Composition for detecting IDH1 mutation, detection reagent and application thereof

Through the composition of strand replacement probe and auxiliary chain, combined with exonuclease treatment, the specificity and sensitivity of PCR methods in detecting IDH1 mutations are solved, and high sensitivity and high specificity detection of IDH1 mutations are achieved, which is suitable for early diagnosis and individualized treatment of brain gliomas.

CN120290731BActive Publication Date: 2025-08-15CHONGQING NOVOS BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510771808.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-08-15
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

Existing PCR methods have problems with insufficient specificity and limited sensitivity when detecting IDH1 mutations, especially when detecting extremely low abundance mutant DNA, and primer dimers and nonspecific products affect detection reliability.

Method used

Using a composition of strand replacement probe and auxiliary strand, specific detection of IDH1 mutations is achieved by designing specific nucleotide sequences and fluorescent labels, and the amplification products are treated in combination with exonuclease to improve the sensitivity and specificity of the detection.

Benefits of technology

A highly specific detection of IDH1 mutations was achieved, with a sensitivity of 0.1%, an area AUC under the ROC curve reached 1, and a sensitivity and specificity of 100%. It is easy to operate and requires no complicated equipment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290731B_ABST
    Figure CN120290731B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of detection reagent preparation, specifically relating to a composition, detection reagent, and applications thereof for detecting IDH1 mutations. The composition comprises a strand displacement probe and an auxiliary chain. The strand displacement probe sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, and the auxiliary chain sequence is shown in SEQ ID NO:3. This composition can achieve specific detection of IDH1 mutations, particularly the R132H mutation. Compared to existing methods, the detection method constructed based on the present composition significantly improves sensitivity and specificity, with a detection limit of up to 0.1%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of detection reagent preparation, and particularly relates to a composition for detecting IDH1 mutations, a detection reagent and applications thereof. Background Art

[0002] In the field of precision diagnosis and treatment of neuro-oncology, the diagnosis and treatment of gliomas are key research topics. IDH1 gene mutations are common and highly clinically significant biomarkers in gliomas, closely associated with patient prognosis and treatment options. Therefore, accurate detection of IDH1 mutations, especially at specific sites (such as R132H), is crucial for guiding personalized treatment.

[0003] Currently, polymerase chain reaction (PCR) is one of the most widely used methods in the field of nucleic acid detection and occupies an important position in clinical practice due to its high sensitivity and specificity. However, traditional PCR methods still face some technical challenges in detecting IDH1 mutations, as follows: (1) Insufficient specificity: Even with high-fidelity PCR, nonspecific amplification can still lead to false positive results, especially when detecting samples with complex backgrounds. Due to the limitations of primer design, PCR is often unable to effectively distinguish similar sequences; (2) Limited detection sensitivity: For extremely low-abundance mutant DNA, traditional PCR detection methods are difficult to meet the needs, especially for capturing rare mutant molecules in liquid biopsies; (3) Primer dimers and nonspecific products: Even if the reaction conditions are optimized, interactions between primers may still affect the detection effect, thereby reducing the reliability of the test.

[0004] To overcome these issues, researchers have developed various strategies to improve the specificity and sensitivity of PCR detection, such as the use of TaqMan probes, molecular beacons, allele-specific PCR, and probes with complex structures. However, these methods have a detection limit of 1%-10% for mutation abundance, which still cannot meet the demand for more accurate detection. Summary of the Invention

[0005] Based on this, the present invention has developed a composition for detecting IDH1 mutations, which can achieve specific detection of IDH1 mutations, particularly the R132H mutation. Compared with existing methods (such as allele-specific PCR), the detection method constructed based on the present composition has significantly improved sensitivity and specificity, with a detection limit of 0.1% (i.e., the mutant nucleic acid can still be detected even when the abundance is 0.1%).

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] In one aspect, the present invention provides a composition for detecting IDH1 mutations, comprising a strand displacement probe and an auxiliary chain, wherein the sequences of the strand displacement probe are shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the sequence of the auxiliary chain is shown in SEQ ID NO: 3.

[0008] Preferably, in the above composition, the 5' end of the strand displacement probe as shown in SEQ ID NO: 1 is connected to a fluorescent quenching group, and the 3' end of the strand displacement probe as shown in SEQ ID NO: 2 is connected to a fluorescent reporter group.

[0009] Preferably, the above composition further comprises:

[0010] An open chain, the sequence of which is shown in SEQ ID NO: 4; and / or

[0011] Metal cations.

