Composition for detecting IDH1 mutation, detection reagent and application thereof

Abstract

The invention belongs to the technical field of detection reagent preparation, and particularly relates to a composition for detecting IDH1 mutation, a detection reagent and application of the composition and the detection reagent. The composition comprises a strand displacement probe and an auxiliary strand, the sequence of the strand displacement probe is shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the sequence of the auxiliary strand is shown as SEQ ID NO: 3. The composition can be used for realizing specific detection on IDH1 mutation (especially R132H mutation). Compared with an existing method, the detection method constructed based on the composition has the advantages that the sensitivity and the specificity are remarkably improved, and the detection limit can reach 0.1%.

Description

Technical Field

[0001] The present invention belongs to the technical field of preparation of detection reagents, and particularly relates to a composition for detecting IDH1 mutations, a detection reagent and its application. Background Art

[0002] In the field of precision diagnosis and treatment of neuro-oncology, the diagnosis and precision treatment of gliomas are important topics in neuro-oncology research. IDH1 gene mutation is a common and highly clinically significant biomarker in gliomas, which is closely related to the prognosis and treatment options of patients. Therefore, accurate detection of IDH1 mutations, especially the detection of specific loci (such as R132H), is of great significance for guiding individualized treatment.

[0003] Currently, polymerase chain reaction (PCR) is one of the most widely used methods in the field of nucleic acid detection and occupies an important position in clinical practice due to its high sensitivity and specificity. However, traditional PCR methods still have some technical challenges in detecting IDH1 mutations, specifically as follows: (1) Insufficient specificity: Even for high-fidelity PCR, non-specific amplification may still lead to false positive results. Especially when detecting samples with complex backgrounds, due to the limitations of primer design, PCR often fails to effectively distinguish similar sequences; (2) Limited detection sensitivity: For extremely low-abundance mutant DNA, traditional PCR detection methods are difficult to meet the requirements, especially in liquid biopsies for capturing rare mutant molecules; (3) Primer dimers and non-specific products: Even when optimizing reaction conditions, the interaction between primers may still affect the detection effect, thereby reducing the reliability of the detection.

[0004] To overcome the above problems, researchers have developed various strategies to improve the specificity and sensitivity of PCR detection, such as using TaqMan probes, molecular beacons, allele-specific PCR, probes with complex structures, etc. for detection. However, the detection limit of mutant abundance for these detection methods is 1% - 10%, which still cannot meet the requirements for more precise detection. Summary of the Invention

[0005] Based on this, the present invention has developed a composition for detecting IDH1 mutations, which can achieve specific detection of IDH1 mutations (especially R132H mutations). Compared with existing methods (such as allele-specific PCR), the detection method constructed based on the composition of the present invention has significantly improved sensitivity and specificity, and the detection limit can reach 0.1% (that is, when the mutant nucleic acid abundance is 0.1%, it can still be detected).

[0006] To achieve the above object, the present invention can adopt the following technical solutions: On the one hand, the present invention provides a composition for detecting IDH1 mutations. The composition includes a strand displacement probe and an auxiliary strand. The sequences of the strand displacement probe are as shown in SEQ ID NO:1 and SEQ ID NO:2, and the sequence of the auxiliary strand is as shown in SEQ ID NO:3.

[0007] Preferably, in the above composition, a fluorescence quenching group is connected to the 5' end of the strand displacement probe as shown in SEQ ID NO:1, and a fluorescence reporting group is connected to the 3' end of the strand displacement probe as shown in SEQ ID NO:2.

[0008] Preferably, the above composition further includes: An opening strand, the sequence of the opening strand is as shown in SEQ ID NO:4; and / or Metal cations.

[0009] On the other hand, the present invention provides a detection reagent for detecting IDH1 mutations. The detection reagent includes the composition in the present invention and an exonuclease, and the exonuclease is used to enzymatically cleave the amplified double-stranded DNA product into single-stranded DNA.

[0010] Preferably, the above detection reagent further includes a pair of PCR amplification primers.

[0011] Preferably, in the above detection reagent, the sequences of the pair of PCR amplification primers are as shown in SEQ ID NO:5 and SEQ ID NO:6.

[0012] On yet another aspect, the present invention provides a product for diagnosing glioma with IDH1 gene mutations, including the composition in the present invention or the detection reagent in the present invention.

[0013] On yet another aspect, the present invention provides the use of the composition in the present invention or the detection reagent in the present invention in the preparation of a product for diagnosing glioma with IDH1 gene mutations, and the IDH1 gene mutation is the R132H mutation.

