.), isolated and preserved by this laboratory. A certificate for the release of biological materials to the public has been submitted in the patent application CN202410970620.1, Mutant Strains and Complemented Strains with Deletion of the Surface Polysaccharide Synthesis Gene of Aeromonas dhakensis, and Their Construction Methods and Applications. E. coli WM3064 (auxotrophic strain, resistant to DAP); E. coli ATCC25922 (drug sensitivity, extracellular protease quality control strain); pRE112 suicide plasmid (E. coli suicide plasmid, sacB, resistant to Cm); pBBR1MCS-2 (broad-host shuttle plasmid, constitutive, low-copy, resistant to Km).

[0052] The plasmids constructed in the present invention are as follows:

[0053] pRE112-ΔwecA: Inserted with homologous arms upstream and downstream of wecA, resistant to Cm;

[0054] ΔwecA: The wecA gene was knocked out in C160501;

[0055] C4-1-pBBR1MCS-2: C160501 inserted with an empty plasmid, resistant to Km;

[0056] ΔwecA-pBBR1MCS-2: ΔwecA inserted with an empty plasmid, resistant to Km;

[0057] pBBR1MCS-2-ΔlacZα::wecA: Replaced lacZα with wecA, resistant to Km;

[0058] CΔwecA: The wecA gene was complemented in ΔwecA, resistant to Km.

[0059] 2. Main reagents: 2×Phanta Max Master Mix, 2×F8 Fast PCR Master Mix, 2×A8 Fast PCR Master Mix, FastPure DNA Extraction Kit, FastPure Plasmid Maxi Kit, bacterial genomic DNA extraction kit, bacterial plasmid extraction kit, and PCR product purification kit are all from Novoprotein (Nanjing) Biotech Co., Ltd.; the super competent cell preparation kit is from Sangon Biotech (Shanghai) Co., Ltd.

[0060] 3. Primers: The primers used in this experiment were designed based on the complete genome sequence of Aeromonas dhakensis C160501 and in combination with the literature, using Snapgene (version 6.0.2) and Primer Premier 6.0, and were synthesized by Beijing Tsingke Biotechnology Co., Ltd., Hainan Branch, as shown in Table 1.

[0061] Table 1. Primers used in this application

[0062]

[0063]

[0064] 4. Experimental animals and cells

[0065] Epithelioma Papulosum Cyprinid (EPC) cells were provided by Teacher Li Xuesong of the Infection and Immunity Laboratory of the School of Life and Health Sciences, Hainan University. The experimental animals used in this invention, zebrafish, were purchased from an aquarium in Haikou City and were raised in a circulating water system at 28 - 29 °C according to the Wester method (Westerfield M. The zebrafish book: a guide for the laboratory use of zebrafish (Brachydanio rerio) [M]. Eugene, University of Oregon Press, 1995: 66 - 122.) for 14 days. After stable survival and no detection of specific immunoglobulin M (IgM) antibodies against Aeromonas dhakensis in the zebrafish serum, subsequent experiments were carried out.

[0066] II. Experimental methods

[0067] 1. Extraction of the genome of Aeromonas dhakensis C160501

[0068] Take the wild strain of Aeromonas dhakensis C160501 stored in a -80°C low-temperature refrigerator, inoculate it on an agar culture plate using the quadrant streaking method, place it in a 37°C incubator for overnight culture, then pick a single colony for colony PCR, and continue culturing after correct identification. Inoculate the activated and identified wild strain of Aeromonas dhakensis C160501 into LB liquid medium, culture it overnight at 37°C, select the bacterial DNA extraction kit from Novoprotein to extract the bacterial DNA and measure its concentration.

[0069] 2. Construction of the wecA gene deletion strain

[0070] 1) Amplification of upstream and downstream homologous arms: Perform PCR amplification using the extracted C160501 genome as a template. The primers used for amplifying the upstream and downstream homologous arms of the wecA gene are wecA-up-F / R and wecA-down-F / R respectively. After the PCR reaction, use 1% agarose gel electrophoresis to detect the amplification products of the upstream and downstream homologous arms, and confirm whether the product size is consistent with the expected value through a gel imaging system. If they are consistent, use a DNA purification kit to purify the product and measure its concentration.

[0071] 2) Reverse amplification of the pRE112 plasmid: Use a plasmid extraction kit to extract pRE112 plasmid DNA, and perform PCR amplification using the primers reverse pRE112-F / R to linearize the plasmid.

[0072] 3) Recombination reaction (seamless cloning): Refer to the instructions of the Universal One Step Cloning Kit to perform a multi-fragment recombination reaction (in a PCR instrument, react at 50°C for 20 min). Use Hieff Universal Enzyme Premix to ligate the pRE112 plasmid with the wecA upstream and downstream homologous arm fragments to construct the recombinant suicide plasmid pRE112-ΔwecA.

[0073] Mix the recombinant reaction product with E. coli WM3064 competent cells in a centrifuge tube, gently pipette and mix well, then incubate on ice for 30 min. Subsequently, place the centrifuge tube in a 42°C water bath for heat shock for 90 s, and immediately transfer it to ice for cooling for 3 min. Then, add 900 μL of fresh LB liquid medium, place it in a 37°C constant temperature shaker for culturing for 1 h. After incubation, aspirate 100 μL of the cultured bacterial liquid, and spread it on LB agar medium containing Cm (50 μg / mL) and DAP (25 μg / mL) according to three different high and low concentration gradients, and invert it and place it in a 37°C incubator for overnight culture.

[0074] The next day, a sterile inoculation loop was used to pick positive clone colonies for colony PCR verification. The outer primers pRE112 verification-F / R of the inserted fragment on the plasmid were used to perform PCR identification on the recombinant transformants (1% agarose gel electrophoresis). The colony PCR products were analyzed by 1% agarose gel electrophoresis, and a gel imaging system was used to confirm whether the product size was as expected. If they were consistent, the PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. in Hainan for sequencing, and then the successfully recombinant plasmid pRE112-ΔwecA was extracted in large quantities. At the same time, the bacterial liquid of the strain with correct sequencing results was added to a cryotube and stored at -80 °C.

