Capture probe, kit containing capture probe and application of capture probe in detection of T cell and B cell immune repertoire under spatial resolution

Abstract

The invention belongs to the technical field of biological detection, and relates to a capture probe, a kit comprising the same and application of the capture probe in detection of T cell and B cell immune repertoire under spatial resolution. The capture probe comprises a transcript specific sequence; the transcript specific sequence is derived from the front 40 bp of a reverse complementary sequence of a J region transcript sequence, and the length of the transcript specific sequence is 20-35 bp. The advantages of using the capture probe to detect T cell and B cell immune repertoire under spatial resolution include that not all RNA with poly A tail is reversely transcribed, but only targeted RNA is reversely transcribed, so that the sequencing cost is remarkably reduced, and the detection is not limited by the poly A degradation degree of RNA in a sample.

Description

Technical Field

[0001] This application relates to the field of biological detection technologies, and particularly to capture probes, kits containing the same, and their use in detecting T cell and B cell immunoglobulin repertoires at spatial resolution. Background Art

[0002] Biological systems are inherently spatially organized, and cell interactions and molecular processes occur in specific spatial environments. Adaptive immune functions rely on T cells and B cells in spatial environments, including antigen-stimulated expansion and cytotoxicity. Previous studies have attempted to sequence spatial immune receptors in fresh samples at a low resolution of 55 μm. However, the combined analysis of high-resolution spatial transcriptomes and TCR (T Cell Receptor) and BCR (B Cell Receptor) immune receptors has not been explored in depth. In addition, paraffin-embedded clinical samples cannot be captured by existing techniques. Simultaneously detecting gene expression reflected by spatial transcriptomes, T / BCR immunoglobulin repertoires, etc. in spatially high-resolution sections has important value for studying spatial biology.

[0003] Existing CDR3 (Complementary Determining Region 3) region sequencing methods use polymerase chain reaction (PCR)-based RNA-seq (RNA sequencing) techniques. mRNA is captured by poly A probes for reverse transcription, and then nested PCR is used to amplify on full-length cDNA. This method is also called RACE (Rapid Amplification of cDNA Ends) technology. These methods are limited to non-degraded samples in which mRNA retains the poly A tail for universal reverse transcription. However, clinical samples are usually fixed with formalin and stored at room temperature, resulting in severe degradation of mRNA, so no existing technique can be used for sequencing.

[0004] Existing techniques use a low resolution of 55 μm for capture, making it difficult to apply to the precise analysis of biological tissues with complex and variable structures such as tumors and the analysis at single-cell resolution.

[0005] In addition, due to the limitations of next-generation sequencing (NGS), nested PCR after reverse transcription aims to shorten the length of the cDNA library and construct a library starting from near the CDR3 region.

[0006] Therefore, there is an urgent need in the art to develop new methods for detecting T cell and B cell immunoglobulin repertoires. Summary of the Invention

[0007] Based on this, it is necessary to provide at least one capture probe, a kit containing the same, and their use in detecting T cell and B cell immunoglobulin repertoires at spatial resolution.

[0008] In a first aspect of the present application, capture probes for detecting T cell and B cell immune repertoires at spatial resolution are provided, and the capture probes comprise transcript-specific sequences;

[0009] The transcript-specific sequences are derived from the first 40 bp of the reverse complementary sequence of the transcript sequences of the J or V region genes of TCR and BCR, and have a length of 20 bp to 35 bp;

[0010] The J region transcript sequence is derived from the Framework-4 (FR4) region;

[0011] The V region transcript sequence is derived from the Framework-2 (FR2) region and the Framework-3 (FR3) region.

[0012] In some embodiments, the J-region transcript sequences are selected from the group consisting of 5863, 5864, 5865, 5866, 5867, 5868, 5869, 5719, 5720, 5721, 5722, 5723, 5532, 5533, 5534, 5535, 5536, 5536, 5537, 5538, 5538, 5539, 5540, 5540, 5540, 5540, 5540, 5540, 12277, 12278, 12279, 12280, 12281, 12257, 12258, 12259, 12260, 12162, 12163, 12164, 12165, 12166, 12167, 12167, 12168, 12169, 12170, 12171, 12172, 12173, 12174, 12175, 12037, 12038, 12039, 12040, 12041, 12041, 12042, 12043, 12044, 12044, 12045, 12046, 12047, 12048, 12049, 12050, 12051, 12051, 12052, 12053, 12054, 12055, 12055, 12056, 12057, 12058, 12059, 12060, 12061, 12062, 12063, 12064, 12065, 12066, 12067, 12067, 12068, 12069, 12069, 12070, 12071, 12072, 12072, 12073, 12073, 12074, 12075, 12075, 12076, 12077, 12078, 12079, 12080, 12081, 12082, 12083, 12084, 12085, 12086, 12087, 12088, 12089, 12090, 12091, 12092, 12093, 12094, 12095, 12096 and 12097.