[0014] On yet another aspect, the present invention provides a method for detecting IDH1 mutations for non-diagnostic purposes, and the IDH1 gene mutation is the R132H mutation. The method selects any one of the following methods: (i) The method includes: using the composition in the present invention for detection, including: mixing the DNA of the sample to be detected and the composition for reaction; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation situation; the DNA of the sample to be detected is a single-stranded DNA sample; (ii) The method includes: detecting using the detection reagent in the present invention, including: amplifying the DNA of the sample to be detected using a pair of PCR amplification primers to obtain a PCR amplification product; digesting the PCR amplification product using an exonuclease to obtain a digestion product; mixing the digestion product and the composition for reaction; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation situation; the DNA of the sample to be detected is a double-stranded DNA sample.

[0015] Preferably, in the above method, In method (ii), in the mixture of the digestion product and the composition: The concentrations of the strand displacement probes shown in SEQ ID NO:1 and SEQ ID NO:2 are 25 nM - 250 nM respectively; and The concentration of the auxiliary strand is 25 nM - 250 nM; and The concentration of the opening strand is 0 - 250 nM; and / or The concentration of the metal cation is 0 - 20 mM; and / or In method (ii): In the PCR amplification system, the concentration of the DNA of the sample to be detected is 100 ng / μL - 400 ng / μL; and / or In the PCR amplification system, the concentration of the pair of PCR amplification primers is 120 nM - 130 nM; and / or In method (ii): The volume ratio of the exonuclease to the PCR amplification product is (0.5 - 1.5) : 10.

[0016] The beneficial effects of the present invention include: (1) The detection method constructed based on the composition for detecting IDH1 mutation provided by the present invention can achieve highly specific detection of the R132H mutation of the IDH1 gene; and, compared with the existing methods (such as allele-specific PCR), the present invention has significantly improved sensitivity and specificity, and the detection limit can reach 0.1% (that is, when the mutant nucleic acid abundance is 0.1%, it can still be detected).

[0017] (2) The detection method constructed based on the composition for detecting IDH1 mutation provided by the present invention was used to detect glioma samples from two clinical cohorts (38 positive samples and 57 negative samples), and by plotting the ROC curve, it can be known that the area under the ROC curve (AUC) of this detection method can reach 1, indicating high detection accuracy.

[0018] (3)The comparison of glioma samples (38 positive samples and 57 negative samples) from two clinical cohorts detected by the detection method constructed based on the composition for detecting IDH1 mutations provided by the present invention with Sanger sequencing samples shows that the detection method based on the strand displacement probe in the present invention has a high consistency with the Sanger sequencing method, and the sensitivity and specificity can reach 100% and 100% respectively.

[0019] (4)The whole detection process of the detection method constructed based on the composition for detecting IDH1 mutations provided by the present invention is simple, rapid and does not require complex equipment, providing strong technical support for the early diagnosis and individualized treatment of glioma. Description of the Drawings

[0020] Figure 1 It is a reaction schematic diagram of mutant DNA strand, auxiliary strand and strand displacement probe; Figure 2 It is a reaction schematic diagram of wild-type DNA strand, auxiliary strand and strand displacement probe; Figure 3 It is a fluorescence curve triggered by different targets; in the figure, ① is the MT group, ② is the MT group without the opening strand, ③ is the WT group, ④ is the negative sample group; ⑤ is the blank group; Figure 4 It is the analysis of the effect of λ digestion by melting curve; Figure 5 It is the fluorescence signal situation of different amounts of λ exonuclease added; Figure 6 It is the fluorescence signal situation of different concentrations of strand displacement probe; Figure 7 It is the fluorescence signal situation of different magnesium ion concentrations; Figure 8 It is the fluorescence signal situation of different digestion times; Figure 9 It is the real-time fluorescence quantitative PCR curve triggered by different concentrations of targets; in the figure, the curves from left to right are 100p, 10p, 1p, 100f, 10f and N groups; Figure 10 It is the fluorescence signal situation of detecting targets with different abundances; Figure 11 The normalized signal is linearly correlated with the mutant abundance from 0.1% to 10%; Figure 12 It is the normalized signal in glioma samples from two clinical cohorts; Figure 13 It is the ROC curve for determining the diagnostic accuracy of the present invention; Figure 14The sensitivity and specificity of the present invention were evaluated using a confusion matrix compared to Sanger sequencing in glioma samples. Detailed implementation manners

[0021] The examples given are for better illustration of the present invention, but the content of the present invention is not limited only to the examples given. Therefore, those skilled in the art who make non-essential improvements and adjustments to the implementation manners based on the above-mentioned invention content still fall within the protection scope of the present invention.