[0075] 4) Conjugal transfer: After activating the donor strain WM3064 (pRE112-ΔwecA) and the wild strain C160501, 50 μL of each was taken and inoculated into LB liquid medium, and cultured with shaking at 37 °C and 180 rpm until OD 600 ≈0.5 or so. 3×2 mL of WM3064 (pRE112-ΔwecA) and 1×2 mL of C160501 bacterial liquid were respectively pipetted into 2 mL centrifuge tubes, and the cell pellets were collected by centrifugation at 5000 rpm for 5 min. The cell pellets of WM3064 (pRE112-ΔwecA) and C160501 were resuspended with 1 mL of fresh LB liquid medium, and this step was repeated twice to ensure thorough mixing. The resuspended liquid was dropped onto an LB agar plate containing DAP (25 μg / mL), and after the liquid was absorbed, it was cultured overnight in a 37 °C incubator. The next day, an appropriate amount of fresh LB liquid medium was added dropwise to the plate, and the cells were scraped and collected with an inoculation loop. After the bacterial liquid was shaken and mixed to wash away DAP, 100 μL of the bacterial liquid was pipetted and spread on an LB agar medium containing Cm (50 μg / mL) at three different high and low concentrations, and it was inverted and cultured overnight at 37 °C.

[0076] 5) Screening of deletion mutants: An inoculation loop was used to pick single colonies on the LB plate (containing Cm), spotted on an LB plate containing chloramphenicol, and streaked on a 20% sucrose plate (cultured overnight at 30 °C). The LB plate was placed in an incubator at 37 °C overnight and stored in a 4 °C refrigerator for standby: If the corresponding gene deletion mutants were not screened out from the sucrose plate, they could be streaked again on the sucrose plate. Single colonies were picked, and the ΔwecA verification-F / R pair was used to perform PCR identification on the strains (1% agarose gel electrophoresis). After the gene deletion mutants were screened, the remaining bacterial liquid was spread on an LB agar medium (purification to avoid contamination with trace amounts of wild-type strains in the single colonies), and single colonies were selected again for PCR identification, and this step was repeated twice. The purified strains were streaked on an LB plate and cultured overnight at 37 °C. Single colonies were picked and verified with the ΔwecA verification-F / R pair and sent for sequencing. The strains with correct verification results were stored in an ultra-low temperature refrigerator at -80 °C.

[0077] 3. Genetic stability detection of wecA gene deletion mutants

[0078] The Aeromonas dhakensis ΔwecA deletion strain was inoculated into a shaking culture tube. After culturing at 37 °C for 12 h, 100 μL was taken and inoculated into fresh LB liquid medium, and it was blindly passaged continuously for 30 generations.

[0079] 4. Construction of the wecA gene complemented strain

[0080] 1) Amplification of the wecA gene fragment: The extracted C160501 genome was used as a template for PCR amplification. The primers used for the amplification of the wecA gene fragment were seamless wecA-F / R. After the PCR reaction was completed, 1% agarose gel electrophoresis was used to detect the amplification product, and the gel imaging system was used to confirm whether the product size was consistent with the expectation. If they were consistent, the DNA purification kit was used to purify the product and determine its concentration.

[0081] 2) Reverse amplification of the pBBR1MCS-2 plasmid: The pBBR1MCS-2 plasmid DNA was extracted using a plasmid extraction kit, and PCR amplification was performed using the primers reverse pBBR1MCS-2-F / R to linearize the plasmid.

[0082] 3) Recombination reaction (seamless cloning): Refer to the instructions of the Universal One Step Cloning Kit for the multi-fragment recombination reaction (in a PCR instrument, react at 50 °C for 20 min). Use Hieff Universal Enzyme Premix to ligate the pBBR1MCS-2 plasmid with the wecA gene fragment to construct the complemented plasmid pBBR1MCS-2-ΔlacZα::wecA.

[0083] 4) Mix the recombination reaction product with competent E. coli WM3064 cells in a centrifuge tube, gently pipette and mix well, and then incubate on ice for 30 min. Subsequently, place the centrifuge tube in a 42 °C water bath for heat shock for 90 s, and immediately transfer it to ice for cooling for 3 min. Then, add 900 μL of fresh LB liquid medium, place it in a 37 °C constant temperature shaking incubator for 1 h. After incubation, 100 μL of the cultured bacterial solution was spread on LB agar medium containing Kan (50 μg / mL) and DAP (25 μg / mL) at three different high and low concentrations, and it was placed upside down and cultured overnight at 37 °C.

[0084] The next day, use a sterile inoculation loop to pick positive clone colonies for colony PCR verification. Use the outer primers pBBR1MCS-2-F / R of the inserted fragment on the plasmid to perform PCR identification on the recombinant transformants (1% agarose gel electrophoresis). The products obtained from colony PCR are subjected to electrophoresis detection on a 1% agarose gel, and the size of the PCR products is detected by a gel imaging system to see if it is consistent with the expected size. If consistent, the PCR products can be sent to Sangon Biotech (Shanghai) Co., Ltd. in Hainan to complete sequencing and other matters, and then extract a large amount of the successfully recombinant plasmid pBBR1MCS-2-ΔlacZα::wecA. At the same time, add the bacterial liquid of the strain with correct sequencing results to a cryotube and store it at -80 °C.

[0085] 5) Conjugal transfer: After activating the donor strain WM3064(pBBR1MCS-2-ΔlacZα::wecA) and the wild strain C160501, take 50 μL of each and inoculate them into LB liquid medium, and shake culture at 37 °C and 180 rpm until OD 600 ≈0.5 or so. Respectively pipette 3 × 2 mL of WM3064(pBBR1MCS-2-ΔlacZα::wecA) and 1 × 2 mL of C160501 bacterial liquid into 2 mL centrifuge tubes, and centrifuge at 5000 rpm for 5 min to collect the bacterial cell precipitate. Resuspend the bacterial cell precipitates of WM3064(pBBR1MCS-2-ΔlacZα::wecA) and C160501 with 1 mL of fresh LB liquid medium, and repeat this step twice to ensure thorough mixing. Drop them onto an LB agar plate containing DAP (25 μg / mL), and after it is completely absorbed, place it upright in a 37 °C incubator and culture for 12 h. The next day, add an appropriate amount of fresh LB liquid medium to the plate, scrape the bacterial cells with an inoculation loop and collect them. After shaking and mixing the bacterial liquid to wash away DAP, pipette 100 μL of the bacterial liquid and spread it on an LB agar medium containing Kan (50 μg / mL) at three different high and low concentrations, and place it upside down in a 37 °C incubator overnight.

[0086] 6) Screening of the complemented strain: Pick single colonies for PCR identification (1% agarose gel electrophoresis). After screening for gene complemented strains, spread the remaining bacterial liquid on LB agar medium (purification to avoid mixing trace amounts of wild-type strains in the single colonies), pick single colonies again for PCR identification, and repeat this step twice. Streak the purified strains on an LB plate and culture them overnight at 37 °C. Pick single colonies and use the outer primers pBBR1MCS-2 verification-F / R of the inserted fragment on the plasmid and wecA verification-F / R to verify the strains and send them for sequencing. Store the strains with correct verification results in a -80 °C ultra-low temperature refrigerator.