[0012] Another aspect of the present invention provides a detection reagent for detecting IDH1 mutations. The detection reagent comprises the composition of the present invention and an exonuclease, and the exonuclease is used to enzymatically cut the amplified double-stranded DNA product into single-stranded DNA.

[0013] Preferably, the above detection reagent also includes a PCR amplification primer pair.

[0014] Preferably, in the above detection reagent, the sequences of the PCR amplification primer pair are shown as SEQ ID NO: 5 and SEQ ID NO: 6.

[0015] In another aspect, the present invention provides a product for diagnosing IDH1 gene mutation brain glioma, comprising the composition of the present invention or the detection reagent of the present invention.

[0016] In another aspect, the present invention provides a use of the composition or the detection reagent of the present invention in the preparation of a product for diagnosing brain glioma with IDH1 gene mutation, wherein the IDH1 gene mutation is R132H mutation.

[0017] In another aspect, the present invention provides a method for detecting an IDH1 mutation for non-diagnostic purposes, wherein the IDH1 gene mutation is an R132H mutation, and the method is any one of the following methods:

[0018] (i) The method comprises: using the composition of the present invention to perform detection, including: mixing the sample DNA to be detected and the composition to react; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation; the sample DNA to be detected is a single-stranded DNA sample;

[0019] (ii) The method comprises: using the detection reagent of the present invention to perform detection, including: amplifying the sample DNA to be detected using a PCR amplification primer pair to obtain a PCR amplification product; enzymatically cleaving the PCR amplification product using an exonuclease to obtain a digestion product; mixing the digestion product with the composition to react; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation status; the sample DNA to be detected is a double-stranded DNA sample.

[0020] Preferably, in the above method,

[0021] In method (ii), the mixture of the digestion product and the composition:

[0022] The concentrations of the strand displacement probes shown in SEQ ID NO: 1 and SEQ ID NO: 2 are 25 nM to 250 nM, respectively; and

[0023] The concentration of auxiliary chain is 25nM-250nM; and

[0024] The concentration of the open chain is 0-250 nM; and / or

[0025] The concentration of the metal cation is 0-20 mM; and / or

[0026] In method (ii):

[0027] In the PCR amplification system, the concentration of the sample DNA to be tested is 100 ng / μL-400 ng / μL; and / or

[0028] In the PCR amplification system, the concentration of the PCR amplification primer pair is 120nM-130nM; and / or

[0029] In method (ii):

[0030] The volume ratio of exonuclease to PCR amplification product is (0.5-1.5):10.

[0031] The beneficial effects of the present invention include:

[0032] (1) The detection method constructed based on the composition for detecting IDH1 mutation provided by the present invention can achieve highly specific detection of the R132H mutation of the IDH1 gene; and, compared with existing methods (such as allele-specific PCR), the present invention has significantly improved sensitivity and specificity, with a detection limit of up to 0.1% (i.e., the mutant nucleic acid can still be detected when the abundance is 0.1%).

[0033] (2) The detection method constructed based on the composition for detecting IDH1 mutation provided by the present invention was tested on brain glioma samples from two clinical cohorts (38 positive samples and 57 negative samples), and the ROC curve was drawn. It can be seen that the area under the ROC curve (AUC) of the detection method can reach 1, indicating high detection accuracy.

[0034] (3) The detection method constructed based on the composition for detecting IDH1 mutation provided by the present invention was used to detect brain glioma samples from two clinical cohorts (38 positive samples and 57 negative samples) and compared with the Sanger sequencing samples. It can be seen that the detection method based on the chain displacement probe in the present invention and the Sanger sequencing method have high consistency, and the sensitivity and specificity can reach 100% and 100% respectively.

[0035] (4) The detection method constructed based on the composition for detecting IDH1 mutation provided by the present invention has a simple and rapid detection process and does not require complicated equipment, which provides strong technical support for the early diagnosis and personalized treatment of brain glioma. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the reaction between the mutant DNA chain, the auxiliary chain and the strand displacement probe;

[0037] Figure 2 Schematic diagram of the reaction between the wild-type DNA chain, the auxiliary chain and the strand displacement probe;

[0038] Figure 3 The fluorescence curves triggered by different targets are shown in Figure 1. ① is the MT group, ② is the MT group without open chain, ③ is the WT group, ④ is the negative sample group, and ⑤ is the blank group.