[0022] The terms used herein are only for describing specific embodiments and are not intended to limit the present disclosure. Unless having significantly different meanings in the context, expressions in the singular form include those in the plural form. As used herein, it should be understood that terms such as "including", "having", "containing" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. Terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility of the existence or addition of one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof. As used herein, depending on the circumstances, " / " can be interpreted as "and" or "or".

[0023] An embodiment of the present invention provides a composition for detecting IDH1 mutations. The composition includes strand displacement probes (including probe T and probe D) and an auxiliary strand. The sequences of the strand displacement probes are shown as SEQ ID NO:1 and SEQ ID NO:2, and the sequence of the auxiliary strand is shown as SEQ ID NO:3.

[0024] It should be noted that the detection principle of the composition of the present invention includes: introducing an auxiliary strand in the strand displacement reaction can block the mutation corresponding sites of the wild-type DNA strand, resulting in a shortening of the landing domain and the branch migration domain by 3 nucleotides each, and an extension of the association domain by 3 nucleotides. When the initial base of the branch migration domain undergoes the breathing process, the intermediate of the three-way junction structure formed by the binding of the landing domain can continue to move forward. However, due to the low probability of base breathing, this will lead to an increase in the transition state energy barrier, thereby significantly inhibiting the reaction rate. In contrast, the mutant DNA strand completes the strand displacement reaction along the normal reaction path; this design achieves a dual thermodynamic and kinetic selection: thermodynamically, the reaction shows a significant increase in ΔΔG; kinetically, the increase in the energy barrier will cause the wild-type target to fall into a kinetic trap, resulting in a significant difference in the reaction rate; thus realizing the distinction between the wild-type DNA strand and the mutant DNA strand. The specific detection principle diagram is as Figure 1 and Figure 2 shown as follows: When the target strand is a mutant DNA strand, fragment 2* in the auxiliary strand (2* + 3*) is complementary to fragment 2 (excluding the mutation site) of the mutant DNA strand. When the mutant DNA strand, the strand displacement probe, and the auxiliary strand are mixed, fragment 2* of the auxiliary strand binds to fragment 2 of the mutant DNA strand to form an intermediate. Since fragment 1 of the mutant DNA strand is complementary to fragment 1* (toehold) in probe T of the probe T - probe D complex (i.e., the strand displacement probe, where probe T contains fragment 1* (toehold), an associated domain, and fragment 3 (branch migration domain), probe D contains fragment 3 and carries a fluorescence quenching group; probe D contains fragment 3* and carries a fluorescence reporting group), fragment 1 in the intermediate binds to fragment 1* in probe T, and strand displacement starts with fragment 1* as the toehold. Before strand displacement, the fluorescence quenching group and the fluorescence reporting group in the probe T - probe D complex are close to each other and no fluorescence is generated. When the auxiliary strand displaces probe T, the probe T carrying the fluorescence group is released and moves away from the probe D carrying the fluorescence quenching group, thus generating fluorescence. When the target strand is a wild - type DNA strand, fragment 2* in the auxiliary strand (2* + 3*) binds to the wild - type DNA strand (including the corresponding mutation site) to form an intermediate. In the intermediate, the base fragment "CTTGATCCCCATAAGCATGACGA" in the auxiliary strand is complementary to the base fragment "TC G TCATGCTTATGGGGATCAAG ( G which is the corresponding mutation site)" to block the corresponding mutation site, reducing the binding sites between the wild - type DNA strand in the intermediate and the toehold domain of probe D. At this time, both the toehold domain (fragment 1*) and the branch migration domain (fragment 3) on probe D are reduced by 3 bases, while the associated domain (semicircle) increases by 3 bases (TGA), causing the first base of the branch migration domain to undergo respiration for the reaction to continue. However, due to the low probability of respiration, this will trap the wild - type target in a kinetic trap and strand displacement cannot be achieved, and no fluorescence will be generated. Based on the above principle, when the target strand is a wild - type DNA strand, no fluorescence (or a trace amount of fluorescence) is generated. When the target strand is a mutant DNA strand, a large amount of fluorescence is generated, thereby distinguishing between the wild - type DNA strand and the mutant DNA strand.

[0025] In some specific examples, in the above composition, a fluorescence quenching group is linked to the 5' end of the strand displacement probe shown in SEQ ID NO:1, and a fluorescence reporting group is linked to the 3' end of the strand displacement probe shown in SEQ ID NO:2.