[0013] In some embodiments, the V-region transcript sequence is selected from those with ID numbers such as 5550, 5552, 5559, 5546, 5547, 5548, 5549, 5551, 5553, 5554, 5555, 5556, 5557, 5558, 5562, 49601, 38040, 5576, 5574, 5575, 5577, 49602, 5613, 5620, 5628, 5580, 5581, 5582, 5583, 5584, 5585, 5586, 5587, 5588, 5589, 5590, 5591, 5592, 5593, 5594, 5595, 5596, 5597, 5598, 5599, 5600, 5601, 5602, 5603, 5604, 50322, 5605, 5606, 5607, 5608, 5609, 5610, 5611, 5612, 5614, 5615, 5616, 5617, 49603, 5618, 5619, 5621, 5622, 5623, 5624, 5625, 5626, 5627, 5652, 5645, 5647, 5648, 5649, 5650, 5657, 5651, 5653, 5654, 5655, 5656, 5661, 5659, 5660, 5662, 5665, 5663, 5664, 5666, 5667, 5669, 5704, 5671, 5673, 5676, 5678, 5683, 5684, 5685, 5687, 5688, 5695, 5703, 5694, 5698, 5706, 5709, 5741, 5742, 5743, 5744, 5730, 5731, 5732, 5733, 5734, 5735, 5736, 5737, 5738, 5739, 5740, 5759, 5746, 5747, 5748, 5749, 5750, 5751, 5752, 5753, 5754, 5755, 5756, 5757, 5758, 5788, 5776, 5777, 5778, 5780, 5781, 5782, 5783, 5784, 5785, 5789, 5792, 5793, 5794, 5797, 5798, 5799, 5800, 5801, 5804, 5821, 5815, 5816, 5817, 5818, 5819, 5820, 5829, 5823, 5824, 5825, 5834, 5835, 5836, 5837, 5838, 5839, 5876, 5877, 5878, 5879, 5880, 5881, 5882, 5894, 5895, 5887, 5888, 5889, 5890, 5891, 5892,5893、5896、5904、5915、5918、5897、5898、5899、5901、5903、5905、5906、5908、5910、5911、5912、5913、5914、5919、5920、5921、5922、5924、5925、5926、5927、5929、5930、5931、5933、5884、5885、5886、5936、5938、5940、5941、5943、5944、12101、12102、12116、12128、12140、12143、12144、12145、12146、12147、12148、12149、12150、12151、12152、12153、12154、12103、12104、12105、12106、12107、12108、12109、12110、12111、12112、12113、12114、12115、12117、12118、12119、12120、12121、12122、12123、12124、12125、12126、12127、12129、12130、12131、12132、12133、12134、12135、12137、12138、12139、12141、12142、12262、12263、12264、12176、12195、12212、12213、12215、12216、12217、12218、12219、12220、12221、12222、12223、12224、12225、12226、12227、12228、12229、12230、12231、12232、12233、12234、12235、12236、12237、12238、12239、12240、12241、12242、12243、12245、12246、12177、12178、12179、12180、12181、12182、12183、12184、12185、12186、12187、12188、12189、12190、12191、12192、12193、12194、12196、12198、12200、12201、12203、12205、12207、12208、12209、12210、12214、12284、12287、12288、12289、12290、12291、12292、12293、12294、12295、12285、12286、A group consisting of the sequences shown in 12296 and 12297.

[0014] In some embodiments, the transcript-specific sequence is as shown in any one of SEQ ID NO: 2 to SEQ ID NO: 854.

[0015] In some embodiments, the capture probe further comprises a sequence required for high-throughput sequencing.

[0016] In some embodiments, the sequence required for high-throughput sequencing is linked to the 5'-end or 3'-end of the transcript-specific sequence.

[0017] In some embodiments, the length of the sequence required for high-throughput sequencing is 21 bp.

[0018] In some embodiments, the sequence required for high-throughput sequencing is as shown in SEQ ID NO: 1.

[0019] In the second aspect of the present application, there is provided a probe composition comprising the capture probe as described in the first aspect.

[0020] In some embodiments, the probe composition further comprises a whole-transcriptome probe.

[0021] In the third aspect of the present application, there is provided a kit comprising one or more of the capture probe as described in the first aspect and the probe composition as described in the second aspect.

[0022] In some embodiments, the kit further comprises reagents for reverse transcription and reagents for adding a poly A tail.

[0023] In the fourth aspect of the present application, there is provided a method for constructing a sequencing library for detecting T cell and B cell immune repertoires at spatial resolution, the method comprising:

[0024] Probe hybridization: Mixing a tissue section and the probe composition as described in the second aspect to obtain tissue 1 after probe hybridization;

[0025] Reverse transcription: Mixing the tissue 1 with a whole-transcriptome probe to obtain tissue 2 after ligation of the whole-transcriptome probe, and performing reverse transcription on the capture probe in the tissue 2 to obtain tissue 3 containing cDNA;

[0026] Adding a poly A tail: Adding a poly A tail to the cDNA to obtain tissue 4 containing cDNA with a poly A tail;

[0027] Chip hybridization: Mix the chip carrying DNA oligonucleotides encoding spatial position information with the tissue 4 to capture the whole transcriptome probes and the cDNA with a poly A tail, and perform pre-amplification and amplification successively to construct a sequencing library.

[0028] In some embodiments, the working concentrations of the capture probes and the human whole transcriptome probes in the probe composition are each independently 1 nM to 100 nM.

[0029] In some embodiments, the tissue section is a preserved tissue section.

[0030] In some embodiments, the thickness of the tissue section is 1 μm to 50 μm.

[0031] In the fifth aspect of the present application, a method for detecting T cell and B cell immune repertoires at spatial resolution is provided, and the method includes:

[0032] Constructing a sequencing library: Construct a sequencing library using the method described in the fourth aspect;

[0033] Sequencing: Sequence the sequencing library.

[0034] In some embodiments, in the step of sequencing, next-generation sequencing technology is used for sequencing.