[0039] Figure 4 The melting curve is used to analyze the effect of λ enzyme digestion;

[0040] Figure 5 The fluorescence signals are shown for different amounts of λ exonuclease added;

[0041] Figure 6 The fluorescence signals at different strand displacement probe concentrations are shown;

[0042] Figure 7 The fluorescence signals at different magnesium ion concentrations;

[0043] Figure 8 The fluorescence signals at different enzyme digestion times;

[0044] Figure 9The real-time fluorescence quantitative curves of PCR triggered by different concentrations of targets are shown in the figure. From left to right, the curves are 100p, 10p, 1p, 100f, 10f, and N groups, respectively.

[0045] Figure 10 To detect the fluorescence signals of targets with different abundances;

[0046] Figure 11 The normalized signal was linearly correlated with the mutation abundance from 0.1% to 10%;

[0047] Figure 12 is the normalized signal in glioma samples from two clinical cohorts;

[0048] Figure 13 is a ROC curve for determining the diagnostic accuracy of the present invention;

[0049] Figure 14 The sensitivity and specificity of the present invention compared with Sanger sequencing in brain glioma samples were evaluated using a confusion matrix. DETAILED DESCRIPTION

[0050] The examples are provided to better illustrate the present invention, but are not intended to limit the present invention to the examples. Therefore, non-essential improvements and adjustments to the embodiments made by those skilled in the art based on the above-mentioned invention still fall within the scope of protection of the present invention.

[0051] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "comprise" and the like are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0052] An embodiment of the present invention provides a composition for detecting IDH1 mutations, comprising strand displacement probes (including probe T and probe D) and an auxiliary chain, wherein the sequences of the strand displacement probes are shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the sequence of the auxiliary chain is shown in SEQ ID NO: 3.

[0053] It should be noted that the detection principle of the composition of the present invention includes: introducing an auxiliary chain in the chain displacement reaction, which can block the mutation corresponding site of the wild-type DNA chain, resulting in the shortening of the toehold domain and the branch migration domain by 3 nucleotides each, and the extension of the association domain by 3 nucleotides. After the initial base of the branch migration domain undergoes a breathing process, the intermediate of the three-way connection structure formed by the binding of the toehold domain can continue to move forward. However, due to the low probability of base breathing, this will lead to an increase in the transition state energy barrier, thereby significantly inhibiting the reaction rate. In contrast, the mutant DNA chain completes the chain displacement reaction along the normal reaction path; this design realizes dual thermodynamic and kinetic selection: thermodynamically, the reaction shows a significant increase in ΔΔG; kinetically, the increase in energy barrier will cause the wild-type target to fall into a kinetic trap, resulting in a significant difference in reaction rate; thereby achieving the distinction between wild-type DNA chains and mutant DNA chains. The specific detection principle diagram is shown in the figure below. Figure 1 and Figure 2 As shown, the details are as follows:

[0054] When the target strand is a mutant DNA strand, fragment 2* in the auxiliary strand (2*+3*) is complementary to fragment 2 of the mutant DNA strand (excluding the mutation site). When the mutant DNA strand, strand displacement probe, and auxiliary strand are mixed, fragment 2* of the auxiliary strand and fragment 2 of the mutant DNA strand combine to form an intermediate. Because fragment 1 of the mutant DNA strand is complementary to fragment 1* of probe T in the probe T-probe D complex (i.e., a strand displacement probe, wherein probe T comprises fragment 1* (toehold), an association domain, and fragment 3 (branch migration domain), and probe D comprises fragment 3 and carries a fluorescence quencher; probe D comprises fragment 3* and carries a fluorescence reporter), fragment 1 in the intermediate combines with fragment 1* of probe T, and strand displacement begins with fragment 1* as a toehold. Before strand displacement, the fluorescence quencher and the fluorescence reporter in the probe T-probe D complex are adjacent, and no fluorescence is generated. When the auxiliary strand displaces probe T, the fluorescent group in probe T is freed and moves away from probe D, which carries the fluorescence quencher, thereby generating fluorescence.