[0026] It should be noted that the fluorescence quenching group connected to the 5'-end of the strand displacement probe shown in SEQ ID NO:1 is well-known in the art, such as BHQ1, BHQ2, BHQ3, QSY7 or QSY21, etc.; the fluorescence reporter group connected to the 3'-end of the strand displacement probe shown in SEQ ID NO:2 is well-known in the art, such as FAM, ROX, HEX, JOE or Cy5, etc.

[0027] In some specific examples, the above composition further includes: An opening strand, the sequence of the opening strand is as shown in SEQ ID NO:4; and / or Metal cations.

[0028] It should be noted that the composition in the present invention may further include an opening strand. Specifically, by introducing an opening strand, the influence of the ssDNA secondary structure on the reaction is reduced, the fluorescence intensity of the reaction is significantly enhanced, and the reaction rate is accelerated; in addition, the present invention may also include metal cations, and the metal cations can promote nucleic acid hybridization and improve the reaction efficiency; the metal cations are well-known in the art, such as magnesium ions, sodium ions or potassium ions, etc.; it should be understood that the way of adding metal cations is generally to add the corresponding salts, such as magnesium acetate, magnesium chloride, sodium chloride or potassium chloride, etc. In addition, the composition in the present invention may include both an opening strand and metal cations, or may only include one of them. Preferably, both an opening strand and metal cations are included, which can reduce the detection time and improve the detection accuracy.

[0029] The embodiment of the present invention further provides a detection reagent for detecting IDH1 mutation. The detection reagent includes the composition in the present invention and an exonuclease, and the exonuclease is used to enzymatically cleave the amplified double-stranded DNA product into single-stranded DNA.

[0030] It should be noted that the type of exonuclease can be selected according to the modification type of the primer of the amplification product. For example, if the primer is modified with phosphorothioate, T7 exonuclease can be used. Another example is that if the primer is modified with phosphate, λ exonuclease can be used.

[0031] In some specific examples, the above detection reagent further includes a pair of PCR amplification primers.

[0032] It should be noted that the composition in the present invention can be combined with an auxiliary detection reagent to form a detection reagent for detecting IDH1 mutation. The detection reagent may include a pair of PCR amplification primers and / or λ exonuclease. Specifically, before detecting the DNA sample, the DNA sample can be amplified and then detected; in addition, using λ exonuclease to enzymatically cleave the PCR amplification product into single-stranded DNA and then detecting can improve the fluorescence intensity of the detection and the detection accuracy.

[0033] In some specific examples, in the above detection reagent, the sequences of the PCR amplification primer pair are as shown in SEQ ID NO:5 and SEQ ID NO:6.

[0034] It should be noted that the primer pair for PCR amplification of the IDH1 mutant gene in the present invention can be designed according to the primer design methods well-known in the art. Preferably, the primers as shown in SEQ ID NO:5 and SEQ ID NO:6 are used. The PCR amplification mediated by this primer pair can easily amplify DNA samples as low as 10 fM for detection.

[0035] The embodiment of the present invention also provides a product for diagnosing glioma with IDH1 gene mutation, including the composition or the detection reagent in the present invention.

[0036] It should be noted that the composition and the detection reagent in the present invention can be used to diagnose glioma with IDH1 gene mutation, and the composition and the detection reagent can be prepared into a product for diagnosing glioma with IDH1 gene mutation. The form of the product can be a reagent or a kit. Additionally, the product can also include reagents for preprocessing the sample to be detected (blood or corresponding tissue), such as reagents for extracting genomic DNA of the sample to be detected, etc.

[0037] The embodiment of the present invention also provides an application of the composition or the detection reagent in the present invention in the preparation of a product for diagnosing glioma with IDH1 gene mutation, and the IDH1 gene mutation is the R132H mutation.

[0038] It should be noted that as described above, the product for diagnosing glioma with IDH1 gene mutation can include a reagent or a kit, and the specific product form can be selected according to specific needs.

[0039] The embodiment of the present invention also provides a method for detecting IDH1 mutation for non-diagnostic purposes. The IDH1 gene mutation is the R132H mutation. Any one of the following methods can be selected for the method: (i) The method includes: detecting using the composition in the present invention, including: mixing the DNA of the sample to be detected and the composition for reaction; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation situation; the DNA of the sample to be detected is a single-stranded DNA sample; (ii) The method includes: detecting using the detection reagent in the present invention, including: amplifying the DNA of the sample to be detected using a PCR amplification primer pair to obtain a PCR amplification product; digesting the PCR amplification product using lambda exonuclease to obtain a digestion product; mixing the digestion product and the composition for reaction; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation situation; the DNA of the sample to be detected is a double-stranded DNA sample.

