Aptamer chimera constructed based on click chemistry and application thereof

Abstract

The invention discloses an aptamer chimera constructed on the basis of click chemistry and application of the aptamer chimera. The aptamer chimera comprises a first sequence and a second sequence which are coupled through the click chemistry reaction, the first sequence comprises a nucleic acid aptamer of a targeted target protein, and the second sequence comprises a signal peptide containing a lysosome sorting motif. The aptamer chimera disclosed by the invention does not depend on the expression of LTRs on a specific cell surface, and has a relatively good degradation effect and specificity on target protein.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a nucleic acid aptamer chimera constructed based on click chemistry and its applications. Background Art

[0002] In recent years, the emerging targeted protein degradation (TPD) technology has effectively eliminated pathogenic proteins by utilizing endogenous cellular mechanisms, circumventing the limitations of the active binding pockets of target proteins, thereby paving the way for the development of novel chemical tools and strategies in drug discovery.

[0003] PROTACs (Proteolysis-targeting chimeras) is an innovative TPD technology based on the ubiquitin-proteasome system (UPS). It uses two ligands connected by a linker to specifically recruit an E3 ubiquitin ligase and a protein of interest (POI), thereby forming a ternary complex that catalyzes proximity-driven polyubiquitination and subsequent proteasomal degradation. However, cell surface membrane proteins and extracellular proteins (accounting for approximately 40% of the encoded proteins) play key roles in neurodegenerative diseases, autoimmune diseases, and cancers, and remain challenging targets. To expand the scope of therapeutic targets, the Carolyn R. Bertozzi team pioneered the development of lysosome-targeting chimeras (LYTACs), which conjugate the extracellular domain of the target protein to the cation-independent mannose-6-phosphate receptor (CI-M6PR or IGF2R) or the asialoglycoprotein receptor (ASGPR) through a sugar-coupled antibody, thereby inducing lysosomal trafficking and degradation. Based on this, scientists have recently proposed technologies such as cytokine receptor-targeting chimeras (KineTACs), integrin-facilitated lysosomal degradation (IFLD), and dendrimerized DNA chimeras (DENTACs), enabling membrane proteins to be degraded through various lysosome-targeting receptors (LTRs), such as cytokine receptors (CXCR7), integrins, and scavenger receptors (SRs). In addition, the Cai team proposed signal-mediated lysosome-targeting chimeras (SignalTAC), a strategy that genetically engineers the leucine-based sorting signal motif from CI-M6PR into the C-terminus of an antibody to induce the internalization of the target protein and lysosome-mediated degradation.

[0004] Currently, the prior art has the following defects and deficiencies:

[0005] (1) Currently developed membrane protein degradation strategies based on membrane surface LTRs (such as LYTACs, KineTACs, and DENTACs, etc.) are overly dependent on the expression of specific cell surface LTRs. However, LTRs vary greatly among different cell lines and may be relatively low in certain tumors, thus limiting their clinical applications;

[0006] (2) The targeted membrane protein degradation technology based on engineered antibodies (such as SignalTAC) has practical problems such as the large molecular weight of antibodies making it difficult to penetrate tumor tissues and the complex preparation process.

[0007] An aptamer is a single-stranded DNA or RNA molecule with a specific structure, obtained through an in vitro screening strategy called Systematic Evolution of Ligands by Exponential Enrichment (SELEX). It has the advantages of small molecular weight, high specificity, high affinity, etc., and is easy to synthesize and modify. Currently, it is widely studied and of great significance in the early detection and precise treatment of diseases. Summary of the Invention

[0008] The present invention provides a nucleic acid aptamer chimera constructed based on click chemistry and its application. It does not depend on the expression of specific cell surface LTRs and has good degradation effect and specificity for target proteins.

[0009] The technical solution of the present invention is as follows:

[0010] A nucleic acid aptamer chimera constructed based on click chemistry, comprising a first sequence and a second sequence coupled by a click chemical reaction;

[0011] The first sequence includes a nucleic acid aptamer targeting a target protein, and the second sequence includes a signal peptide containing a lysosomal sorting motif.

[0012] Preferably, the lysosomal sorting motif is Lysosomal sorting motif.

[0013] Preferably, the target protein is PTK7 protein.

[0014] More preferably, the sequence of the nucleic acid aptamer is as shown in SEQ ID NO.1; the sequence of the signal peptide is as shown in SEQ ID NO.7.

[0015] The sequence of the nucleic acid aptamer is as shown in SEQ ID NO.1, specifically 5’-CTCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAG-3’.

[0016] The sequence of the signal peptide is as shown in SEQ ID NO.7, specifically GGGRRRRRRRRRGYEQF.