[0087] 5. Construction of the strain containing the empty vector

[0088] After conjugating ΔwecA with E. coli WM3064 carrying the pBBR1MCS plasmid, a strain containing the empty plasmid was obtained.

[0089] 6. Determination of strain growth curve

[0090] After activating and preserving the revived Aeromonas dhakensis C160501, ΔwecA, CΔwecA, C4-1-pBBR1MCS-2, and ΔwecA-pBBR1MCS-2, they were cultured until the logarithmic growth phase (OD 600 ≈0.5 or so), and the bacterial solutions were respectively added to 200 μL of fresh LB liquid medium (in a 96-well plate) at a ratio of 1%, with three parallels in each group. The blank control was not inoculated with bacteria. At 37 °C and 180 rpm, the OD of the bacterial solution was detected every 1 h using a microplate reader. 600 Taking the absorbance as the abscissa and the culture time as the ordinate, the average value of the three groups of data was taken to draw the growth curve.

[0091] 7. Detection of the minimum inhibitory concentration of polymyxin B

[0092] After activating and preserving the revived Aeromonas dhakensis C160501, ΔwecA, and CΔwecA, they were inoculated into MH liquid medium and cultured at 37 °C and 180 rpm until the logarithmic growth phase. The OD was adjusted 600 to 0.5 and then diluted 100 times. 100 μL of the bacterial solution was placed in a 96-well plate. Different concentrations of polymyxin B at 0, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 μg / mL were respectively placed in the 96-well plate by column and mixed with the bacterial solution. After being placed in a 37 °C constant temperature incubator and incubated statically overnight, the results were observed and recorded.

[0093] 8. Determination of protease activity

[0094] After activating and preserving the revived Aeromonas dhakensis C160501, ΔwecA, CΔwecA, C4-1-pBBR1MCS-2, and ΔwecA-pBBR1MCS-2, they were cultured until the logarithmic growth phase (OD 600 ≈0.5 or so). Using a pipette, 3 μL of the bacterial solution was gently spotted on the protease activity detection medium. The plate was placed upright for half an hour to completely solidify, and then placed in a 37 °C constant temperature incubator and cultured upright for 24 h. The colony diffusion diameter was measured, and the average value was taken for three repetitions.

[0095] 9. Determination of hemolytic activity

[0096] After activating and preserving the revived Aeromonas dhakensis C160501, ΔwecA, and CΔwecA, they were cultured until the logarithmic growth phase (OD 600Approximately around 0.5), use a pipette to gently spot 3 μL of the bacterial solution on a sterile sheep blood agar plate. Keep the plate upright for half an hour to allow it to fully solidify, and then place it in a 37°C constant temperature incubator and incubate it upright for 24 h. Measure the colony diffusion diameter and take the average value from three replicates.

[0097] 10. Motility detection

[0098] After activating and preserving the Aeromonas dhakensis C160501, ΔwecA, and CΔwecA strains respectively, culture them until the logarithmic growth phase (OD 600 Approximately around 0.5), use a pipette to gently spot 3 μL of the bacterial solution on 0.3% TSA (swimming ability detection) and 0.5% TSA (swarming ability detection) solid media. Keep the plate upright for half an hour to allow it to fully solidify, and then place it in a 37°C constant temperature incubator and incubate it upright for 24 h. Measure the colony diffusion diameter and take the average value from three replicates.

[0099] 11. Transmission electron microscopy (TEM)

[0100] To explore the effect of the wecA gene on flagella formation in Aeromonas dhakensis C160501, streak the strain on an LB solid medium. After being identified as the target strain by Nanshan Sequencing Company, use transmission electron microscopy to observe the flagella and cell morphology of the C160501 wild strain, ΔwecA deletion strain, and CΔwecA complemented strain. The experimental method refers to the reference (Kang Yuanhuan. Comparative proteomics and genomics analysis of different virulent strains of Aeromonas veronii and preliminary study on the functions of related genes [D]. Jilin. Jilin Agricultural University. 2017.).

[0101] 12. qRT-PCR detection of the expression level of flagella-related genes

[0102] To further analyze the effect of the wecA gene on flagella in Aeromonas dhakensis C160501, detect the expression changes of flagella-related genes in C160501 at the gene level by fluorescence quantitative PCR. The primers used are shown in Table 1.

[0103] 13. Hydrogen peroxide resistance detection

[0104] After activating and preserving the Aeromonas dhakensis C160501, ΔwecA, and CΔwecA strains respectively, culture them until the logarithmic growth phase (OD 600 Approximately around 0.5), spread 100 μL of the bacterial solution evenly on an LB solid plate. Then, stick a sterile paper sheet pre-soaked in H2O2 solution on the surface of the medium, place it in a 37°C constant temperature incubator and incubate it upside down for 24 h. Measure the colony diffusion diameter and take the average value from three replicates.

[0105] 14. Crystal violet staining method for detecting the formation of bacterial biofilms

[0106] After activating the revived and preserved Aeromonas dhakensis C160501, ΔwecA, and CΔwecA respectively, the crystal violet staining method was used. The bacterial liquid with an OD 600 value of approximately 0.5 was diluted 100 times. 200 μL was taken and added to a 96-well plate, and cultured at 37 °C for 24 h. After taking it out, the OD 600 value was measured, rinsed three times with PBS buffer, 100 μL of methanol was added to fix for 20 min, the methanol was discarded and air-dried. Subsequently, it was stained with crystal violet ammonium oxalate for 6 min, rinsed three times with PBS buffer and air-dried. 100 μL of 95% ethanol was added to each well, and after standing at room temperature for 30 min, the OD 600 value was measured, and the experiment was repeated three times.

[0107] 15. Detection of the formation of bacterial biofilms by laser confocal fluorescence microscopy

[0108] Take a confocal culture dish, add 2 mL of the diluted bacterial liquid to it, and place it in a constant temperature incubator at 37 °C for 24 h. After the culture is completed, gently rinse the culture dish three times with PBS buffer, add methanol solution to fix for 20 min, discard the methanol solution and air-dry. Add an appropriate amount of propidium iodide (PI) staining solution to stain for 25 min. After the staining is completed, rinse with PBS buffer; then stain with fluorescein isothiocyanate (FITC-ConA) for 30 min, and then rinse again with PBS buffer. Blot off the excess water with absorbent paper, and drop an appropriate amount of anti-fluorescence quenching mounting solution. Prepare the observation sample, use a laser confocal fluorescence microscope to observe the biofilm, receive green and red fluorescence signals at wavelengths of 488 nm and 535 nm respectively, after positioning the fluorescence signal through a 60× oil immersion lens, scan along the Z-axis from the free surface of the biofilm towards the attachment surface, and set the scanning thickness of each layer to 1 - 2 μm. After completing the image acquisition, use the NIS software to process the image, and finally obtain a three-dimensional image of the biofilm for subsequent analysis and research.