[0055] When the target chain is a wild-type DNA chain, the 2* fragment in the auxiliary chain (2*+3*) combines with the wild-type DNA chain (including the mutation corresponding site) to form an intermediate. In the intermediate, the base fragment "CTTGATCCCCATAAGCATGACGA" in the auxiliary chain and the base fragment "TC G TCATGCTTATGGGGATCAAG ( GThe toehold (fragment 1*) and branch migration domain (fragment 3) on probe D are both reduced by 3 bases, while the association domain (semicircle) increases by 3 bases (TGA). This results in the first base of the branch migration domain having to undergo respiration for the reaction to proceed. However, due to the low probability of respiration, the wild-type target falls into a kinetic trap, unable to achieve chain displacement and thus producing no fluorescence.

[0056] Based on the above principle, when the target is connected to a wild-type DNA chain, no fluorescence (or a trace amount of fluorescence) is generated, and when the target is connected to a mutant DNA chain, a large amount of fluorescence is generated, thereby distinguishing the wild-type DNA chain from the mutant DNA chain.

[0057] In some specific examples, in the above composition, the 5' end of the strand displacement probe shown in SEQ ID NO: 1 is connected to a fluorescent quenching group, and the 3' end of the strand displacement probe shown in SEQ ID NO: 2 is connected to a fluorescent reporter group.

[0058] It should be noted that the fluorescent quenching group connected to the 5' end of the strand displacement probe as shown in SEQ ID NO: 1 is well known in the art, such as BHQ1, BHQ2, BHQ3, QSY7 or QSY21; the fluorescent reporter group connected to the 3' end of the strand displacement probe as shown in SEQ ID NO: 2 is well known in the art, such as FAM, ROX, HEX, JOE or Cy5.

[0059] In some specific examples, the above composition further comprises:

[0060] An open chain, the sequence of which is shown in SEQ ID NO: 4; and / or

[0061] Metal cations.

[0062] It should be noted that the composition of the present invention may also include an open chain. Specifically, by introducing an open chain to reduce the effect of the ssDNA secondary structure on the reaction, the fluorescence intensity of the reaction is significantly enhanced and the reaction speed is accelerated. In addition, the present invention may also include metal cations, which can promote nucleic acid hybridization and improve reaction efficiency. Metal cations are well known in the art, such as magnesium ions, sodium ions, or potassium ions. It should be understood that the method of adding metal cations is generally to add corresponding salts, such as magnesium acetate, magnesium chloride, sodium chloride, or potassium chloride. In addition, the composition of the present invention may include both open chains and metal cations, or only one of them. Preferably, both open chains and metal cations are included, which can reduce detection time and improve detection accuracy.

[0063] An embodiment of the present invention further provides a detection reagent for detecting IDH1 mutations. The detection reagent comprises the composition of the present invention and an exonuclease, wherein the exonuclease is used to enzymatically cut the amplified double-stranded DNA product into single-stranded DNA.

[0064] It should be noted that the type of exonuclease can be selected according to the modification type of the primer of the amplified product. For example, if the primer is modified with phosphorothioate, T7 exonuclease can be used. For another example, if the primer is modified with phosphate, λ exonuclease can be used.

[0065] In some specific examples, the above-mentioned detection reagent also includes a PCR amplification primer pair.

[0066] It should be noted that the composition of the present invention can be combined with auxiliary detection reagents to form a detection reagent for detecting IDH1 mutations. The detection reagent may include a PCR amplification primer pair and / or a lambda exonuclease. Specifically, the DNA sample can be amplified before testing. In addition, using lambda exonuclease to cleave the PCR amplification product into single strands before testing can increase the fluorescence intensity and improve detection accuracy.

[0067] In some specific examples, in the above detection reagent, the sequences of the PCR amplification primer pair are shown as SEQ ID NO: 5 and SEQ ID NO: 6.

[0068] It should be noted that the primer pair for PCR amplification of the IDH1 mutant gene in the present invention can be designed according to primer design methods known in the art, preferably the primers shown in SEQ ID NO: 5 and SEQ ID NO: 6. PCR amplification mediated by this primer pair can easily amplify and detect DNA samples as low as 10 fM.

[0069] An embodiment of the present invention further provides a product for diagnosing IDH1 gene mutation brain glioma, comprising the composition of the present invention or the detection reagent of the present invention.

[0070] It should be noted that the composition and detection reagent of the present invention can be used to diagnose IDH1 gene mutation brain glioma. The composition and detection reagent can be prepared into a product for diagnosing IDH1 gene mutation brain glioma. The product can be in the form of a reagent or a kit; in addition, the product can also include reagents for pre-treating the sample to be tested (blood or corresponding tissue), such as reagents for extracting genomic DNA from the sample to be tested.