[0040] It should be noted that different detection methods above can be selected according to different detection requirements. In addition, for the application of detecting IDH1 mutations for non-diagnostic purposes, it can be applied in vitro to detect IDH1 mutations and study the changes in related signaling pathways caused by IDH1 mutations.

[0041] It should also be noted that in the above methods for detecting IDH1 mutations, the mutation sites of wild-type targets will be blocked by the auxiliary strand, thus preventing the generation of fluorescence; in contrast, mutant targets can trigger fluorescence normally.

[0042] In some specific examples, in method (ii) of the above method, in the mixture of digestion products and the composition: The concentrations of the strand displacement probes shown in SEQ ID NO:1 and SEQ ID NO:2 are 25 nM - 250 nM respectively; for example, 50 nM, 75 nM, 90 nM, 115 nM, 125 nM, 150 nM, 175 nM, 190 nM, 215 nM or 225 nM, etc.; and The concentration of the auxiliary strand is 25 nM - 250 nM, for example, 50 nM, 75 nM, 90 nM, 115 nM, 125 nM, 150 nM, 175 nM, 190 nM, 215 nM or 225 nM, etc.; and The concentration of the opening strand is 0 - 250 nM, for example, 5 nM, 25 nM, 50 nM, 75 nM, 90 nM, 115 nM, 125 nM, 150 nM, 175 nM, 190 nM, 215 nM or 225 nM; and / or The concentration of MgCl2 is 0 - 20 mM, for example, 5 mM, 10 mM or 15 mM, etc.

[0043] In some specific examples, in method (ii) of the above method: In the PCR amplification system, the concentration of the sample DNA to be detected is 100 ng / μL - 400 ng / μL, for example, 150 ng / μL, 200 ng / μL, 250 ng / μL, 300 ng / μL or 350 ng / μL, etc.; and / or In the PCR amplification system, the concentration of the PCR amplification primer pair is 120 nM - 130 nM, for example, 123 nM, 125 nM, 128 nM or 129 nM, etc.

[0044] It should also be noted that a fluorescent dye can be added to the PCR amplification system in method (ii) above to achieve real-time quantitative PCR (qPCR) detection, and the fluorescent dye is well-known in the art.

[0045] In some specific examples, in method (ii) of the above method: the volume ratio of λ exonuclease to the PCR amplification product is (0.5 - 1.5):10, such as 0.7:10, 1:10, or 1.3:10, etc.

[0046] It should be noted that in the above method (ii), when λ exonuclease is mixed with the PCR amplification product, an enzyme buffer can also be added. The enzyme buffer is well-known in the art, and the volume ratio of the added enzyme buffer to the volume of the PCR amplification product is (0.5 - 1.5):10, such as 0.7:10, 1:10, or 1.3:10, etc.; in addition, the time of λ exonuclease ≥ 10 min is sufficient, generally 10 min - 40 min, such as 20 min, 25 min, or 30 min.

[0047] In some specific examples, in the above method, the IDH1 gene mutation is the R132H mutation.

[0048] To better understand the present invention, the content of the present invention will be further clarified below in combination with specific examples, but the content of the present invention is not limited to the following examples.

[0049] In the following examples, genomic DNA (gDNA) was extracted from tissue samples using a commercial genomic DNA extraction kit (ADx-ARMS, Xiamen) (the extraction method refers to the kit instruction manual). In addition, the concentration of the extracted DNA was measured by NanoDrop.

[0050] In the following examples, a centrifugal real-time fluorescence quantitative PCR instrument (Rotor-Gene 6000 (CorbettResearch, Mortlake, Australia).) was used to monitor the fluorescence signal.

[0051] In the following examples, wild-type IDH1 plasmid (IDH1-wt) and R132H mutant IDH1 plasmid were purchased from Sangon Biotech (Shanghai) Co., Ltd., and their nucleic acid sequences are shown in SEQ ID NO:7 and SEQ ID NO:8 respectively.

[0052] In the following examples, the specific information of the sequences involved is shown in Table 1 below; in addition, the sequences involved were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0053] Table 1 Specific information of the sequences involved I. Detection reagent combinations for detecting IDH1 mutations Example 1 In the examples of the present invention, the situation of the detection reagents for detecting IDH1 mutations is shown in Table 2 below.

[0054] Table 2 Detection reagent situation in Example 1 Example 2 The difference between Example 2 and Example 1 is that the detection reagent in the embodiment of the present invention does not contain an opening strand, and the others are the same as in Example 1.

[0055] Example 3 The difference between Example 3 and Example 1 is that the detection reagent in the embodiment of the present invention does not contain λ exonuclease, and the others are the same as in Example 1.