[0109] 16. Detection of antimicrobial peptide sensitivity

[0110] After activating the revived and preserved Aeromonas dhakensis C160501, ΔwecA, and CΔwecA respectively, the bacterial liquid was adjusted to an OD 600 value of approximately 0.5, and the antimicrobial peptide concentrations were diluted to 25 ng / mL, 50 ng / mL, 100 ng / mL, and 200 ng / mL respectively with ddH2O. Take 100 μL of the bacterial liquid and mix it with different concentrations of antimicrobial peptides in equal volume, and then add them to a 96-well plate. Set three parallel wells for each concentration. After incubating at 37 °C for 1 h, dilute the mixture 1000 times with ddH2O, spread it on an LB solid medium, and perform colony counting after overnight culture at 37 °C. The formula for calculating the bacterial survival rate is: the number of colonies in the sample / the number of colonies of the untreated strain.

[0111] 17. Detection of the adhesion ability of EPC cells

[0112] Pre-culture EPC cells in a 24-well cell culture plate using M199 cell culture medium. After overnight culture, discard the cell culture medium and wash away the non-adherent cells with M199 medium without antibiotics. After activating the Aeromonas dhakensis C160501, ΔwecA, and CΔwecA stored in resuscitation respectively, dilute the bacterial solution to an OD 600 value of about 0.5, and inoculate it into the 24-well cell culture plate at a ratio of 10:1 (bacteria: cells). Set three replicates for each group, and use PBS solution as a blank control. After culturing in a 37 °C cell incubator for 3 h, wash three times with PBS solution, add 1% Tritonx-100 and mix well to lyse the cells, and incubate at 37 °C for 45 min. Dilute the lysate to an appropriate concentration, coat it, and count. The adhesion is evaluated by the adhesion index: the total number of bacteria adhering to the cell surface / the number of cells.

[0113] 18. Detection of the cytotoxicity of bacteria on EPC cells by the CCK8 method

[0114] Co-culture 100 μL of bacterial solution with a concentration of 1×10 6 CFU / mL with EPC cells for 30 min, 1 h, and 2 h. Detect the cytotoxicity of different strains on EPC cells according to the instruction manual of the Solarbio CCK-8 cell cytotoxicity kit. The experiment is repeated three times.

[0115] 19. Virulence detection of Caenorhabditis elegans

[0116] After activating the Aeromonas dhakensis C160501, ΔwecA, and CΔwecA stored in resuscitation respectively, culture them until the logarithmic growth phase (OD 600 ≈0.5 or so). Take 100 μL of the bacterial suspension and spread it evenly on the NGM (Nematode Growth Medium) agar plate, and incubate it in a 37 °C constant temperature incubator for 12 h.

[0117] L1-stage nematode larvae were inoculated onto NGM plates containing OP50 Escherichia coli (E. coli OP50) for synchronization and cultured in a 20 °C incubator until the L4 stage or young adult stage. Subsequently, synchronized L4-stage nematodes were inoculated onto NGM plates coated with wild-type strains, gene knockout strains, and gene complementation strains. Each experiment used no less than 30 nematodes per group, and three biological replicates were set up. The NGM plate inoculated with OP50 E. coli was used as a negative control. The inoculated plates were placed in a 20 °C incubator for culture, and the survival status of the nematodes was observed regularly. The number of surviving nematodes was recorded every 24 h until all nematodes died, and the experiment ended (Kang Yuanhuan. Comparative proteomics and genomics analysis of different virulence strains of Aeromonas veronii and preliminary study on the functions of related genes [D]. Jilin. Jilin Agricultural University. 2017.).

[0118] 20. Detection of median lethal dose in zebrafish

[0119] The preserved Aeromonas dhakensis C160501, ΔwecA, and CΔwecA were resuscitated and activated. The overnight culture broth was centrifuged at 5000 rpm for 5 min, the supernatant was discarded, the precipitate was collected, washed with PBS, and serially diluted 10-fold. The diluted broth was stored in a 4 °C refrigerator for later use.

[0120] The experiment was divided into 25 treatment groups and 1 control group, with 10 zebrafish in each group. Each fish was intraperitoneally injected with 10 μL of the diluted bacterial solution, and the control group was injected with an equal volume of PBS. The health status of the zebrafish was observed daily and the number of deaths was recorded for 7 consecutive days. Finally, the median lethal dose (LD 50 ) was calculated.

[0121] 21. Immunoprotection analysis in zebrafish

[0122] The cell pellet of the deletion strain was collected by centrifugation, washed with PBS solution and diluted to 1×10 7 CFU / mL. There were 40 zebrafish in each group, 5 experimental groups and 1 control group. The experimental groups were intraperitoneally injected with 10 μL of the bacterial solution, and the control group was injected with an equal volume of PBS solution.

[0123] On the 15th day after the first immunization, 10 μL of wild strain C160501 with a concentration of 1.6×10 8 CFU / mL was injected into the abdomen of healthy zebrafish. A second immunization was carried out 14 days after the first immunization. The number of dead zebrafish was recorded until the death situation stabilized, and the immunoprotection rate was statistically analyzed.

[0124] 22. qRT-PCR analysis of zebrafish intestinal tissue

[0125] The intestinal tissues of zebrafish at 24 h after the first immunization and the second immunization were selected for qRT-PCR analysis. The specific steps of RNA extraction, reverse transcription, and subsequent qPCR analysis are as follows:

[0126] ① Extract tissue RNA using RNAiso Kit (Vazyme), dissolve it in DEPC water, take a small amount and measure the concentration with BioDrop for quality control, aliquot it into RNase-Free centrifuge tubes, and store it at -80 °C for later use.

[0127] ② Take 2 μg of total RNA and use III 1st Strand cDNA Synthesis SuperMix for qPCR (Shanghai Yisheng Biotechnology Co., Ltd.) to synthesize the first strand of cDNA. Refer to the instructions for the specific reverse transcription steps, and store the obtained cDNA at -80 °C for later use.

[0128] ③ Using gadpH as the internal reference gene, analyze the relative expression levels of immune-related genes (IgM, mucin-2, IL-1β, IL-6, IL-8, IL-10, TNF-α, and MyD88) by qPCR. The required primer sequences are shown in Table 2.