[0071] An embodiment of the present invention further provides a use of the composition of the present invention or the detection reagent of the present invention in preparing a product for diagnosing brain glioma with IDH1 gene mutation, wherein the IDH1 gene mutation is R132H mutation.

[0072] It should be noted that, as mentioned above, the product for diagnosing IDH1 gene mutation glioma may include a reagent or a kit, and the specific product form can be selected according to specific needs.

[0073] The present invention also provides a method for detecting an IDH1 mutation for non-diagnostic purposes, wherein the IDH1 gene mutation is an R132H mutation, and the method is any one of the following methods:

[0074] (i) The method comprises: using the composition of the present invention to perform detection, including: mixing the sample DNA to be detected and the composition to react; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation; the sample DNA to be detected is a single-stranded DNA sample;

[0075] (ii) The method comprises: using the detection reagent of the present invention to perform detection, including: amplifying the sample DNA to be detected using a PCR amplification primer pair to obtain a PCR amplification product; enzymatically digesting the PCR amplification product using a lambda exonuclease to obtain a digestion product; mixing the digestion product with the composition to react; monitoring the fluorescence intensity during the reaction to determine the IDH1 mutation status; the sample DNA to be detected is a double-stranded DNA sample.

[0076] It should be noted that the above-mentioned different detection methods can be selected for different detection requirements. In addition, for applications of detecting IDH1 mutations for non-diagnostic purposes, they can be used in vitro to detect IDH1 mutations and study the changes in related signaling pathways caused by IDH1 mutations.

[0077] It should also be noted that in the above-mentioned method for detecting IDH1 mutations, the mutation site of the wild-type target will be blocked by the auxiliary chain, thereby failing to trigger the generation of fluorescence; in contrast, the mutant target can trigger fluorescence normally.

[0078] In some specific examples, in method (ii) of the above method, in the mixture of the digestion product and the composition:

[0079] The concentration of the strand displacement probes as shown in SEQ ID NO: 1 and SEQ ID NO: 2 is 25 nM to 250 nM, respectively; for example, 50 nM, 75 nM, 90 nM, 115 nM, 125 nM, 150 nM, 175 nM, 190 nM, 215 nM or 225 nM, etc.; and

[0080] The concentration of the auxiliary chain is 25 nM-250 nM, such as 50 nM, 75 nM, 90 nM, 115 nM, 125 nM, 150 nM, 175 nM, 190 nM, 215 nM or 225 nM; and

[0081] The concentration of the open chain is 0-250 nM, such as 5 nM, 25 nM, 50 nM, 75 nM, 90 nM, 115 nM, 125 nM, 150 nM, 175 nM, 190 nM, 215 nM or 225 nM; and / or

[0082] The concentration of MgCl2 is 0-20 mM, such as 5 mM, 10 mM or 15 mM.

[0083] In some specific examples, in method (ii) of the above method:

[0084] In the PCR amplification system, the concentration of the sample DNA to be detected is 100 ng / μL-400 ng / μL, such as 150 ng / μL, 200 ng / μL, 250 ng / μL, 300 ng / μL or 350 ng / μL; and / or

[0085] In the PCR amplification system, the concentration of the PCR amplification primer pair is 120 nM-130 nM, such as 123 nM, 125 nM, 128 nM or 129 nM.

[0086] It should also be noted that fluorescent dyes may be added to the PCR amplification system in the above method (ii) to achieve real-time quantitative PCR (qPCR) detection. Fluorescent dyes are well known in the art.

[0087] In some specific examples, in method (ii) of the above method: the volume ratio of λ exonuclease to PCR amplification product is (0.5-1.5):10, such as 0.7:10, 1:10 or 1.3:10.

[0088] It should be noted that in the above method (ii), when the λ exonuclease is mixed with the PCR amplification product, an enzyme buffer can be further added. The enzyme buffer is well known in the art, and the ratio of the added volume to the volume of the PCR amplification product is (0.5-1.5):10, for example, 0.7:10, 1:10 or 1.3:10. In addition, the λ exonuclease reaction time can be ≥10 min, generally 10 min-40 min, for example, 20 min, 25 min or 30 min.

[0089] In some specific examples, in the above method, the IDH1 gene mutation is an R132H mutation.

[0090] In order to better understand the present invention, the content of the present invention is further explained below with reference to specific examples, but the content of the present invention is not limited to the following examples.