[0035] The direct targeting capture and reverse transcription adopted in the above method are superior to the existing methods at least in the following aspects:

[0036] First, not all RNAs with a poly A tail will be reverse transcribed, only the targeted RNAs will be reverse transcribed, so the sequencing cost will be significantly reduced;

[0037] Second, even if the poly A tail has degraded, the fragmented RNAs remaining in the formalin-fixed clinical samples can still be captured;

[0038] Finally, the region and length of the cDNA can be restricted to the target region, which is convenient for NGS to perform sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions in the embodiments and examples of the present application and to more fully understand the present application and its beneficial effects, the following will briefly introduce the drawings required to be used in the description of the embodiments or examples. Obviously, the following drawings are only some embodiments of the present application. For those skilled in the art, without creative efforts, other drawings can be obtained based on these drawings. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.

[0040] Figure 1 This is a schematic diagram of the probe-based human immune receptor repertoire sequence capture and sequencing mode in one embodiment of the present application.

[0041] Figure 2 A schematic diagram showing the mapping of the spatially captured human immune receptor repertoire sequences in one embodiment of the present application to the human CDR3 region.

[0042] Figure 3 A spatially visualized result showing the capture of BCR sequences by specific probes in one embodiment of the present application.

[0043] Figure 4 A spatially visualized result showing the capture of TCR sequences by specific probes in one embodiment of the present application.

[0044] Figure 5 A comparison result showing the capture of an exemplary BCR transcript by specific probes in one embodiment of the present application.

[0045] Figure 6 A comparison result showing the capture of an exemplary BCR transcript by specific probes in one embodiment of the present application.

[0046] Figure 7 A spatially visualized result showing the capture of the CDR1 sequence of BCR by specific probes in one embodiment of the present application.

[0047] Figure 8 A spatially visualized result showing the capture of the CDR2 sequence of BCR by specific probes in one embodiment of the present application. Detailed implementation manners

[0048] For ease of understanding the present application, the present application will be described more comprehensively below with reference to the relevant drawings. Preferred embodiments of the present application are shown in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The terms used in the specification of this application herein are only for the purpose of describing specific embodiments and are not intended to limit this application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0050] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, in other cases where "one or more" or other expressions indicating "one or more" are used, unless otherwise specified, the same understanding shall apply.

[0051] In this application, "its combination", "any combination thereof", "any combination mode thereof", etc. include all suitable combination modes of any two or more than two items among the listed items.

[0052] In this application, "suitable" in "suitable combination mode", "suitable mode", "any suitable mode", etc. shall be based on being able to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0053] In this application, terms such as "further", "furthermore", "especially", "for example", "such as", "example", "exemplification", etc. are used for descriptive purposes, indicating that there is an association in the covered content between the previous and the subsequent different technical solutions, but should not be understood as a limitation on the previous technical solution, nor as a limitation on the protection scope of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0054] In this application, "optionally", "optional", "option", mean that it can be either present or absent, that is, it refers to any one of the two parallel options of "present" or "absent". If "optional" appears multiple times in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction relationship, each "optional" is independent. Unless otherwise specified, descriptions such as "optionally include" and "optionally contain" in this application, taking "optionally include" as an example, mean "may include or may not include".

[0055] The terms "contain", "include" and "comprise" used in this application are synonyms, which are inclusive or open-ended, and do not exclude additional, unmentioned members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features also include actions, conditions for the occurrence of actions, timing, states, etc.

[0056] In this application, in a technical feature or technical solution described in an open language, it includes a closed technical feature or technical solution composed of the listed content, and also includes an open technical feature or technical solution containing the listed content.

[0057] In this application, for exemplary descriptions such as "in some embodiments (or examples)" and "in one embodiment (or example)", it can cover but is not limited to the following meanings: These solutions can be combined with other solutions in a suitable manner to form a new technical solution.

[0058] In this application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only used for descriptive purposes and cannot be construed as indicating or implying relative importance or quantity, nor can they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumerative description and should be understood not to constitute a closed limitation on quantity.

[0059] In this application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specifically stated, the distribution of the selectable numerical values within the numerical interval is considered continuous and includes the two numerical endpoints of the numerical interval (i.e., the minimum value and the maximum value), as well as each numerical value between these two numerical endpoints. Unless otherwise specifically stated, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be combined. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. The "numerical interval" is allowed to broadly include numerical interval types such as percentage intervals, ratio intervals, ratio value intervals, etc.

[0060] In this application, when there are multiple steps involved in the method flow, unless there are clear different descriptions in this article, the execution of these steps has no strict order limitation, and they can be executed in other orders than the described ones. Moreover, any one step can include multiple sub-steps or multiple stages. These sub-steps or stages do not necessarily need to be executed at the same moment, but can be executed at different moments, and their execution order does not necessarily need to be sequential, but can be executed alternately or simultaneously with other steps or a part of the sub-steps or stages of other steps.

[0061] In the first aspect of this application, capture probes for detecting T-cell and B-cell immune repertoires at spatial resolution are provided, and the capture probes comprise transcript-specific sequences;

[0062] The transcript-specific sequences are derived from the first 40 bp of the reverse complementary sequence of the transcript sequences of the J region or V region genes of TCR and BCR, and have a length of 20 bp to 35 bp;

[0063] The J-region transcript sequence is derived from the Framework-4 (FR4) region;

[0064] The V region transcript sequence is derived from the Framework-2 (FR2) region and the Framework-3 (FR3) region.