[0129] Table 2. Primers required for qPCR analysis of immune-related genes

[0130]

[0131] ④ Use Green Master Mix (No Rox) reagent for qPCR reaction. The specific reaction system is shown in Table 3. Place the prepared reaction system in CFX96 Real-Time PCR Detection (Bio-Rad) and run it according to the program shown in Table 4.

[0132] Table 3. qPCR reaction system

[0133]

[0134] Table 4. qPCR reaction program

[0135]

[0136]

[0137] ⑤ After the qPCR experimental data collection is completed, input the CT values into Excel software for preliminary sorting. Use the 2 -ΔΔCt algorithm to quantitatively analyze the expression levels of immune-related genes, so as to obtain the relative expression level data of the target genes.

[0138] 23. Data Statistics and Analysis

[0139] The LD of the strains was calculated using SPSS 10 software 50 values, and data statistics and visualization analysis were performed using GraphPad Prism software. One-way analysis of variance (ANOVA) and Tukey's test were used to determine the differences between groups, and a p-value < 0.05 indicated statistically significant differences.

[0140] III. Experimental Results and Analysis

[0141] 1. Construction of Tool Strains

[0142] 1.1 Construction of the wecA Gene Deletion Strain

[0143] The ΔwecA gene deletion strain was verified by PCR using the primer pair ΔwecA verification-F / R. As Figure 1 shown, the amplified fragment size using the genomic DNA of wild-type Aeromonas dhakensis as a template was 2,081 bp (lane 1), and the amplified fragment size of the PCR product of the ΔwecA deletion strain was 1,289 bp (lanes 2 and 3), which was consistent with the expected fragment size, and the construction of the ΔwecA Aeromonas dhakensis was completed.

[0144] 1.2 Detection of the Genetic Stability of the wecA Gene Deletion Strain

[0145] To detect whether the genetic characteristics of the ΔwecA gene deletion strain were stable, the present invention performed PCR verification on the strains blindly passaged continuously for 30 generations. Nine monoclonal isolates were randomly selected and PCR amplification was performed using the primer pair ΔwecA verification-F / R. As Figure 2 shown, specific bands of 1,289 bp were stably amplified in each generation of the strains, and the sizes of the PCR products of all the tested strains were consistent with the expected results. These results indicated that the ΔwecA gene deletion strain could maintain stable genetic characteristics during continuous passage and could be used for subsequent experimental studies.

[0146] 1.3 Construction of the wecA Gene Complemented Strain

[0147] Genotype identification of the CΔwecA complemented strain was performed by double PCR verification. The genome was amplified using the ΔwecA verification-F / R primers, and at the same time, the plasmid insertion fragment was verified using the pBBR1MCS-2 verification-F / R primers. As Figure 3As shown, a 1,271-bp ΔwecA deletion fragment was amplified in lanes 1-2, a 2,240-bp plasmid insertion fragment was obtained in lanes 3-4, a 2,657-bp wild-type fragment was amplified using the wild strain as a template in lane 6, and a 969-bp plasmid backbone fragment was obtained in lane 7. All the amplified products were consistent with the expected sizes. These results indicate that the CΔwecA complemented strain has been successfully constructed and the plasmid has been stably integrated into the genome.

[0148] 1.4 Construction of the strain containing the empty vector

[0149] The transformants were screened and identified using the pBBR1MCS-2 verification - F / R primer pair. As Figure 4 shown, through PCR amplification and agarose gel electrophoresis analysis, the ΔwecA Aeromonas dhakensis transformants containing the pBBR1MCS-2 empty plasmid were successfully screened. The positive clones were verified by sequencing, confirming that the plasmid was intact and correctly inserted.

[0150] 2. The deletion of the wecA gene has no significant effect on the bacterial growth rate

[0151] The results of the growth curve analysis are as Figure 5 shown. Compared with the wild strain C160501, there were no significant differences in the growth curves of all the experimental strains (P>0.05). This result indicates that the deletion of the wecA gene has no significant effect on the growth kinetics of Aeromonas dhakensis C160501, suggesting that the wecA gene may not be directly involved in regulating the basic metabolism or growth and reproduction process of the bacteria.

[0152] 3. The deletion of the wecA gene leads to increased sensitivity of the bacteria to polymyxin B

[0153] As Figure 6 shown, compared with the wild strain C160501, the ΔwecA deletion strain showed significantly enhanced sensitivity to polymyxin B (P≤0.0001). This result indicates that the deletion of the wecA gene has a significant effect on the structural integrity of the lipopolysaccharide of Aeromonas dhakensis, further confirming the function of the wecA gene encoding N-acetylglucosamine-1-phosphate transferase in Aeromonas dhakensis and its direct participation in the LPS biosynthesis process. This finding provides an important experimental basis for further understanding the role of the wecA gene in maintaining the bacterial outer membrane structure and regulating antibiotic sensitivity.

[0154] 4. The deletion of the wecA gene has no significant effect on the protease activity of the bacteria

[0155] As Figure 7As shown, there was no significant difference in protease activity between the ΔwecA deletion strain and the wild-type strain C160501 (p > 0.05). Through gene complementation experiments, it was found that there was no statistically significant change in protease activity in either the wecA gene complemented strain or the empty vector transformed strain (p > 0.05). Given that two previous independent experiments had confirmed that empty vector transformation had no significant effect on the strain phenotype, an empty vector transformation control group would not be set up in subsequent experiments.

[0156] 5. Deletion of the wecA gene leads to a significant increase in bacterial hemolytic activity

[0157] Hemolysis results showed ( Figure 8 ), compared with the wild-type strain C160501, the diameter of the hemolytic zone of the ΔwecA deletion strain was significantly increased (P ≤ 0.001). This experimental result indicates that the deletion of the wecA gene can significantly increase the hemolytic activity of Aeromonas dhakensis. In addition, the complemented strain had no significant effect on the hemolytic activity of the strain.

[0158] 6. Deletion of the wecA gene leads to a significant enhancement of bacterial swimming ability

[0159] Statistical results are shown in Figure 9 , C160501, ΔwecA, and CΔwecA could all form swimming rings, but there were no significant differences. In the swimming assay, the deletion of the wecA gene significantly enhanced the swimming ability of Aeromonas dhakensis (P ≤ 0.01). In addition, the complemented gene had no significant effect on the swimming and motility abilities of the strain. It can be seen that the deletion of the wecA gene affects the motility of Aeromonas dhakensis.

[0160] 7. Deletion of the wecA gene has no significant effect on the bacterial flagellar morphology

[0161] Figure 10 Electron microscopy analysis showed that the wild-type strain C160501 had a typical single polar flagellum structure, the measured diameter of the flagellum was 16.2 ± 1.4 nm (n = 30), and the length distribution range was 1.3 - 3.1 μm. The flagellar morphology integrity of the ΔwecA deletion strain was highly consistent with that of the wild-type strain (p > 0.05), and there were no significant differences in the diameter (16.1 ± 1.3 nm) and length (1.3 - 3.1 μm) parameters; the flagellar structure parameters of the CΔwecA complemented strain were completely restored.