[0056] Examples 4 to 12 The differences between Examples 4 to 12 and Example 1 are as follows: in the detection reagent, the addition amounts of λ exonuclease, the concentrations of probe T and probe D, and the concentration of MgCl2 are different, and the others are the same as in Example 1; the addition amounts of various substances in the detection reagents of Examples 4 to 12 are shown in Table 3 below.

[0057] Table 3 Addition amounts of the above substances in Examples 4 to 12 Comparative Example 1 The difference between Comparative Example 1 and Example 1 is that the detection reagent in Comparative Example 1 of the present invention only contains strand displacement probes (probe T and probe D) and λ exonuclease, and the concentrations are the same as in Example 1.

[0058] Comparative Example 2 The difference between Comparative Example 2 and Example 1 is that the detection reagent of Comparative Example 2 of the present invention does not contain an auxiliary strand, and the others are the same as in Example 1.

[0059] Effect test of the detection reagent Verify the effects of the detection reagents of Examples 1 to 12 and Comparative Example 1 according to the following detection method, specifically as follows: (1) Perform amplification by PCR Amplify the DNA sample to be tested using a PCR amplification kit (Sangon Biotech (Shanghai) Co., Ltd., product number: B639274-0001) (the amplification method is carried out according to the kit instructions) to obtain a PCR amplification product; among them, the PCR amplification system includes the DNA sample to be tested, PCR Mix, forward primer, reverse primer, and SYBR Green mixture, and the PCR amplification program is: 95°C, 3 min; 95°C, 10 s; 60°C, 30 s.

[0060] (2) Perform enzymatic digestion on the amplification product Add λ exonuclease (λexo) and enzyme buffer (buffer provided with λ exonuclease purchased from NEB) to 10 μL of PCR amplification product, and then gently mix by pipetting to obtain a mixed solution; after incubating the mixed solution at 37°C for 30 minutes, heat to 85°C and maintain for 10 minutes to inactivate the enzyme, and then cool back to room temperature to obtain a digestion product.

[0061] (3) Testing with detection reagents Add probe T, probe D, open strand, auxiliary strand, and MgCl2 to 10 μL of the digestion product and make up to 20 μL with TEM (triethylene glycol monomethyl ether).

[0062] (4) Fluorescence signal monitoring The fluorescence signal changes of the monitoring system (normalized signal) were monitored, and the IDH1 mutation in the sample was detected by analyzing the fluorescence value.

[0063] The specific results are as follows: First, the R132H mutant IDH1 plasmid was used as a DNA sample to be tested and the detection reagents of Example 1 and Example 2 were used to perform detection according to the above detection method, respectively, and were recorded as the MT group (Example 1) and the MT group without opening chain (Example 2); In addition, the wild-type IDH1 plasmid was used as a DNA sample to be tested and the detection reagent of Example 1 was used to perform detection according to the above detection method, which was recorded as the WT group; In addition, the detection reagent of Example 1 was used without adding DNA sample to perform detection according to the above detection method, which was recorded as negative sample group; In addition, the R132H mutant IDH1 plasmid was used as a DNA sample to be tested and the detection reagent of Comparative Example 1 was used to perform detection according to the above detection method, which was recorded as a blank group; The changes in the fluorescence signals detected above (normalized signals) are as follows: Figure 3 As shown, the results showed that the WT group showed very little fluorescence increase, and the MT group without an open chain showed an obvious fluorescence increase, but the kinetics was slow. When an open chain was introduced (MT group), the fluorescence was significantly enhanced, indicating that the introduction of an open chain can reduce the effect of ssDNA secondary structure on the reaction, thereby increasing the reaction efficiency.

[0064] Secondly, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested and the detection reagents of Example 1 and Example 3 were used for detection according to the above detection method; the melting curves obtained by the detection reagents of Example 3 (untreated with λ exonuclease) and Example 1 (treated with λ exonuclease) were compared, and the results were as follows: Figure 4As shown, the results show that the melting curve results show that the products of different PCRMIX have obvious melting peaks (Tm value is 83 °C). After digestion with λ exonuclease, the melting peak drops sharply, indicating that λ exonuclease has successfully cleaved the 5'-phosphorylated strand.

[0065] Thirdly, using the R132H mutant IDH1 plasmid as the DNA sample to be tested, the detection reagents of Example 1 and Examples 4 to 6 were used to perform detections respectively according to the above detection method. The detected fluorescence signals (normalized signals) are as Figure 5 shown. The results show that when the addition amount of λ exonuclease is 1 μL, the fluorescence signal is the strongest, that is, the addition amount of λ exonuclease in the present invention can preferably be 1 μL.