[0091] In the following example, genomic DNA (gDNA) was extracted from tissue samples using a commercial genomic DNA extraction kit (AmoyBio-Xiamen) (refer to the kit instructions for extraction methods). The extracted DNA concentration was also measured using a NanoDrop.

[0092] In the following examples, the fluorescence signal was monitored using a centrifugal real-time PCR instrument (Rotor-Gene 6000 (CorbettResearch, Mortlake, Australia).

[0093] In the following examples, the wild-type IDH1 plasmid (IDH1-wt) and the R132H mutant IDH1 plasmid were purchased from Sangon Biotech (Shanghai) Co., Ltd., and their nucleic acid sequences are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

[0094] In the following examples, the specific information of the sequences involved is shown in Table 1. In addition, the sequences involved were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0095] Table 1 Detailed information of the sequences involved

[0096]

[0097] 1. Combination of test reagents for detecting IDH1 mutations

[0098] Example 1

[0099] In the embodiments of the present invention, the detection reagents used to detect IDH1 mutations are shown in Table 2 below.

[0100] Table 2 Detection reagents in Example 1

[0101]

[0102] Example 2

[0103] The difference between Example 2 and Example 1 is that the detection reagent of the embodiment of the present invention does not contain an open chain, and the rest is the same as Example 1.

[0104] Example 3

[0105] The difference between Example 3 and Example 1 is that the detection reagent of the present invention does not contain λ exonuclease, and the rest is the same as Example 1.

[0106] Example 4 to Example 12

[0107] The difference between Examples 4 to 12 and Example 1 is that the amount of λ exonuclease added, the concentrations of probe T and probe D, and the MgCl2 concentration in the detection reagent are different, and the rest are the same as Example 1; the amount of each substance added in the detection reagent of Examples 4 to 12 is shown in Table 3 below.

[0108] Table 3 Addition amount of the above substances in Examples 4 to 12

[0109]

[0110] Comparative Example 1

[0111] The difference between Comparative Example 1 and Example 1 is that the detection reagent in Comparative Example 1 of the present invention only contains strand displacement probes (probe T and probe D) and lambda exonuclease, and the concentrations are the same as in Example 1.

[0112] Comparative Example 2

[0113] The difference between Comparative Example 2 and Example 1 is that the detection reagent of Comparative Example 2 of the present invention does not contain an auxiliary chain, and the rest is the same as Example 1.

[0114] Detection reagent effectiveness test

[0115] The effects of the detection reagents of Examples 1 to 12 and Comparative Example 1 were verified according to the following detection methods, as follows:

[0116] (1) PCR amplification

[0117] The DNA sample to be tested was amplified using a PCR amplification kit (Shanghai Sangon Biotech Co., Ltd., Catalog No. B639274-0001) (the amplification method was carried out according to the kit instructions) to obtain a PCR amplification product. The PCR amplification system included the DNA sample to be tested, PCR Mix, forward and reverse primers, and SYBR Green mix. The PCR amplification program was as follows: 95°C for 3 min; 95°C for 10 s; and 60°C for 30 s.

[0118] (2) Enzyme digestion of amplified products

[0119] Add λ exonuclease (λexo) and enzyme buffer (buffer provided with λ exonuclease purchased from NEB) to 10 μL of PCR amplification product, and then gently mix by pipetting to obtain a mixed solution; after incubating the mixed solution at 37°C for 30 minutes, heat to 85°C and maintain for 10 minutes to inactivate the enzyme, and then cool back to room temperature to obtain the digestion product.

[0120] (3) Detection using test reagents

[0121] Probe T, probe D, open strand, auxiliary strand, and MgCl2 were added to 10 μL of the digestion product and made up to 20 μL with TEM (triethylene glycol monomethyl ether).

[0122] (4) Fluorescence signal monitoring

[0123] Monitor the changes in the fluorescence signal of the system (normalized signal) and detect the IDH1 mutation in the sample by analyzing the fluorescence value.