[0162] 8. Deletion of the wecA gene leads to an up-regulation of the transcriptional level of bacterial flagellar-related genes

[0163] The results showed that compared with the wild-type strain, the expression levels of flagellar-related genes (including fliA, fliC, fliS, fliK, fliL, and cheV) in the ΔwecA gene deletion strain showed a significant upward trend ( Figure 11)。It shows that the wecA gene plays a key role in the expression regulation of flagella-related genes.

[0164] 9. Deletion of the wecA gene leads to a significant increase in the tolerance of bacteria to hydrogen peroxide

[0165] The statistical results are shown in Figure 12 . It was found that the resistance of the bacteria to hydrogen peroxide was significantly enhanced after the deletion of the wecA gene (P≤0.05), indicating that the ΔwecA deletion strain has a significantly enhanced ability to cope with oxidative stress.

[0166] 10. Deletion of the wecA gene has no significant effect on the ability of bacteria to form biofilms

[0167] ① The results of the crystal violet method are shown in Figure 13 . There was no significant difference between the ΔwecA deletion strain, the CΔwecA complemented strain and the wild strain C160501 (P>0.05). The deletion of the wecA gene has no effect on the ability of Aeromonas dhakensis to form biofilms.

[0168] ② The results of observation by laser confocal fluorescence microscopy are shown in Figure 14 . It was observed that the biofilms of the ΔwecA deletion strain, the CΔwecA complemented strain and the wild strain C160501 showed FITC-ConA and PI signals of the same intensity (scale bar 20 μm). This result is consistent with the Figure 13 biofilm results shown.

[0169] 11. Deletion of the wecA gene has no significant effect on the sensitivity of bacteria to antimicrobial peptides

[0170] Drug sensitivity tests were performed on each strain using the crocodile-derived antimicrobial peptides Leucrocin I and Leucrocin II. As Figure 15 shown, there was no significant difference in the sensitivity of the ΔwecA deletion strain and the CΔwecA complemented strain to the two antimicrobial peptides compared with the wild strain C160501 (P>0.05). This result shows that the deletion of the wecA gene does not change the sensitivity of Aeromonas dhakensis to crocodile-derived antimicrobial peptides.

[0171] 12. Deletion of the wecA gene leads to a significant decrease in the adhesion rate of bacteria to EPC cells

[0172] The results are shown in Figure 16 . The adhesion rate of the ΔwecA deletion strain was significantly lower than that of the wild strain C160501 (P≤0.0001), and the adhesion rate of the complemented strain was the same as that of the wild strain C160501, indicating that the deletion of the wecA gene affects its adhesion ability.

[0173] 13. Deletion of the wecA gene leads to a decrease in the cytotoxicity of bacteria to EPC cells

[0174] The results showed that, compared with the wild strain C160501, the ΔwecA deletion strain exhibited weaker cytotoxicity (P≤0.01), while the cytotoxicity of the CΔwecA complemented strain was basically the same as that of the wild strain ( Figure 17 ). It indicated that the wecA gene played an important role in regulating the cytotoxicity of Aeromonas dhakensis.

[0175] 14. Deletion of the wecA gene led to an increase in the survival rate of Caenorhabditis elegans

[0176] The average lifespan of the ΔwecA deletion strain (16.32±0.21 days) was higher than that of the wild strain (10.70±0.21 days) and the complemented strain (12.19±0.20 days), while the lifespan of all Aeromonas dhakensis strains was shorter than that of the OP50 strain (17.94±0.19 days) ( Figure 18 ). The knockout of the wecA gene significantly increased the survival rate of Caenorhabditis elegans.

[0177] 15. Deletion of the wecA gene led to a decrease in the pathogenicity of bacteria to zebrafish

[0178] To explore the effect of wecA gene deletion on the pathogenicity of Aeromonas dhakensis, this experiment used the zebrafish model to carry out the median lethal dose (LD 50 ) determination experiment. The experimental results showed (Table 5) that the LD 50 values of the C160501 wild strain and the ΔwecA deletion strain were 4.8×10 7 CFU / mL and 1.11×10 8 CFU / mL, respectively. By comparison, it was found that the virulence of the ΔwecA deletion strain was lower than that of the wild-type strain. This finding confirmed that the deletion of the wecA gene could affect the virulence of Aeromonas dhakensis, suggesting that this gene might play an important role in the bacterial pathogenic mechanism. However, the molecular mechanism and signal pathway of the wecA gene regulating virulence still need to be further explored through molecular biology techniques such as transcriptomics and proteomics.

[0179] Table 5. Determination of median lethal dose

[0180]

[0181] 16. Deletion of the wecA gene enhanced the protective effect of bacteria in the zebrafish immune protection test

[0182] The experimental results are shown in Table 6. The ΔwecA deletion strain showed significant immunoprotective effects in the zebrafish immunoprotection experiment, and its relative protection rates reached 46.7% and 55.6% respectively. Especially during the secondary immunization process, the protective effect of this strain was more significant, indicating its potential research value as a candidate live attenuated vaccine. This result confirmed that the deletion of the wecA gene might lead to changes in the immunogenicity of Aeromonas dhakensis, thus having a positive impact on immunoprotection. However, its specific mechanism of action and molecular basis still need to be further studied and systematically elucidated through additional experiments.

[0183] Table 6. Zebrafish Immunoprotection Test

[0184]

[0185] Note: (I) First immunization; (II) Second immunization.

[0186] The survival curve of zebrafish in this experiment is as Figure 19 .

[0187] 17. Deletion of the wecA gene results in significant upregulation of the expression of multiple immune-related genes in bacteria

[0188] As Figure 20 shown, in the primary immunization experiment, compared with the wild-type strain C160501-infected group, the host immune-related gene expression profiles in the ΔwecA deletion strain-infected group showed significant differences. Specifically, the mRNA expression levels of immunoglobulin M (IgM) and intestinal mucin-2 were significantly upregulated, while the expression of other detected genes was downregulated to varying degrees. In the secondary immunization experiment, the ΔwecA deletion strain-infected group showed more significant immune activation characteristics: in addition to the continuous upregulation of IgM and mucin-2, the mRNA expression levels of tumor necrosis factor-α (TNF-α), myeloid differentiation factor 88 (MyD88), and interleukin family genes (IL-1β, IL-6, IL-8, IL-10) were all significantly upregulated, and the upregulation amplitude was more than twice that of the primary immunization experiment. This gene expression profile is highly consistent with the results of the zebrafish immunoprotection experiment in "16. Deletion of the wecA gene enhances the protective effect of bacteria in the zebrafish immunoprotection test" in the previous section, further confirming that the deletion of the wecA gene can significantly enhance the host immune response.