[0017] The present invention also provides a preparation method of the nucleic acid aptamer chimera, comprising: performing a click chemical reaction on a nucleic acid aptamer targeting PTK7 modified by a first group and a signal peptide modified by a second group, and that's it.

[0018] The first group is a dibenzocyclooctyne group, a trans-cyclooctene group or a bicyclo[6.1.0]nonyne group; the second group is an azide group.

[0019] The first group is modified at the 3'-end of the aptamer, and the second group is modified at the N-terminus of the signal peptide.

[0020] Preferably, the molar ratio of the aptamer to the signal peptide is 1:2 - 5; most preferably 1:3.

[0021] The present invention also provides a protein degrader, which comprises the aptamer chimera described above.

[0022] The present invention also provides the application of the aptamer chimera in the preparation of protein degradation drugs.

[0023] The present invention also provides the application of the protein degrader in the preparation of protein degradation drugs.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] The present invention utilizes the characteristics that aptamers are easy to synthesize and modify and the inherent sorting motifs of lysosome-related proteins, and designs and synthesizes aptamer chimeras for protein degradation, which have good degradation effects and specificities on target proteins. The method of the present invention is simple and convenient. Combining with the existing high efficiency of solid-phase synthesis of DNA and polypeptides, degradation chimeras targeting different targets can be synthesized in large quantities by using this method, providing new ideas for clinical treatment. Description of the Drawings

[0026] Figure 1 It is the structural diagram and sequence of the polypeptide;

[0027] Figure 2 It is a schematic diagram of the cross-linking of the azide group at the N-terminus of the polypeptide and the DBCO group at the 3'-end of the DNA sequence through click chemistry;

[0028] Figure 3 It is the PAGE gel electrophoresis diagram of the polypeptide and reaction solutions of different lengths of Sgc8;

[0029] Figure 4 It is the mass spectrometry identification result diagram of degradation chimeras of different lengths of Sgc8; (a) is S-APT AC, (b) is S-APTAC#5, (c) is S-APTAC#10, (d) is S-APTAC#20, (e) is S-APTAC#30, (f) is S-APTAC Mut;

[0030] Figure 5Degradation effect diagrams of Sgc8 degradation chimeras with different lengths on the target protein PTK7. (A) is a Western blot, and (B) is a confocal microscopy photograph;

[0031] Figure 6 Effect diagrams after treating HCT116 cells with S-APTAC for different times. (A) is a Western blot, and (B) is a flow cytometry detection result diagram;

[0032] Figure 7 Degradation effect diagrams of S-APTAC degradation chimeras with different concentrations on the target protein PTK7. (A) is a Western blot, and (B) is a degradation curve;

[0033] Figure 8 In (A), it is a schematic diagram of point mutation of Sgc8. (B) is a graph of the binding strength of different sequences to HCT 116 cells. (C) is a Western blot of the degradation effects of library control sequences, Sgc8, S-APTAC, and S-APTAC Mut on the target protein PTK7. (D) is a Western blot of the CD71 level after treating HCT116 cells with different concentrations of S-APTAC for 48 h. (E) is a graph of the mRNA level of PTK7 after treating HCT116 cells with different concentrations of S-APTAC for 48 h. Detailed implementation manners

[0034] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. It should be noted that the following embodiments are intended to facilitate the understanding of the present invention and do not limit it in any way.

[0035] The present invention proposes a simple construction strategy for a membrane protein degradation chimera based on an aptamer and verifies its effect and specific mechanism on the degradation of the target membrane protein.

[0036] The specific content of the present invention includes: 1. Construction and purification of a degradation chimera based on the aptamer Sgc8; 2. Verification of the degradation effect of the degradation chimera based on the aptamer Sgc8 (named S-APTAC in the present invention) on the target membrane protein PTK7.

[0037] Specific implementation schemes:

[0038] 1. Raw materials: The aptamer Sgc8 targeting PTK7, polypeptide; the 3' end of the aptamer Sgc8 is modified with DBCO (Dibenzocyclooctyne), and the N-terminus of the polypeptide is modified with azidohexanoic acid (total molecular weight MW = 2302.6 Da);

[0039] 2. The preparation and purification method of the above-mentioned Sgc8-degrading chimera (S-APTAC) includes the following steps:

[0040] (1) Dissolve the nucleic acid aptamer Sgc8 in sterile water, measure the concentration by Nanodrop, and dilute it to 100 μM; (2) Dissolve a certain amount of polypeptide in sterile water and prepare a storage concentration of 2 mM;

[0041] (3) Add the dissolved DNA strand and polypeptide to the reaction flask at a ratio of 50 μM:150 μM (200 μl reaction system, make up the volume with sterile water), stir, and react overnight;