[0124] The specific results are as follows:

[0125] First, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested using the detection reagents of Example 1 and Example 2 according to the above-mentioned detection method, respectively, and recorded as the MT group (Example 1) and the MT group without open chain (Example 2);

[0126] In addition, the wild-type IDH1 plasmid was used as the DNA sample to be tested and detected using the detection reagent of Example 1 according to the above detection method, which was recorded as the WT group;

[0127] In addition, the detection reagent of Example 1 was used without adding DNA sample and tested according to the above detection method, which was recorded as the negative sample group;

[0128] In addition, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested and the detection reagent of Comparative Example 1 was used to detect according to the above detection method, which was recorded as the blank group;

[0129] The changes in the fluorescence signals (normalized signals) detected above are as follows: Figure 3 As shown, the results showed that the WT group showed very little fluorescence increase, and the MT group without an open chain showed an obvious fluorescence increase, but the kinetics was slow. When an open chain was introduced (MT group), the fluorescence was significantly enhanced, indicating that the introduction of an open chain can reduce the effect of ssDNA secondary structure on the reaction, thereby increasing the reaction efficiency.

[0130] Secondly, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested using the detection reagents of Example 1 and Example 3 according to the above detection method; the melting curves obtained by the detection reagents of Example 3 (untreated with λ exonuclease) and Example 1 (treated with λ exonuclease) were compared, and the results were as follows: Figure 4 As shown in the figure, the melting curves showed that the products of different PCRMIXs had distinct melting peaks (Tm value was 83°C). After cleavage by λ exonuclease, the melting peak dropped sharply, indicating that λ exonuclease successfully cleaved the 5′-phosphorylated chain.

[0131] Thirdly, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested using the detection reagents of Example 1 and Examples 4 to 6 according to the above detection method. The detected fluorescence signals (normalized signals) were as follows: Figure 5 As shown, the results show that when the amount of λ exonuclease added is 1 μL, the fluorescence signal is the strongest, that is, the amount of λ exonuclease added in the present invention can preferably be 1 μL.

[0132] Fourthly, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested using the detection reagents of Example 1 and Examples 7 to 9 according to the above detection method. The detected fluorescence signals (normalized signals) were as follows: Figure 6 As shown in the figure, the results show that different probe concentrations all have strong fluorescence signals, and the fluorescence signal increases with the increase of probe concentration.

[0133] Fifth, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested using the detection reagents of Example 1 and Examples 10 to 12 according to the above detection method. The detected fluorescence signals (normalized signals) were as follows: Figure 7 As shown in the figure, the results show that different MgCl2 concentrations all have strong fluorescence signals, and the fluorescence signal increases with the increase of MgCl2 concentration.

[0134] Sixth, the R132H mutant IDH1 plasmid and the wild-type IDH1 plasmid were used as DNA samples to be tested, respectively, using the detection reagent of Comparative Example 2 according to the above-mentioned detection method. The test results showed that there was no obvious difference in the fluorescence intensity of the two, indicating that without adding the auxiliary chain, the R132H IDH1 mutation detection cannot be achieved.

[0135] In addition, the R132H mutant IDH1 plasmid was used as the DNA sample to be tested and the detection reagent of Example 1 was used to perform the detection according to the above detection method, wherein the enzyme cleavage time in step (2) was set to 10 min, 20 min, 30 min and 40 min respectively. The changes in the fluorescence signal (normalized signal) at different enzyme cleavage times are shown in Figure 2. Figure 8 As shown, the results showed that different enzyme digestion times had little effect on the change of fluorescence signals.

[0136] 2. Testing of detection reagents and detection methods

[0137] (I) Sensitivity test of PCR amplification primer pairs in the detection method

[0138] The R132H mutant IDH1 plasmid was diluted to different concentrations (the diluent was Sangon DNA diluent) as the DNA sample to be tested, and then amplified according to the above detection method step (2) to test the sensitivity of the PCR amplification primers; and a control group (N) was used without adding DNA sample.

[0139] The real-time fluorescence curve during PCR amplification is as follows Figure 9 As shown ( Figure 9 In the table, 10f represents 10 fM, 100f represents 100 fM, and so on), the results showed that PCR mediated by phosphate-modified primers can easily detect plasmid targets as low as 10 fM.

[0140] (II) Detection limit test of detection method

[0141] In the following tests, mutation abundance refers to the proportion of the R132H mutant IDH1 plasmid in the mixed DNA sample. For example, a mutation abundance of 0.1% means that in a 1000μL mixed DNA sample, the R132H mutant IDH1 plasmid is 1μL and the wild-type IDH1 plasmid is 999μL. A mutation abundance of 0.5% means that in a 1000μL mixed DNA sample, the R132H mutant IDH1 plasmid is 5μL and the wild-type IDH1 plasmid is 995μL; and so on.