[0189] The N-acetylglucosamine-1-phosphate transferase encoded by the wecA gene is an enzyme that is ubiquitous in eukaryotes and prokaryotes and belongs to the polyisoprenyl phosphate-N-acetylhexosamine-1-phosphate transferase family (Jin Yue. Functional study of the wecA gene in Mycobacterium [D]. Dalian. Dalian Medical University. 2010.). In Escherichia coli, this enzyme is involved in the biosynthesis of lipopolysaccharide (LPS), while in Mycobacterium, it acts on the construction of the cell wall. The wecA gene was first identified during the biosynthesis of the enterobacterial common antigen (ECA) in Escherichia coli. This gene not only plays an important role in this process but is also the initiating enzyme in the Wzy-dependent O-antigen synthesis pathway in Escherichia coli and Shigella. The wecA gene plays an important role in the synthesis of the O-antigen of lipopolysaccharide in a variety of enteric bacteria and is also involved in the generation of the enterobacterial common antigen. This enzyme has a relatively broad substrate specificity. For example, in Escherichia coli, it can catalyze the synthesis of Und-PP-N-acetylgalactosamine, and a similar reaction is used for the generation of the O8 antigen in Yersinia (Burns S, Hull S. Comparison of loss of serum resistance by defined lipopolysaccharide mutants and an acapsular mutant of uropathogenic Escherichia coli O75:K5 [J]. Infection and Immunity, 1998, 66(9):4244-53.). As the initiating enzyme for O-antigen biosynthesis, wecA catalyzes the first enzymatic reaction in O-antigen biosynthesis. Currently, there is sufficient biochemical and genetic data indicating that wecA can transfer the GleNAc-1-P (N-acetylglucosamine-1-phosphate) group from UDP-GlcNAc (UDP-N-acetylglucosamine) to Und-P, thereby forming Und-P-P-GlcNAc. This reaction product acts as a receptor, continuously receiving sugar groups, and thus completing the biosynthesis of the repeating subunits of O-antigen or enterobacterial common antigen (Rick P, Hubbard G, Barr K. Role of the rfe gene in the synthesis of the O8 antigen in Escherichia coli K-12 [J]. Journal of Bacteriology, 1994, 176(10):2877-84.).

[0190] The present invention uses molecular genetics methods and successfully constructs a wecA gene deletion strain (ΔwecA) and its complemented strain (CΔwecA) through homologous recombination technology mediated by the suicide plasmid pRE112 and the broad-host expression plasmid pBBR1-MCS-2 system to clarify the regulatory mechanism of the wecA gene on the virulence characteristics of Aeromonas dhakensis strain C160501. Biological characteristic analysis of the wild-type strain, ΔwecA, and CΔwecA of Aeromonas dhakensis C160501 found that the deletion of the ΔwecA gene had no obvious changes in the growth performance, protease activity, biofilm formation ability, and antimicrobial peptide sensitivity of Aeromonas dhakensis C160501, suggesting that the wecA gene may not directly participate in the regulation of these biological processes.

[0191] The wecA gene encodes N-acetylglucosamine-1-phosphate transferase, which plays a key catalytic role in the lipopolysaccharide (LPS) biosynthesis pathway and is responsible for transferring N-acetylglucosamine phosphate to the lipid carrier, thereby initiating the synthesis of the LPS core polysaccharide. Gene deletion leads to the interruption of the LPS synthesis pathway, resulting in an incomplete structure of the LPS layer in the bacterial outer membrane and further affecting its barrier function. Although the enzymatic function of the wecA gene was not directly verified in this invention, it was found through the determination of the minimum inhibitory concentration (MIC) of polymyxin B that the sensitivity of the ΔwecA deletion strain to polymyxin B was significantly enhanced compared with the wild-type strain. Given that the target of polymyxin B is the LPS structure, this result indirectly confirmed that the deletion of the wecA gene affected the LPS synthesis of Aeromonas dhakensis. In addition, the adhesion ability of the ΔwecA deletion strain to EPC cells was significantly reduced, which may be due to the abnormal LPS structure causing the exposure or conformational change of bacterial surface adhesion factors, thereby affecting its specific binding to the receptors on the surface of host cells. This finding was consistent with the results of the toxicity detection experiment on EPC cells. Compared with the wild-type strain, the toxic effect of the ΔwecA deletion strain on EPC cells was significantly weakened, further confirming the important role of the wecA gene in regulating bacterial virulence.

[0192] The motility of Aeromonas dhakensis mainly depends on the flagellar system, and its motility patterns can be divided into swarming and swimming. Swarming describes the collective migration of bacteria on solid substrates or in high-viscosity environments, while swimming refers to the autonomous movement behavior of individual bacteria in liquid or low-viscosity environments. The results of motility analysis experiments showed that the swarming ability of the ΔwecA deletion strain was significantly improved compared with that of the wild-type strain. The results of transmission electron microscopy experiments also showed that the morphological integrity of the flagella of the ΔwecA deletion strain was highly consistent with that of the wild strain. The deletion of the wecA gene had no effect on the flagellar structure of Aeromonas dhakensis, but the number of pili increased within the field of view. This phenomenon may be related to the changes in the cell wall structure caused by the deletion of the wecA gene, including changes in the fluidity and permeability of the cell membrane. These changes may promote the transport and assembly of motility-related factors such as flagellin, and at the same time reduce the resistance during bacterial movement, resulting in upregulation of flagella-related genes and an increase in the number of pili, and a significant increase in the swarming ability of bacteria. This result was verified in the detection of flagella-related genes. In the hemolytic activity experiment, the hemolytic activity of the ΔwecA deletion strain was significantly enhanced, which may be due to the exposure of hemolysis-related proteins or sites on the bacterial surface caused by changes in the LPS structure. These newly exposed sites can directly interact with host cells such as red blood cells to cause hemolysis, thus showing an increase in hemolytic ability. In addition, the ΔwecA deletion strain showed significantly enhanced resistance to hydrogen peroxide, indicating that the wecA gene plays an important role in regulating the oxidative stress response of bacteria.