[0066] Fourthly, using the R132H mutant IDH1 plasmid as the DNA sample to be tested, the detection reagents of Example 1 and Examples 7 to 9 were used to perform detections respectively according to the above detection method. The fluorescence signal conditions (normalized signals) of the detections are as Figure 6 shown. The results show that for different probe concentrations, there are strong fluorescence signals, and as the probe concentration increases, the fluorescence signal increases.

[0067] Fifthly, using the R132H mutant IDH1 plasmid as the DNA sample to be tested, the detection reagents of Example 1 and Examples 10 to 12 were used to perform detections respectively according to the above detection method. The fluorescence signal conditions (normalized signals) of the detections are as Figure 7 shown. The results show that for different MgCl2 concentrations, there are strong fluorescence signals, and as the MgCl2 concentration increases, the fluorescence signal increases.

[0068] Sixthly, using the R132H mutant IDH1 plasmid and the wild-type IDH1 plasmid as the DNA samples to be tested respectively, the detection reagents of Comparative Example 2 were used to perform detections respectively according to the above detection method. The detection results show that there is no obvious difference in the fluorescence intensities of the two, indicating that the detection of the IDH1 mutation of R132H cannot be achieved without adding the auxiliary strand.

[0069] In addition, using the R132H mutant IDH1 plasmid as the DNA sample to be tested, the detection reagent of Example 1 was used to perform detections respectively according to the above detection method. Among them, the digestion times in step (2) were set to 10 min, 20 min, 30 min, and 40 min respectively. The fluorescence signal changes (normalized signals) at different digestion times are as Figure 8 shown. The results show that different digestion times have little effect on the change of fluorescence signal.

[0070] II. Effect test of detection reagent and detection method (1) Sensitivity test of PCR amplification primer pair in detection method Dilute the IDH1 plasmid with the R132H mutation into different concentrations (the diluent is the DNA diluent from Sangon Biotech) as the DNA samples to be tested, and then perform amplification according to step (2) of the above detection method respectively to test the sensitivity of the PCR amplification primers; and use the absence of a DNA sample as the control group (N).

[0071] The real-time fluorescence curve during the PCR amplification is as Figure 9 shown ( Figure 9 in which, 10f represents 10 fM, 100f represents 100 fM, and so on), and the results show that PCR mediated by the phosphorylated primer can easily detect plasmid targets as low as 10 fM.

[0072] (II) Detection limit test of the detection method In the following tests, the mutant abundance refers to the proportion of the IDH1 plasmid with the R132H mutation in the mixed DNA sample. For example, a mutant abundance of 0.1% means that in a 1000 μL mixed DNA sample, the IDH1 plasmid with the R132H mutation is 1 μL, and the wild-type IDH1 plasmid is 999 μL; a mutant abundance of 0.5% means that in a 1000 μL mixed DNA sample, the IDH1 plasmid with the R132H mutation is 5 μL, and the wild-type IDH1 plasmid is 995 μL; and so on.

[0073] Mix the IDH1 plasmid with the R132H mutation and the wild-type IDH1 plasmid in different proportions to prepare mixed DNA samples with different mutant abundances (0.1%, 0.5%, 1%, 5%, 10%, and 100%) as the DNA samples to be tested, and then use the detection reagent of Example 1 to detect the fluorescence signal conditions (normalized signals) of DNA samples with different mutant abundances according to the above test method for verifying the effect of the detection reagent (mt); in addition, use the wild-type IDH1 plasmid as the DNA sample to be tested and use the detection reagent of Example 1 to detect the fluorescence signal conditions (normalized signals) according to the detection method of the detection reagent as the baseline (wt).

[0074] The detection results are as Figure 10 shown, and the results show that when the mutant abundance is 0.1%, the mt fluorescence signal value is still stronger than the wt value, indicating that when the mutant abundance is 0.1%, it can still be detected.

[0075] In addition, the relationship between the change in the normalized signal and the change in the mutant abundance from 0.1% to 10% is as Figure 11 shown, and the results show that the normalized signal is linearly correlated with the mutant abundance from 0.1% to 10%.

[0076] (III) Detection test for multiple samples Genomic DNA of 95 glioma samples was extracted using a commercial genomic DNA extraction kit and used as the DNA samples to be tested. The 95 DNA samples to be tested were detected using the detection reagent in Example 1 according to the above detection method (the method for verifying the effect of the detection reagent). The detection results were divided into two clinical cohorts, among which 38 were positive samples (R132H type IDH1 mutation), and 57 were negative samples (IDH1 wild type). The fluorescence signal changes (normalized signals) of the glioma samples in the two clinical cohorts were as Figure 12 shown. The results showed that the normalized fluorescence values of the positive samples were significantly higher than those of the negative samples.