[0065] In some embodiments, the J region transcript sequence is selected from the group consisting of 5863, 5864, 5865, 5866, 5867, 5868, 5869, 5719, 5720, 5721, 5722, 5723, 5532, 5533, 5534, 5535, 5536, 5536, 5537, 5538, 5538, 5539, 5540, 5540, 5540, 5540, 5540, 5540, 12277, 12278, 12279, 12280, 12281, 12257, 12258, 12259, 12260, 12162, 12163, 12164, 12165, 12166, 12167, 12167, 12168, 12169, 12170, 12171, 12172, 12173, 12174, 12175, 12037, 12038, 12039, 12040, 12041, 12041, 12042, 12043, 12044, 12044, 12045, 12046, 12047, 12048, 12049, 12050, 12051, 12051, 12052, 12053, 12054, 12055, 12055, 12056, 12057, 12058, 12059, 12060, 12061, 12062, 12063, 12064, 12065, 12066, 12067, 12067, 12068, 12069, 12069, 12070, 12071, 12072, 12072, 12073, 12073, 12074, 12075, 12075, 12076, 12077, 12078, 12079, 12080, 12081, 12082, 12083, 12084, 12085, 12086, 12087, 12088, 12089, 12090, 12091, 12092, 12093, 12094, 12095, 12096 and 12097.

[0066] In some embodiments, the V-region transcript sequence is selected from those with the following HGNC database ID numbers: 5550, 5552, 5559, 5546, 5547, 5548, 5549, 5551, 5553, 5554, 5555, 5556, 5557, 5558, 5562, 49601, 38040, 5576, 5574, 5575, 5577, 49602, 5613, 5620, 5628, 5580, 5581, 5582, 5583, 5584, 5585, 5586, 5587, 5588, 5589, 5590, 5591, 5592, 5593, 5594, 5595, 5596, 5597, 5598, 5599, 5600, 5601, 5602, 5603, 5604, 50322, 5605, 5606, 5607, 5608, 5609, 5610, 5611, 5612, 5614, 5615, 5616, 5617, 49603, 5618, 5619, 5621, 5622, 5623, 5624, 5625, 5626, 5627, 5652, 5645, 5647, 5648, 5649, 5650, 5657, 5651, 5653, 5654, 5655, 5656, 5661, 5659, 5660, 5662, 5665, 5663, 5664, 5666, 5667, 5669, 5704, 5671, 5673, 5676, 5678, 5683, 5684, 5685, 5687, 5688, 5695, 5703, 5694, 5698, 5706, 5709, 5741, 5742, 5743, 5744, 5730, 5731, 5732, 5733, 5734, 5735, 5736, 5737, 5738, 5739, 5740, 5759, 5746, 5747, 5748, 5749, 5750, 5751, 5752, 5753, 5754, 5755, 5756, 5757, 5758, 5788, 5776, 5777, 5778, 5780, 5781, 5782, 5783, 5784, 5785, 5789, 5792, 5793, 5794, 5797, 5798, 5799, 5800, 5801, 5804, 5821, 5815, 5816, 5817, 5818, 5819, 5820, 5829, 5823, 5824, 5825, 5834, 5835, 5836, 5837, 5838, 5839, 5876, 5877, 5878, 5879, 5880, 5881, 5882, 5894, 5895, 5887, 5888, 5889, 5890, 5891, 5892,5893、5896、5904、5915、5918、5897、5898、5899、5901、5903、5905、5906、5908、5910、5911、5912、5913、5914、5919、5920、5921、5922、5924、5925、5926、5927、5929、5930、5931、5933、5884、5885、5886、5936、5938、5940、5941、5943、5944、12101、12102、12116、12128、12140、12143、12144、12145、12146、12147、12148、12149、12150、12151、12152、12153、12154、12103、12104、12105、12106、12107、12108、12109、12110、12111、12112、12113、12114、12115、12117、12118、12119、12120、12121、12122、12123、12124、12125、12126、12127、12129、12130、12131、12132、12133、12134、12135、12137、12138、12139、12141、12142、12262、12263、12264、12176、12195、12212、12213、12215、12216、12217、12218、12219、12220、12221、12222、12223、12224、12225、12226、12227、12228、12229、12230、12231、12232、12233、12234、12235、12236、12237、12238、12239、12240、12241、12242、12243、12245、12246、12177、12178、12179、12180、12181、12182、12183、12184、12185、12186、12187、12188、12189、12190、12191、12192、12193、12194、12196、12198、12200、12201、12203、12205、12207、12208、12209、12210、12214、12284、12287、12288、12289、12290、12291、12292、12293、12294、12295、12285、12286、A group consisting of the sequences shown in 12296 and 12297.

[0067] In some embodiments, the transcript-specific sequence is derived from the first 40 bp, 39 bp, 38 bp, 37 bp, 36 bp, 35 bp, 34 bp, 33 bp, 32 bp, 31 bp, 30 bp, 29 bp, 28 bp, 27 bp, 26 bp, or 25 bp of the reverse complementary sequence of the J-region transcript sequence.

[0068] In some embodiments, the length of the transcript-specific sequence is 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, or 35 bp.

[0069] In some embodiments, the transcript-specific sequence is as shown in any one of SEQ ID NOs: 2 to 854.

[0070] In some embodiments, the capture probe further comprises a sequence required for high-throughput sequencing, exemplarily, for example, the Read2S sequence.

[0071] In some embodiments, the sequence required for high-throughput sequencing is linked to the 5'-end of the transcript-specific sequence.

[0072] In some embodiments, the sequence required for high-throughput sequencing is linked to the 3'-end of the transcript-specific sequence.

[0073] In some embodiments, the length of the sequence required for high-throughput sequencing can be a conventional length in the art, exemplarily, for example, 21 bp.

[0074] In some embodiments, the sequence required for high-throughput sequencing is as shown in SEQ ID NO: 1.

[0075] In some embodiments, the sequence required for high-throughput sequencing is linked to the 5'-end of the transcript-specific sequence, and the sequence required for high-throughput sequencing is as shown in SEQ ID NO: 1, and the transcript-specific sequence is as shown in any one of SEQ ID NOs: 2 to 854.