[0042] (4) After the reaction is completed, take a small amount of the reaction solution and dilute it for preliminary verification by PAGE gel electrophoresis;

[0043] (5) Purification: Add the reaction solution to a 5 kDa ultrafiltration tube, centrifuge at 8000 rpm for 10 minutes, and discard the filtrate; (the molecular weight of the product > 5000 Da, the molecular weight of the excessive polypeptide < 5000 Da is in the filtrate);

[0044] (6) Add 200 μl of sterile water to the ultrafiltration tube, centrifuge at 8000 rpm for 10 minutes and discard the filtrate, repeat 3 times;

[0045] (7) Add 50 μl of sterile water to the inner tube of the ultrafiltration tube and wash it repeatedly to elute the product;

[0046] (8) The obtained product is freeze-dried overnight, re-dissolved after freeze-drying, a small amount is taken for mass spectrometry identification, and the rest is used for subsequent experiments.

[0047] 3. Result verification and example demonstration:

[0048] (1) Synthesis and characterization of the DNA-polypeptide conjugate

[0049] The azide group at the N-terminus of the polypeptide and the DBCO group at the 3' end of the DNA sequence were cross-linked through a click chemistry reaction; specifically, five Sgc8 nucleic acid aptamer sequences of different lengths and one Sgc8 Mut sequence with a point mutation (5'-CTCTAACTGCTGTGC CGCCGGGAAAATACTGTACGGTTAGAG-3') were purchased for this experiment; among them, the five Sgc8 nucleic acid aptamer sequences of different lengths included the original Sgc8 sequence (Sgc8(0)) (specific sequence: 5'-CT CTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAG-3') and the Sgc8 with a point mutation obtained by adding 5 (Sgc8(5)), 10 (Sgc8(10)), 20 (Sgc8(20)), and 30 (Sgc8(30)) adenine bases to the end of Sgc8 The Mut sequence was obtained by mutating the 13th cytosine in the Sgc8 sequence to thymine (C→T) (5'-CTCTAA CTGCTG T The peptides used in this experiment were derived from the fusion terminal flexible sequence (GGG), the transmembrane motif (RRRRRRRRR) and the lysosomal associated membrane protein 2a (LAMP-2a). The lysosomal sorting motif GYEQF was obtained (e.g. Figure 1 ), which mainly provides a lysosomal sorting signal for the target protein, so that the target protein PTK7 is installed with a lysosomal sorting signal after being recognized and bound by the Sgc8 nucleic acid aptamer in S-APTAC, and then sorted to the lysosome for degradation. The end of the polypeptide is modified with an azidohexanoic acid group to facilitate cross-linking with the DBCO group at the 3' end of the DNA sequence.

[0050] Sgc8(0) sequence: 5'-CTCTAACTGCTGCGCCGCCGGGAAAATACTGT ACGGTTAGAG-3'(SEQ IDNO.1);

[0051] Sgc8 Mut sequence: 5'-CTCTAACTGCTG T GCCGCCGGGAAAATACTGT ACGGTTAGAG-3'(SEQ IDNO.2);

[0052] Sgc8(5) sequence: 5'-CTCTAACTGCTG T GCCGCCGGGAAAATACTGT ACGGTTAGAGAAAAAA-3' (SEQ ID NO. 3);

[0053] Sgc8(10) sequence: 5'-CTCTAACTGCTG T GCCGCCGGGAAAATACTGTACGGTTAGAGAAAAAAAAAA-3'(SEQ ID NO.4);

[0054] Sgc8(20) sequence: 5'-CTCTAACTGCTG T GCCGCCGGGAAAATACTGTACGGTTAGAGAAAAAAAAAAAAAAAAAAAA-3'(SEQ ID NO.5);

[0055] Sgc8(30) sequence: 5'-CTCTAACTGCTG T GCCGCCGGGAAAATACTG TACGGTTAGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3'(SE Q ID NO.6);

[0056] Polypeptide sequence: GGGRRRRRRRRRGYEQF(SEQ ID NO.7).