[0142] The R132H mutant IDH1 plasmid and the wild-type IDH1 plasmid were mixed in different proportions to prepare mixed DNA samples with different mutation abundances (0.1%, 0.5%, 1%, 5%, 10% and 100%) as the DNA samples to be tested. Then, the fluorescence signal (normalized signal) of the DNA samples with different mutation abundances was detected using the detection reagent of Example 1 according to the test method for verifying the effect of the detection reagent (mt). In addition, the wild-type IDH1 plasmid was used as the DNA sample to be tested, and the fluorescence signal (normalized signal) was detected using the detection reagent of Example 1 according to the detection method of the above-mentioned detection reagent as the baseline (wt).

[0143] Test results such as Figure 10 As shown in the figure, the results show that when the mutation abundance is 0.1%, the mt fluorescence signal value is still stronger than the wt value, indicating that the mutation can still be detected when the abundance is 0.1%.

[0144] In addition, the relationship between the normalized signal change and the change in mutation abundance from 0.1% to 10% is shown in Figure 11 As shown, the results showed that the normalized signal was linearly correlated with the mutation abundance from 0.1% to 10%.

[0145] (3) Multiple sample testing

[0146] A commercial genomic DNA extraction kit was used to extract genomic DNA from 95 brain glioma samples as the test DNA samples. The 95 test DNA samples were tested using the detection reagent in Example 1 according to the above detection method (the above method for verifying the effectiveness of the detection reagent). The test results were divided into two clinical cohorts, of which 38 were positive samples (R132H type IDH1 mutation) and 57 were negative samples (IDH1 wild type). The changes in the fluorescence signals (normalized signals) of the brain glioma samples in the two clinical cohorts are shown in Figure 2. Figure 12 The results showed that the normalized fluorescence value of the positive samples was significantly higher than that of the negative samples.

[0147] In addition, the receiver operating characteristic (ROC) curve was drawn using GraphPad using the detection results of the brain glioma samples from the above two clinical cohorts. The results are as follows: Figure 13 As shown, the results showed that the area under the receiver operating characteristic (ROC) curve (AUC) was 1.

[0148] Furthermore, the Sanger sequencing method was used to sequence the brain glioma samples of the two clinical cohorts. The sequencing results showed that 38 positive samples were R132H mutant IDH1 mutation samples, and 57 negative samples did not detect R132H mutation. The results were compared with the results of the detection reagent in Example 1 according to the above detection method using a confusion matrix. The results are as follows: Figure 14 As shown, the results show that the detection results of the detection method of Example 1 are consistent with the Sanger sequencing results, indicating that the sensitivity and specificity of the detection method of Example 1 are 100% and 100%, respectively (wherein the true positive rate represents the sensitivity (upper left of the rectangular graph), and the true negative rate represents the specificity (lower left of the rectangular graph)).

[0149] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be covered by the scope of the claims of the present invention.

Claims

1. A composition for detecting IDH1 mutations, comprising a strand displacement probe and an auxiliary chain, wherein the sequences of the strand displacement probe are shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the sequence of the auxiliary chain is shown in SEQ ID NO:

3.

2. The composition according to claim 1, characterized in that The 5' end of the strand displacement probe as shown in SEQ ID NO: 1 is connected to a fluorescent quenching group, and the 3' end of the strand displacement probe as shown in SEQ ID NO: 2 is connected to a fluorescent reporter group.

3. The composition according to claim 1 or 2, characterized in that The composition further comprises: An open chain, the sequence of which is shown in SEQ ID NO: 4; and / or Metal cations.

4. A detection reagent for detecting IDH1 mutation, characterized in that: The detection reagent comprises the composition according to any one of claims 1 to 3 and an exonuclease, wherein the exonuclease is used for enzymatically cleaving the amplified double-stranded DNA product into single-stranded DNA.

5. The detection reagent according to claim 4, characterized in that The detection reagents also include PCR amplification primer pairs.

6. The detection reagent according to claim 5, characterized in that The sequences of the PCR amplification primer pair are shown in SEQ ID NO: 5 and SEQ ID NO:

6.

7. A product for diagnosing IDH1 gene mutation glioma, characterized in that: The method comprises the composition according to any one of claims 1 to 3 or the detection reagent according to any one of claims 4 to 6.

8. Use of the composition according to any one of claims 1 to 3 or the detection reagent according to any one of claims 4 to 6 in the preparation of a product for diagnosing brain glioma with IDH1 gene mutation, wherein the IDH1 gene mutation is R132H mutation.