[0076] In a second aspect of the present application, a probe composition is provided, which comprises the capture probe as described in the first aspect.

[0077] In some embodiments, the probe composition further comprises a whole transcriptome probe.

[0078] In a third aspect of the present application, there is provided a kit comprising one or more of the capture probes as described in the first aspect and the probe composition as described in the second aspect.

[0079] In some embodiments, the kit further comprises reagents for reverse transcription and reagents for adding a poly A tail.

[0080] In a fourth aspect of the present application, there is provided a method for constructing a sequencing library for detecting T cell and B cell immune repertoires at spatial resolution, the method comprising:

[0081] Probe hybridization: Mixing a tissue section and the probe composition as described in the second aspect to obtain tissue 1 after probe hybridization;

[0082] Reverse transcription: Mixing the tissue 1 with a whole transcriptome probe to obtain tissue 2 after ligation of the whole transcriptome probe, and performing reverse transcription on the capture probes in the tissue 2 to obtain tissue 3 containing cDNA;

[0083] Adding a poly A tail: Adding a poly A tail to the cDNA to obtain tissue 4 containing cDNA with a poly A tail;

[0084] Chip hybridization: Mixing a chip carrying DNA oligonucleotides encoding spatial position information and the tissue 4 to capture the whole transcriptome probe and the cDNA with a poly A tail, and performing pre-amplification and amplification successively to construct a sequencing library.

[0085] In some embodiments, the working concentrations of the capture probes and the human whole transcriptome probes in the probe composition are each independently 1 nM to 100 nM.

[0086] In some embodiments, the tissue section is a preserved tissue section.

[0087] In some embodiments, the tissue section is from a sample fixed with formalin and embedded in paraffin.

[0088] As an alternative to the above formalin fixation, the sample can be fixed in any one of a variety of other fixatives to maintain the biological structure of the sample before analysis. For example, the sample can be fixed by immersion in ethanol, methanol, acetone, paraformaldehyde (PFA), and combinations thereof.

[0089] As an alternative to the above paraffin embedding, the sample can be embedded in any of a variety of other embedding materials to provide a structural substrate to the sample before sectioning and other processing steps. Generally, the embedding material is removed before analyzing the tissue sections obtained from the sample. Suitable embedding materials include, but are not limited to, wax, resins (such as methacrylate resins), epoxy resins, and agar.

[0090] In some embodiments, the tissue sections are from a sample fixed with 4% paraformaldehyde (PFA) and embedded in paraffin.

[0091] In some embodiments, the thickness of the tissue sections is from 1 μm to 50 μm.

[0092] In some embodiments, the thickness of the tissue sections is from 5 μm to 35 μm, and exemplarily, for example, 5 μm, 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, or 35 μm, or a value or range between any two values.

[0093] It should be understood that the above capture probes target the fourth framework region (FR4) of TCR and BCR.

[0094] In a fifth aspect of the present application, a method for detecting T cell and B cell immune repertoires at spatial resolution is provided, the method comprising:

[0095] Constructing a sequencing library: constructing a sequencing library using the method described in the fourth aspect;

[0096] Sequencing: sequencing the sequencing library.

[0097] In some embodiments, in the step of sequencing, next-generation sequencing technology is used for sequencing.

[0098] In some embodiments, when constructing the sequencing library, the read1 and read2 sequences of Illumina are used for amplification.

[0099] In some embodiments, the sequencing is performed on the Illumina Novaseq 6000 Xplus platform.

[0100] Some examples are provided below.

[0101] The embodiments of the present application will be described in detail below in conjunction with the examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specified conditions in the following examples, the guidelines given in the present application are preferentially referred to, and it is also possible to follow the experimental manuals or conventional conditions in the art, or the conditions recommended by the manufacturers, or refer to the experimental methods known in the art.

[0102] The CDR3 region is the region with the highest variability due to somatic hypermutation during the maturation of TCR and BCR. The CDR3 region of the RNA transcript was directly sequenced using a J region-specific probe, and cDNA was generated by reverse transcription. Subsequently, a 3' poly A tail was added to the reverse-transcribed cDNA using terminal transferase. The poly A-tailed cDNA containing the CDR3 region was then hybridized with poly-T probes linked to a spatial barcode array. The sequence of the CDR3 region was then transferred to the spatial barcode probe and used to construct a spatial transcriptome library.

[0103] The reagents and materials are shown in Table 1.

[0104] Table 1

[0105]

[0106] Human FFPE-embedded tumor samples were fixed in 4% paraformaldehyde PFA (Servicebio Cat#G1101) for 48 hours and then paraffin-embedded. The tissues were sectioned into 5-μm-thick slices using a Leica HistoCore BIOCUT microtome (Leica Cat#14051756235) and mounted on Fisherbrand SuperFrost Plus slides (fisherscientific Cat#12-550-15). Subsequently, the sections were dewaxed, stained with H&E, and imaged.

[0107] During the processes of probe capture of mRNA, bridge ligation, probe release, and sequencing library construction, designed direct capture probes were used, which targeted the fourth framework region (FR4) of TCR and BCR. The released probes were then hybridized with a 10×Genomics Visium HD oligonucleotide slide.

[0108] Library construction was amplified using the Illumina read1 and read2 sequences. The finally constructed library was sequenced on an Illumina Novaseq 6000 Xplus platform.

[0109] The sequenced FASTQ files were aligned to the mouse reference genome using Space Ranger v3.1.0, and analyzed in combination with the known human immune repertoire transcript sequences in MIXCR. Finally, aligned histological images, gene barcode matrices, and TCR&BCR library matrices were generated on the same slide for further analysis.