[0057] For the preparation and purification method of the above Sgc8-degrading chimera (S-APTAC), after the DNA and polypeptide react overnight in a 200 μl system at a ratio of 50 μM:150 μM, the azide group at the N-terminus of the polypeptide and the DBCO group at the 3'-terminus of the DNA sequence are cross-linked together through click chemistry, as Figure 2 shown. Take 2 μl of the reaction solution for preliminary verification by PAGE gel electrophoresis (as Figure 3 ), where lanes 1, 3, 5, 7, 9 are Sgc8(0), Sgc8(5), Sgc8(10), Sgc8(20), Sg c8(30) respectively, and lanes 2, 4, 6, 8, 10 are the products of cross-linking of the polypeptide with different lengths of Sgc8, namely S-APTAC, S-APTAC#5, S-APTAC#10, S-APTAC#20, S-APTAC#30. It can be seen that different lengths of Sgc8 and their products after cross-linking with the polypeptide have different migration distances in gel electrophoresis. Then, it is purified and eluted by ultrafiltration, and after lyophilization and reconstitution, it is sent to Sangon Biotech (Shanghai) Co., Ltd. for mass spectrometry identification. The identification results are as Figure 4 shown, and the successful cross-linking of the polypeptide and DNA is verified according to the molecular weight of the product.

[0058] (2) Verification of the degradation effect of membrane proteins based on S-APTAC with different lengths

[0059] HCT116 cells were cultured in 6-well plates. When the cell density reached 60 - 70%, 500 nM of the purified Sgc8 degradation chimeras with different lengths (S-APTAC, S-APTAC#5, S-APTAC#10, S-APTAC#20, S-APTAC#30) were added and incubated for 48 h. Then the cells were collected for western blot experiments to detect the level of the target protein PTK7 (as shown in (A) of Figure 5 . The chimera S-APTAC synthesized with the Sgc8(0) conjugate polypeptide without adding adenine at the end had the best degradation effect on the target PTK7, and with the addition of adenine at the end of Sgc8, its degradation effect gradually weakened.

[0060] HCT116 cells were cultured in confocal dishes. After the cells adhered, 500 nM of the purified S-APTAC was added and incubated for 48 h. Then the cell medium was removed, and the cells were washed 3 times with DPBS, and then fixed with 4% paraformaldehyde for 30 min. After removing the fixative, the cells were permeabilized and blocked. Then, the diluted primary antibody was added in a certain proportion and incubated overnight at 4 °C. Then the fluorescent secondary antibody was incubated and observed and photographed under a laser confocal microscope (as shown in (B) of Figure 5 . Treatment with S-APTAC for 48 h had an obvious degradation effect on PTK7.

[0061] (3) Time-dependent verification of the degradation of membrane proteins by Sgc8 degradation chimeras

[0062] HCT116 cells were cultured in 6-well plates. When the cell density reached 60 - 70%, 500 nM of the purified S-APTAC degradation chimera was added and incubated for 12, 24, 48, 72 h. Then the cells were collected for Western blot experiments to detect the level of the target protein PTK7 (as shown in (A) of Figure 6 . The results showed that when the incubation time was 48 h, the degradation of PTK7 reached approximately 70%. In addition, when 500 nM of the purified S-APTAC degradation chimera was added and incubated for 12, 24, 48 h, the cells were digested with enzyme-free digestion solution, centrifuged at 1000 rpm to collect the cells and remove the supernatant, washed 3 times with DPBS buffer, resuspended with Binding buffer, 200 nM of FAM-labeled Sgc8 was added to the cell suspension and incubated at 4 °C for 30 min, centrifuged at 1000 rpm to collect the cells and remove the supernatant, washed 3 times with Washing buffer to remove the unbound 200 nM FAM-Sgc8, and then the level of PTK7 on the cell surface was measured by flow cytometry (as shown in Figure 6As shown in (B) below, the results showed that with the prolongation of the S-APTAC treatment time, PTK7 on the cell surface was significantly reduced.

[0063] (4) Verification of the concentration dependence of S-APTAC on membrane protein degradation

[0064] HCT116 cells were cultured in 6-well plates. When the cell density reached 60 - 70%, S-APTAC degradation chimeras purified at different concentrations (50, 100, 200, 500, 800, 1000 nM) were added and incubated for 48 h. Then the cells were collected for Western blot analysis to detect the level of the target protein PTK7 (as shown in (A) below). Figure 7 The results showed that the degradation of PTK7 was concentration-dependent on S-AP TAC. When the concentration was 500 nM, the degradation rate reached 65 - 70%. By calculating the gray value and fitting the degradation curve of S-APTAC concentration - PTK7 level (as shown in (B) below), the calculated half-degradation concentration was approximately 163.1 nM. Figure 7 As shown in (B) below, the calculated half-degradation concentration was approximately 163.1 nM.