[0077] In addition, using the detection conditions of the glioma samples in the above two clinical cohorts, the receiver operating characteristic (ROC) curve was plotted using GraphPad. The results were as Figure 13 shown. The results showed that the area under the receiver operating characteristic (ROC) curve (AUC) was 1.

[0078] Furthermore, the glioma samples in the two clinical cohorts were sequenced using the Sanger sequencing method. The sequencing results showed that 38 positive samples were R132H mutant IDH1 mutation samples, and R132H mutation was not detected in 57 negative samples. The results were compared with the results detected by the detection reagent in Example 1 according to the above detection method using a confusion matrix. The results were as Figure 14 shown. The results showed that the results detected by the detection method in Example 1 were consistent with the Sanger sequencing results, indicating that the sensitivity and specificity of the detection method in Example 1 were 100% and 100% respectively (where the true positive rate represents sensitivity (upper left of the rectangle), and the true negative rate represents specificity (lower left of the rectangle)).

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.

Claims

1. A composition for detecting IDH1 mutation, the composition comprising a strand displacement probe and an auxiliary strand, the sequences of the strand displacement probe being shown in SEQ ID NO:1 and SEQ ID NO:2, and the sequence of the auxiliary strand being shown in SEQ ID NO:

3.

2. The composition according to claim 1, wherein The 5' end of the strand displacement probe shown in SEQ ID NO:1 is linked with a fluorescence quenching group, and the 3' end of the strand displacement probe shown in SEQ ID NO:2 is linked with a fluorescence reporting group.

3. The composition according to claim 1 or 2, characterized in that, The composition further comprises: An opening strand, the sequence of the opening strand being shown in SEQ ID NO:4; and / or A metal cation.

4. Detection reagent for detecting IDH1 mutation, characterized in that The detection reagent comprises the composition according to any one of claims 1 to 3 and an exonuclease, and the exonuclease is used to enzymatically cleave the amplified double-stranded DNA product into single-stranded DNA.

5. The detection reagent according to claim 4, wherein The detection reagent further comprises a pair of PCR amplification primers.

6. The detection reagent according to claim 5, characterized in that The sequences of the pair of PCR amplification primers are shown in SEQ ID NO:5 and SEQ ID NO:

6.

7. A product for diagnosing glioma with IDH1 gene mutation, characterized in that, Comprising the composition according to any one of claims 1 to 3 or the detection reagent according to any one of claims 4 to 6.

8. Use of the composition according to any one of claims 1 to 3 or the detection reagent according to any one of claims 4 to 6 in the preparation of a product for diagnosing glioma with IDH1 gene mutation, wherein the IDH1 gene mutation is the R132H mutation.

9. A method for detecting IDH1 mutations for non-diagnostic purposes, characterized in that, The IDH1 gene mutation is the R132H mutation, and the method selects any one of the following methods: (i) The method comprises: detecting using the composition according to any one of claims 1 to 3, including: mixing the DNA of the sample to be detected and the composition for reaction; monitoring the fluorescence intensity during the reaction to judge the IDH1 mutation situation; the DNA of the sample to be detected is a single-stranded DNA sample; (ii) The method comprises: detecting using the detection reagent according to claim 5 or 6, including: amplifying the DNA of the sample to be detected using the pair of PCR amplification primers to obtain a PCR amplification product; enzymatically cleaving the PCR amplification product using an exonuclease to obtain a digestion product; mixing the digestion product and the composition for reaction; monitoring the fluorescence intensity during the reaction to judge the IDH1 mutation situation; the DNA of the sample to be detected is a double-stranded DNA sample.

10. The method according to claim 9, wherein In the mixture of the digestion product and the composition in method (ii): The concentrations of the strand displacement probes shown in SEQ ID NO:1 and SEQ ID NO:2 are respectively 25 nM - 250 nM; and The concentration of the auxiliary strand is 25 nM - 250 nM; and The concentration of the opening strand is 0 - 250 nM; and / or The concentration of the metal cation is 0 - 20 mM; and / or In method (ii): In the PCR amplification system, the concentration of the DNA of the sample to be detected is 100 ng / μL - 400 ng / μL; and / or In the PCR amplification system, the concentration of the pair of PCR amplification primers is 120 nM - 130 nM; and / or In method (ii): The volume ratio of the exonuclease to the PCR amplification product is (0.5 - 1.5):10.

Images