[0110] Example 1 Probe Preparation

[0111] The sequences of the probes are divided into two parts: the transcript-specific sequence and the Read2S sequence required for Illumina high-throughput sequencing.

[0112] Download all TCRs (including TRA, TRB, TRD, and TRG genes) corresponding to the human genome, as well as the J-region transcript sequences of BCR (including IGH, IGL, and IGK) (a total of 122) from the MIXCR database ( ), perform reverse complementation, and take the first 25 bp after reverse complementation (such as shown in SEQ ID NO: 2 to 123 respectively) as the transcript-specific sequences of the targeted TCR & BCR probes; for the V-region transcript sequences (a total of 731), perform reverse complementation and take the first 25 bp after reverse complementation (such as shown in SEQ ID NO: 124 to 854 respectively) as the transcript-specific sequences of the targeted TCR & BCR probes. Add a 21-bp Read2S sequence (CCTTGGCACCCGAGAATTCCA, SEQ ID NO: 1) required for Illumina high-throughput sequencing to the 5' end of the transcript-specific sequence of the targeted TCR&BCR probe, which is the full-length sequence (46 bp) of the targeted TCR & BCR probe.

[0113] Synthesize all probe-specific transcripts into an oligonucleotide library simultaneously (either IDT in the United States or other oligonucleotide library synthesis companies can be used, here it is IDT in the United States), and the minimum synthesis amount is 1 pmol.

[0114] Example 2 Probe Application - Exploring the Relationship between the Spatial Distribution of the Immune Receptor Repertoire Sequences of Tumor-Infiltrating T&B Lymphocytes and Tumor Cells after PD1 Treatment in Colorectal Cancer in the Clinical Pathology Museum

[0115] 2.1 Experimental Purpose

[0116] Utilize the TCR & BCR sequences enriched in the tumor regions of colorectal cancer patients who have received neoadjuvant therapy (Anti-PD-1) in the clinical pathology museum.

[0117] 2.1 Experimental Scheme

[0118] 2.1.1 Acquisition of Human Tissue Samples

[0119] 1) Perform colorectal cancer tumor resection surgery on patients who meet the sampling ethics.

[0120] 2) Immerse the samples in PFA for 2 - 7 days.

[0121] 3) Process the samples immersed in PFA by formalin embedding.

[0122] 2.1.2 Spatial Transcriptomics Combined with Single-Slice Immune Receptor Repertoire Sequencing

[0123] 1) Preparation of tissue sections:

[0124] Preparation of tissue sections: For FFPE-embedded tissue samples, use a Leica microtome to cut sections (5 μm), dewax, and perform HE staining, and image with a slide scanner.

[0125] 2) Probe hybridization

[0126] For HE-stained samples, perform the de-crosslinking and probe hybridization experiments within 1 - 2 days according to the procedure of the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). During probe hybridization, mix the designed and synthesized TCR & BCR targeted capture probes with the 10x Genomics human whole transcriptome probes (Visium Human Transcriptome Probe Kit v2 - Small, PN-1000466) and then perform hybridization. The system is shown in Table 2 (x represents the number of samples).

[0127] Table 2

[0128]

[0129] 2) Reverse transcription

[0130] For the tissue after probe hybridization, wash it according to the procedure of the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685) after probe hybridization. After washing, perform the ligation of the whole transcriptome probes (Human WT Probes v2) according to the procedure of the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). For the tissue after ligation of the whole transcriptome probes, perform reverse transcription of the TCR & BCR probes. The system is shown in Table 3.

[0131] Table 3

[0132]

[0133] The reaction conditions are shown in Table 4.

[0134] Table 4

[0135]

[0136] 3) Add poly A tail

[0137] For the tissues after reverse transcription of TCR & BCR probes, wash them according to the same steps of washing after ligation in the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). After the washing is completed, add poly A tail to the completed cDNA of reverse transcription. The system is shown in Table 5

[0138] Table 5

[0139]

[0140] The reaction conditions are shown in Table 6

[0141] Table 6

[0142]

[0143] 4) While the spatially encoded chip captures the whole transcriptome probes, it also captures the cDNA products reverse transcribed from TCR & BCR probes

[0144] For the tissues after reverse transcription of TCR & BCR probes and addition of poly A tail, wash them according to the same steps of washing after ligation in the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685). After the washing is completed, continue with the chip hybridization according to the 10x Visium HD spatial gene expression user guide (10x Genomics User Guide CG000685), so as to transfer the DNA oligonucleotides encoding spatial position information on the chip to the probe library. Subsequently, continue with the pre-amplification of the probe library and the construction of the Illumina sequencing library after amplification according to its process. At this time, the probe cDNA of TCR & BCR is constructed into a library and sequenced together with other normal whole transcriptome probe libraries, without the need for separate additional operations. The sequencing uses an Illumina Novaseq 6000 X plus instrument, with 150bp paired-end reads, and the library structure is Illumina Trueseq

[0145] 2.1.3 Result analysis

[0146] For the paired-end Fastq files output from Illumina sequencing (containing whole transcriptome reads, TCR reads, and BCR reads simultaneously), use the Space Ranger (v3.1.0) software of 10x Genomics to align them with the human reference genome and whole transcriptome probe design. Space Ranger will decode the spatial coordinates of the probe sequences through the chip-encoded sequences corresponding to the known spatial coordinates, so that the gene expression of the whole transcriptome can be obtained normally. For the TCR & BCR sequences contained in the same sequencing file, first extract all the reads that may be the cDNA corresponding to the target TCR & BCR using the probe design library sequence, and similarly perform the alignment of Space Ranger. Output their spatial position coordinates through the Bam file after alignment. Use the RNA-seq preset module of the MIXCR software to perform the alignment of TCR & BCR to obtain the immune receptor clonotypes of TCR & BCR corresponding to different reads. According to the principle of the same Read Name, jointly output the information of different immune receptor clonotypes contained in different reads and the spatial coordinate information of the same Read Name as the spatial coordinate expression matrix of TCR & BCR clonotypes.