[0065] (5) Verification of the specificity of S-APTAC for membrane protein degradation

[0066] The Sgc8Mut sequence with a point mutation was obtained by mutating the 13th cytosine of the Sgc8 sequence to thymine (C→T). Flow cytometry was used to verify that the binding ability of Sgc8 Mut to target cells was significantly weakened (as shown in (B) below); the S-APTAC Mut chimera was constructed in the same way as above, and 500 nM of the library control sequence (library sequences: AT CTAACTGATTATTATTATTATTATTATTATTCGGTTAGAAAAAA (SEQ ID NO.8)), Sgc8, S-APTAC, and S-APTAC Mut were added to the cells and treated for 48 h respectively. Then the cells were collected for Western blot analysis to detect the level of the target protein PTK7 (as shown in (C) below). The results showed that only the PTK7 level in the S-APTAC treatment group was significantly reduced, indicating that the degradation of PTK7 depends on the recognition and binding of Sgc8 and the conjugation of the polypeptide; in addition, the CD71 level and PTK7 mRNA level of samples incubated with S-APTAC for different times were detected respectively to evaluate the specificity of S-APTAC (as shown in (D) and (E) below). Figure 8 As shown in (B) below; the S-APTAC Mut chimera was constructed in the same way as above, and 500 nM of the library control sequence (library sequences: AT CTAACTGATTATTATTATTATTATTATTATTCGGTTAGAAAAAA (SEQ ID NO.8)), Sgc8, S-APTAC, and S-APTAC Mut were added to the cells and treated for 48 h respectively. Then the cells were collected for Western blot analysis to detect the level of the target protein PTK7 (as shown in (C) below). Figure 8 The results showed that only the PTK7 level in the S-APTAC treatment group was significantly reduced, indicating that the degradation of PTK7 depends on the recognition and binding of Sgc8 and the conjugation of the polypeptide; in addition, the CD71 level and PTK7 mRNA level of samples incubated with S-APTAC for different times were detected respectively to evaluate the specificity of S-APTAC (as shown in (D) and (E) below). Figure 8 As shown in (D) below, Figure 8 As shown in (E) below. Figure 8The results in (D) showed that the level of CD71 did not change significantly, indicating that the degradation of S-APTAC was target-specific. After treating HCT116 cells with different concentrations of S-APTAC for 48 h, total cellular mRNA was extracted and the mRNA level of PTK7 was detected by qPCR. Figure 8 The results in (E) showed that the mRNA level of PTK7 did not change significantly, indicating that S-APTAC only affected the protein level of PTK7 but not its mRNA level (Primer F: CAGTTCCTGAGGATTTCCAAGAG, Primer R: TGCATAGGGCCACCTTC).

[0067] Primer F sequence: CAGTTCCTGAGGATTTCCAAGAG (SEQ ID NO.9);

[0068] Primer R sequence: TGCATAGGGCCACCTTC (SEQ ID NO.10). The above embodiments have detailed the technical solutions and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, supplements, equivalent replacements, etc. made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A nucleic acid aptamer chimera constructed based on click chemistry, characterized in that, Comprising a first sequence and a second sequence coupled by a click chemical reaction; The first sequence comprises a nucleic acid aptamer targeting a target protein, and the second sequence comprises a signal peptide containing a lysosomal sorting motif.

2. The nucleic acid aptamer chimera constructed based on click chemistry according to claim 1, characterized in that, The lysosomal sorting motif described above is the lysosomal sorting motif.

3. The nucleic acid aptamer chimera constructed based on click chemistry according to claim 1, wherein The target protein is PTK7 protein.

4. The nucleic acid aptamer chimera constructed based on click chemistry according to claim 1, wherein The sequence of the nucleic acid aptamer is as shown in SEQ ID NO.1; the sequence of the signal peptide is as shown in SEQ ID NO.

7.

5. A method for preparing a nucleic acid aptamer chimera as described in any one of claims 1-4, characterized in that, Comprising: Performing a click chemical reaction on a nucleic acid aptamer targeting PTK7 modified with a first group and a signal peptide modified with a second group, thus obtaining the product; The first group is a dibenzocyclooctyne group, a trans-cyclooctene group or a bicyclo[6.1.0]nonyne group; the second group is an azide group.

6. The preparation method of the nucleic acid aptamer chimera according to claim 5, characterized in that The first group is modified at the 3'-end of the nucleic acid aptamer, and the second group is modified at the N-terminus of the signal peptide.

7. The preparation method of the nucleic acid aptamer chimera according to claim 5, wherein The molar ratio of the nucleic acid aptamer to the signal peptide is 1:2-5.

8. A protein degrader, characterized in that, The protein degrader comprises the nucleic acid aptamer chimera according to any one of claims 1-4.

9. Use of a nucleic acid aptamer chimera according to any one of claims 1-4 in the preparation of a protein degradation drug.

10. Use of a protein degrader according to claim 8 in the preparation of a protein degradation drug.

Images