A cap-independent linear mRNA expression system and its applications

Abstract

This invention discloses a cap-independent linear mRNA expression system and its applications. The UPA cap-free linear mRNA of this invention requires no 5' cap addition or nucleic acid modification during in vitro transcription and synthesis, enabling efficient and stable expression. It can be used as an expression system for infectious disease vaccines or tumor vaccines, exhibiting stronger immune-inducing and / or tumor-suppressive effects than conventional mRNA.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a cap-independent linear mRNA expression system and its applications. Background Technology

[0002] In recent years, mRNA, as a direct template for protein synthesis, has been widely used in viral prevention and personalized cancer treatment. As a next-generation vaccine technology, mRNA vaccines offer advantages such as short development cycles, strong immunogenicity, programmable design, and scalable production. They have been successfully applied during the pandemic, demonstrating excellent safety and significant immunoprotective effects. 1 Furthermore, mRNA vaccines have shown great potential in the prevention of other viruses (such as influenza virus, Zika virus, and HIV), and several candidate vaccines have entered clinical trials. 2 Besides viral vaccines, mRNA has also shown significant breakthroughs in the field of cancer treatment, particularly in personalized cancer vaccines. 3 Personalized mRNA tumor vaccines are based on neoantigens in a patient's tumor and are designed to encode specific mRNAs. Once delivered into the body, they induce a specific T-cell immune response, achieving precise targeting and killing of cancer cells. Compared to traditional tumor vaccines, personalized mRNA tumor vaccines have higher specificity and flexibility, capable of simultaneously encoding and expressing multiple tumor neoantigens, thereby more comprehensively activating a polyclonal T-cell immune response against the tumor. This multi-antigen expression characteristic not only enhances the breadth and intensity of the immune response but also provides a more effective solution for addressing tumor heterogeneity. Multiple studies have shown that personalized mRNA tumor vaccines have entered clinical trials and demonstrated reliable safety and positive therapeutic effects in indications such as melanoma, non-small cell lung cancer, and pancreatic cancer. 4,5 In summary, mRNA technology not only shows broad application prospects in virus prevention and control, but also has great potential in the field of personalized tumor treatment.

[0003] Currently, mRNA technology is mainly divided into conventional linear mRNA, self-replicating mRNA (saRNA), and circular RNA (circRNA). Conventional linear mRNA is the most mature form, relying on a 5' cap-mediated translation mechanism. It has the advantages of high expression efficiency and relatively simple preparation, and has been widely used in vaccines and protein replacement therapies. However, its disadvantages include easy degradation, low stability, the need for a cap structure, and the frequent requirement for nucleic acid modification. Self-replicating mRNA is self-amplified in cells by RNA-dependent RNA polymerase (RdRp), which can significantly reduce the required dosage and improve the persistence of protein expression. However, due to its large molecular size, delivery and synthesis are more complex, and it may trigger an excessively strong immune response. Circular RNA, due to its covalent closure at the 5' and 3' ends, is more stable than linear mRNA, reducing nuclease degradation, and is suitable for long-term protein expression, gene therapy, and novel vaccine development. However, its translation relies on IRES or m6A-mediated mechanisms, which may affect translation efficiency, and the production process is not yet mature, still facing challenges such as low circularization efficiency, insufficient yield, and high purification difficulty. Summary of the Invention

[0004] To address the above technical problems, this invention provides a novel cap-free, independent linear mRNA (hereinafter referred to as cap-free linear mRNA) that does not require the addition of a 5' cap or nucleic acid modification during in vitro transcription synthesis.

[0005] The first aspect of the present invention provides a capless linear mRNA, wherein the mRNA comprises, from 5' to 3', the following elements in sequence: one or more tandem 5' protection sequences (UPA), IRES, 5' UTR, a target protein coding region, 3' UTR, and optionally a polyA tail, wherein the 5' protection sequence comprises exonuclease-resistant RNA (xrRNA) and an RNA-binding protein binding motif.

[0006] In some embodiments, the 5' protective sequence is repeated 1-5 times in the mRNA, preferably 2 times.

[0007] In some embodiments, the xrRNA is derived from the 3'UTR of a flavivirus.

[0008] In some embodiments, the flavivirus is selected from cell-fusing agent virus (CFAV), dengue virus (DENV), Usutu virus (USUV), yellow fever virus (YFV), or Zika virus (ZIKV).

[0009] In some embodiments, the 3'UTR of the flavivirus contains the nucleotide sequence shown in any one of SEQ ID NO:12-16.

[0010] In some embodiments, the xrRNA comprises the nucleotide sequence shown in any one of SEQ ID NO:1 or SEQ ID NO:17-33.

[0011] In some embodiments, the RNA-binding protein binding motif is selected from polynucleotide polyA or other RNA-binding protein binding motifs; preferably, the length of the RNA-binding protein binding motif is 36-60 bp; preferably, the length of the polynucleotide motif is 48 bp.

[0012] In some embodiments, the xrRNA is linked to the polyA to form an xrRNA-PolyA sequence.

[0013] In some embodiments, the xrRNA is UX1 derived from the 3'UTR of Usutu virus, the UX1 containing the nucleotide sequence shown in SEQ ID NO: 1; the polynucleotide motif is polyA; and the 5' protective sequence xrRNA-PolyA is defined as the UPA sequence.

[0014] In some embodiments, the UPA comprises the nucleotide sequence shown in SEQ ID NO:8.