[0147] Figure 1 Show the process of capturing TCR and BCR transcripts with specific probes. In the first step, a gene-specific probe (containing Illumina Read2 and nucleic acid sequence 1) binds to the transcript, generates the nucleic acid sequence 2 product through the described reverse transcription, and then generates the poly A product through the reaction of adding a poly A tail at the end. In the second step, obtain the spatially encoded product library by in situ hybridizing the product generated by the probe on the nucleotides of the spatial coordinates. In the third step, add Illumina high-throughput sequencing adapters to the library through PCR reaction.

[0148] Figure 2 Show the alignment results of capturing an example BCR transcript with a specific probe, including the V region, CDR3 region, and J region sequences of this BCR transcript. Target0 represents the sequenced sequence. LQTE represents the amino acid sequence of the BCR. Quality represents the alignment quality, where 88888 represents a full score for the alignment quality.

[0149] Figure 3 Show the spatial visualization results of capturing BCR sequences with specific probes. Align the above BCR sequencing product library back to the spatial coordinates of human colorectal tumors through the analysis method described in the case, and you can know the different information of the spatial positions corresponding to different BCR sequences.

[0150] Figure 4Displays the spatial visualization results of TCR sequences captured by specific probes. By aligning the above TCR sequencing product library back to the spatial coordinates of human colorectal tumors using the analysis method described in the case, the different spatial position information corresponding to different TCR sequences can be known.

[0151] Figure 5 Displays the alignment results of the exemplary BCR transcript captured by specific probes, including the V region and CDR1 region sequences of this BCR transcript. Target0 represents the sequenced sequence. LQTE represents the amino acid sequence of BCR. Quality represents the alignment quality, where 88888 represents a full score for the alignment quality.

[0152] Figure 6 Displays the alignment results of the exemplary BCR transcript captured by specific probes, including the V region and CDR2 region sequences of this BCR transcript. Target0 represents the sequenced sequence. LQTE represents the amino acid sequence of BCR. Quality represents the alignment quality, where 88888 represents a full score for the alignment quality.

[0153] Figure 7 Displays the spatial visualization results of the CDR1 sequence of BCR captured by specific probes. By aligning the above BCR sequencing product library back to the spatial coordinates of human colorectal tumors using the analysis method described in the case, the different spatial position information corresponding to different BCR sequences can be known.

[0154] Figure 8 Displays the spatial visualization results of the CDR2 sequence of BCR captured by specific probes. By aligning the above BCR sequencing product library back to the spatial coordinates of human colorectal tumors using the analysis method described in the case, the different spatial position information corresponding to different BCR sequences can be known.

[0155] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as falling within the scope described in this specification.

[0156] The above-described embodiments only represent several implementation manners of the present application, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims, and the specification and drawings can be used to explain the content of the claims.

Claims

1. Capture probes for detecting T cell and B cell immune repertoires at spatial resolution, characterized in that, The capture probe contains a transcript-specific sequence; The transcript-specific sequence is derived from the first 40 bp of the reverse complementary sequence of the transcript sequence of the J region or V region gene of TCR and BCR, and has a length of 20 bp to 35 bp; The J region transcript sequence is derived from the Framework-4 (FR4) region; The V region transcript sequence is derived from the Framework-2 (FR2) region and the Framework-3 (FR3) region.