[0193] The results of the nematode virulence experiment showed that knocking out the wecA gene significantly increased the survival rate of Caenorhabditis elegans in Aeromonas dhakensis infection. The results of the median lethal dose of zebrafish showed that the LD of the wecA gene deletion strain was lower than that of the wild strain C160501 50It increased by 2.31 times, indicating that the virulence of the ΔwecA deletion strain was weakened. In the immunoprotection test on zebrafish, ΔwecA showed relatively remarkable effects, and its relative protection rates could reach 46.7% and 55.6% respectively. Moreover, during the secondary immunization process, this protective effect was more significant. The qPCR analysis results of the zebrafish intestine 12 hours after immunization also showed that in the first immunization experiment, the mRNAs of the immune-related genes immunoglobulin (IgM) and intestinal mucin (mucin-2) of the ΔwecA deletion strain were up-regulated, but its inflammatory factors were all down-regulated. This indicates that the deletion of the wecA gene leads to abnormal LPS synthesis, weakening the virulence of the bacteria. LPS can activate the host's immune cells and trigger an inflammatory response. The blockage of its synthesis will reduce the pathogenic ability of the bacteria to the host, and it may not be able to trigger typical infection symptoms or the infection degree may be reduced after infecting the host. At the same time, the change in the LPS structure may affect the way and degree of the bacteria being recognized by the host's immune cells. On the one hand, the bacteria may be more easily recognized and cleared by immune cells; on the other hand, it may also lead to the bacteria being unable to effectively activate the host's immune response and affect the immune escape ability. In the second immunization experiment, all the immune-related genes of the ΔwecA deletion strain were up-regulated, indicating that the immune system was in a "pre-activated" state, enhancing the immune protection effect. These findings provide new insights into understanding the role of the wecA gene in the pathogenic mechanism of Aeromonas dhakensis.

[0194] In summary, through systematic experimental designs, the present invention reveals the multiple roles of the wecA gene in the virulence regulation of Aeromonas dhakensis C160501, especially its important functions in aspects such as LPS synthesis, host-pathogen interaction, and immune regulation. These findings not only deepen the understanding of the pathogenic mechanism of Aeromonas dhakensis but also provide potential targets for developing novel antibacterial strategies. However, the specific molecular mechanism of the wecA gene regulatory network still needs further research, especially the interaction relationship between it and other virulence factors is worthy of in-depth exploration. Future research can focus on the role of the wecA gene in the bacteria's adaptation to environmental stress and the molecular mechanism of its interaction with the host immune system, which will provide important theoretical basis for developing wecA gene-based vaccines or antibacterial drugs.

[0195] The above-mentioned embodiments of the present invention are merely examples for more clearly illustrating the present invention, rather than limitations on the implementation manners of the present invention. Any obvious changes or variations derived from the technical solutions of the present invention still fall within the protection scope of the present invention.

Claims

1. Method for constructing Aeromonas dhakensis wecA gene deletion strain, comprising: Construct the recombinant suicide plasmid of wecA gene by seamless cloning method pRE112-ΔwecA, conjugate the Aeromonas dhakensis strain with E. coli WM3064 containing pRE112-ΔwecA to obtain the wecA gene deletion strain ΔwecA.

2. The construction method according to claim 1, characterized in that Construct the recombinant suicide plasmid of wecA gene by seamless cloning method pRE112-ΔwecA also includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, and using wecA-up-F / R, two pairs of primers wecA-down-F / R to amplify the upstream and downstream homologous arms of the wecA gene respectively; extract the pRE112 plasmid DNA, and use the primers reverse pRE112-F / R for PCR amplification to linearize the plasmid; ligate the pRE112 plasmid with the wecA upstream and downstream homologous arm fragments to construct the recombinant suicide plasmid pRE112-ΔwecA; the primer sequences are as follows: wecA-up-F: TGGTCAAAGAGGAGGAGTATTCATCG, wecA-up-R: TCATGCACCGTCACCGTCATCTG; wecA-down-F: CAGCAACGGGGTTGTGAACTGGAA, wecA-down-R: GGAGTGCGCGACACTATGGTTGA; reverse pRE112-F: TCTAGAAGAAGCTTGGGATCGGGC, reverse pRE112-R: GAGCTCTCCCGGGAATTCATGC.

3. The Aeromonas dhakensis wecA gene deletion strain is obtained by the construction method described in claim 1 or 2.

4. Construction method of wecA gene complementation strain of Aeromonas dhakensis, comprising: Construct the wecA gene complementation plasmid by seamless cloning method pBBR1MCS-2-ΔlacZα::wecA, conjugate the Aeromonas dhakensis strain with E. coli WM3064 containing pBBR1MCS-2-ΔlacZα::wecA to obtain the wecA gene complementation strain CΔwecA.

5. The construction method according to claim 4, characterized in that, Construct the wecA gene complementation plasmid by seamless cloning method pBBR1MCS-2-ΔlacZα::wecA also includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, and using the primers seamless wecA-F / R to amplify the wecA gene fragment; extract the pBBR1MCS-2 plasmid DNA, and use the primers reverse pBBR1MCS-2-F / R for PCR amplification to linearize the plasmid; ligate the pBBR1MCS-2 plasmid with the wecA gene fragment to construct the complementation plasmid pBBR1MCS-2-ΔlacZα::wecA; the primer sequences are as follows: seamless wecA-F: TCACCGAGCAGGGATTCG, seamless wecA-R: GCGGATGGCTGACCAATACT; reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG, Reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT. The Aeromonas dhakensis wecA gene complemented strain is obtained by the construction method described in claim 4 or 5.

7. Application of deletion of wecA gene of Aeromonas dhakensis, including: Significantly enhance the sensitivity of the strain to polymyxin B, affect LPS synthesis, significantly enhance the hemolytic activity of the strain, significantly enhance the swimming ability of the strain, significantly up-regulate the transcriptional level of flagella-related genes, significantly enhance the resistance of the strain to hydrogen peroxide, significantly reduce the adhesion rate of the strain to EPC cells, and weaken the toxicity of the strain to EPC cells.

8. The application according to claim 7, wherein The application also includes: significantly increasing the survival rate of Caenorhabditis elegans under Aeromonas dhakensis infection.

9. The application according to claim 7, wherein The application also includes: reducing the pathogenicity of the strain to zebrafish and significantly enhancing the protective effect of the strain in the zebrafish immune protection test.

10. The application according to claim 9, characterized in that, The deletion of the Aeromonas dhakensis wecA gene can significantly up-regulate the expression of a variety of immune-related genes, including: immunoglobulin M, intestinal mucin 2, tumor necrosis factor α, myeloid differentiation factor 88, and interleukin family members.

Citation Information

Patent Citations

  • Mutant strain with deletion of polysaccharide synthesis gene on surface of Aeromonas dakara, complementary strain and construction method and application of mutant strain and complementary strain

    CN118879600A