2. The capture probe according to claim 1, wherein, The J region transcript sequence is selected from the group consisting of the sequences shown by the ID numbers such as 5863, 5864, 5865, 5866, 5867, 5868, 5869, 5719, 5720, 5721, 5722, 5723, 5532, 5533, 5534, 5535, 5536, 5536, 5537, 5538, 5538, 5539, 5540, 5540, 5540, 5540, 5540, 5540, 12277, 12278, 12279, 12280, 12281, 12257, 12258, 12259, 12260, 12162, 12163, 12164, 12165, 12166, 12167, 12167, 12168, 12169, 12170, 12171, 12172, 12173, 12174, 12175, 12037, 12038, 12039, 12040, 12041, 12041, 12042, 12043, 12044, 12044, 12045, 12046, 12047, 12048, 12049, 12050, 12051, 12051, 12052, 12053, 12054, 12055, 12055, 12056, 12057, 12058, 12059, 12060, 12061, 12062, 12063, 12064, 12065, 12066, 12067, 12067, 12068, 12069, 12069, 12070, 12071, 12072, 12072, 12073, 12073, 12074, 12075, 12075, 12076, 12077, 12078, 12079, 12080, 12081, 12082, 12083, 12084, 12085, 12086, 12087, 12088, 12089, 12090, 12091, 12092, 12093, 12094, 12095, 12096 and 12097 in the HGNC database; and / or, the V-region transcript sequence is selected from those with the ID numbers such as 5550, 5552, 5559, 5546, 5547, 5548, 5549, 5551, 5553, 5554, 5555, 5556, 5557, 5558, 5562, 49601, 38040, 5576, 5574, 5575, 5577, 49602, 5613, 5620, 5628, 5580, 5581, 5582, 5583, 5584, 5585, 5586, 5587, 5588, 5589, 5590, 5591, 5592, 5593, 5594, 5595, 5596, 5597, 5598, 5599, 5600, 5601, 5602, 5603, 5604, 50322, 5605, 5606, 5607, 5608, 5609, 5610, 5611, 5612, 5614, 5615, 5616, 5617, 49603, 5618, 5619, 5621, 5622, 5623, 5624, 5625, 5626, 5627, 5652, 5645, 5647, 5648, 5649, 5650, 5657, 5651, 5653, 5654, 5655, 5656, 5661, 5659, 5660, 5662, 5665, 5663, 5664, 5666, 5667, 5669, 5704, 5671, 5673, 5676, 5678, 5683, 5684, 5685, 5687, 5688, 5695, 5703, 5694, 5698, 5706, 5709, 5741, 5742, 5743, 5744, 5730, 5731, 5732, 5733, 5734, 5735, 5736, 5737, 5738, 5739, 5740, 5759, 5746, 5747, 5748, 5749, 5750, 5751, 5752, 5753, 5754, 5755, 5756, 5757, 5758, 5788, 5776, 5777, 5778, 5780, 5781, 5782, 5783, 5784, 5785, 5789, 5792, 5793, 5794, 5797, 5798, 5799, 5800, 5801, 5804, 5821, 5815, 5816, 5817, 5818, 5819, 5820, 5829, 5823, 5824, 5825, 5834, 5835, 5836, 5837, 5838, 5839, 5876, 5877, 5878, 5879, 5880, 5881, 5882, 5894, 5895, 5887, 5888, 5889, 5890, 5891, 5892, 5893 in the HGNC database5896、5904、5915、5918、5897、5898、5899、5901、5903、5905、5906、5908、5910、5911、5912、5913、5914、5919、5920、5921、5922、5924、5925、5926、5927、5929、5930、5931、5933、5884、5885、5886、5936、5938、5940、5941、5943、5944、12101、12102、12116、12128、12140、12143、12144、12145、12146、12147、12148、12149、12150、12151、12152、12153、12154、12103、12104、12105、12106、12107、12108、12109、12110、12111、12112、12113、12114、12115、12117、12118、12119、12120、12121、12122、12123、12124、12125、12126、12127、12129、12130、12131、12132、12133、12134、12135、12137、12138、12139、12141、12142、12262、12263、12264、12176、12195、12212、12213、12215、12216、12217、12218、12219、12220、12221、12222、12223、12224、12225、12226、12227、12228、12229、12230、12231、12232、12233、12234、12235、12236、12237、12238、12239、12240、12241、12242、12243、12245、12246、12177、12178、12179、12180、12181、12182、12183、12184、12185、12186、12187、12188、12189、12190、12191、12192、12193、12194、12196、12198、12200、12201、12203、12205、12207、12208、12209、12210、12214、12284、12287、12288、12289、12290、12291、12292、12293、12294、12295、12285、12286、The group consisting of the sequences shown in 12296 and 12297.

3. The capture probe according to claim 2, wherein The transcript-specific sequence is any one of SEQ ID NO: 2 to SEQ ID NO:

854.

4. The capture probe according to any one of claims 1 to 3, wherein The capture probe further contains a sequence required for high-throughput sequencing; Optionally, the sequence required for high-throughput sequencing is linked to the 5' end or 3' end of the transcript-specific sequence; Optionally, the length of the sequence required for the high-throughput sequencing is 21 bp; the sequence required for the high-throughput sequencing is optionally as shown in SEQ ID NO: 1; Further optionally, the sequence required for the high-throughput sequencing is linked to the 5' end of the transcript-specific sequence, the sequence required for the high-throughput sequencing is as shown in SEQ ID NO: 1, and the transcript-specific sequence is as shown in any one of SEQ ID NO: 2 to SEQ ID NO:

854.

5. A probe composition, characterized in that, It comprises the capture probe according to any one of claims 1 to 4; Optionally, the probe composition further comprises a whole-transcriptome probe.

6. Kit, characterized in that, It comprises one or more of the capture probe according to any one of claims 1 to 4 and the probe composition according to claim 5; Optionally, the kit further comprises reagents for reverse transcription and reagents for adding a poly A tail.

7. A method for constructing a sequencing library for detecting T cell and B cell immune repertoires at spatial resolution, characterized in that, The method comprises: Probe hybridization: Mixing a tissue section and the probe composition according to claim 5 to prepare tissue 1 after probe hybridization; Reverse transcription: Mixing the tissue 1 with a whole-transcriptome probe to prepare tissue 2 after ligation of the whole-transcriptome probe, and performing reverse transcription on the capture probe in the tissue 2 to prepare tissue 3 containing cDNA; Adding a poly A tail: Adding a poly A tail to the cDNA to prepare tissue 4 containing cDNA with a poly A tail; Chip hybridization: Mixing a chip carrying DNA oligonucleotides encoding spatial position information and the tissue 4 to capture the whole-transcriptome probe and the cDNA with a poly A tail, and performing pre-amplification and amplification successively to construct a sequencing library.

8. The method according to claim 7, wherein The working concentrations of the capture probe and the human whole-transcriptome probe in the probe composition are each independently 1 nM to 100 nM; and / or, The tissue section is a preserved tissue section, optionally with a thickness of 1 μm to 50 μm.

9. A method for detecting T cell and B cell immunoglobulin repertoires at spatial resolution, characterized in that, The method comprises: Constructing a sequencing library: Constructing a sequencing library using the method according to claim 7 or 8; Sequencing: Sequencing the sequencing library.

10. The method according to claim 9, characterized in that, In the step of sequencing, next-generation sequencing technology is used for sequencing.

Images