[0015] In some embodiments, the UPA is repeated 1-5 times in the mRNA, preferably 2 times.

[0016] In some embodiments, the IRES comprises the nucleotide sequence shown in SEQ ID NO: 3 or 4.

[0017] In some embodiments, the 5'UTR contains the nucleotide sequence shown in any one of SEQ ID NO: 5, 36, 37, and / or the 3'UTR contains the nucleotide sequence shown in any one of SEQ ID NO: 6, 7, 38, 39.

[0018] In some embodiments, the target protein comprises tumor antigens, bacterial antigens, or viral antigens.

[0019] In some embodiments, the tumor antigen is a tumor neoantigen, a tumor-associated antigen, or a tumor-specific antigen.

[0020] In some embodiments, the tumor is cervical cancer or melanoma.

[0021] In some embodiments, the mRNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 51, 52, 54, 55.

[0022] In some embodiments, the infectious disease is caused by one or more viruses selected from HPV, HIV, EBV, and HBV.

[0023] A second aspect of the present invention provides a vector comprising the capless linear mRNA described in the first aspect of the present invention.

[0024] A third aspect of the present invention provides a cell comprising the capless linear mRNA described in the first aspect of the present invention or the vector described in the second aspect of the present invention.

[0025] A fourth aspect of the present invention provides nanolipid particles comprising the capless linear mRNA described in the first aspect of the present invention.

[0026] The fifth aspect of the present invention provides a pharmaceutical composition comprising the capless linear mRNA of the first aspect of the present invention, and / or the carrier of the second aspect of the present invention, and / or the cell of the third aspect of the present invention, and / or the nanolipid particles of the fourth aspect of the present invention.

[0027] In some embodiments, the pharmaceutical composition is a vaccine or other therapeutic protein.

[0028] In some embodiments, the other therapeutic proteins include antibodies, cytokines, and / or enzymes.

[0029] The sixth aspect of the present invention provides the use of the capless linear mRNA described in the first aspect of the present invention, and / or the vector described in the second aspect of the present invention, and / or the cell described in the third aspect of the present invention, and / or the nanolipid particles described in the fourth aspect of the present invention, and / or the pharmaceutical composition described in the fifth aspect of the present invention in the preparation of drugs for tumors or infectious diseases.

[0030] In some embodiments, the tumor is cervical cancer or melanoma.

[0031] Preferably, the virus is selected from HPV, HIV, EBV, or HBV; preferably, the target protein is an HPV E6E7 fusion protein; preferably, the mRNA contains the nucleotide sequence shown in any one of SEQ ID NO: 51-56.

[0032] The advantages of this invention over the prior art are:

[0033] 1. Two self-designed sequences, UPA and EV-A-S1 / EV-A-S2, are used to replace the 5' cap of traditional mRNA, forming UPA cap-free linear mRNA. UPA cap-free linear mRNA does not require a 5' cap structure or nucleotide modification, reducing production costs and simplifying the production process, making it particularly suitable for large-scale vaccine production and personalized cancer treatment.

[0034] 2. Improved mRNA stability and expression persistence: By introducing the UX1 sequence and polyA (UPA sequence) derived from the flavivirus 3'UTR, the degradation of mRNA by the exonuclease XRN-1 was effectively inhibited, thus improving mRNA stability. The tandem design of two UPAs (2UPA) further enhanced the persistence of in vivo expression, with stability even superior to that of traditional capped mRNAs (e.g., luciferase activity persisted for up to 120 hours in mice).

[0035] 3. Compact structure and high safety: The UX1 sequence is only 88 nt and contains only two small stem-loop structures, avoiding the safety risks that may be caused by long sequences (such as sfRNA). Experiments have shown that the UPA capless linear mRNA vaccine did not cause significant toxicological reactions or organ damage in mice, demonstrating good safety.

[0036] 4. Highly efficient translation and immune response: EV-A-S1 and EV-A-S2 IRES can efficiently initiate the translation of cap-free mRNAs, combining UPA and optimized UTR sequences (such as β-globin UTRs) to achieve efficient and stable protein expression. In tumor treatment models, UPA cap-free linear mRNA vaccines induced high levels of tumor-specific T cells and significantly inhibited tumor growth.

[0037] 5. The capless linear mRNA vaccines UPA-E6E7 and 2UPA-E6E7 designed in this invention have shown good safety and tumor treatment effects in mouse models, and have great potential for clinical application. Attached Figure Description

[0038] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0039] Figure 1 A schematic diagram of the design of capless linear mRNA for UPA. The capless linear mRNA sequences of UPA and 2UPA designed in this invention are arranged linearly from 5' to 3' as UPA(UX1+polyA) or 2UPA, EV-A-S1 IRES, 5'UTR, target gene, 3'UTR and polyA tail.

[0040] Figure 2Screening for 5' end protective structures of capless linear mRNA. (A) Schematic diagram of xrRNA and Dumbbell structures and nomenclature in the 3' UTR of genomic RNA of Flavivirviruses CFAV, DENV, USUV, YFV, and ZIKV. (B) Comparison of luciferase activity in cell supernatant 48 h after constructing the structure of Figure (A) into the 5' end of capless linear GLUC mRNA.

[0041] Figure 3 Untranslated region sequence filtering. (A) Schematic diagram of untranslated region filtering. (B) Sequence filtering between UX1 and EV-A-S1. (C) 3'UTR filtering. (D) 5'UTR filtering.

[0042] Figure 4 UX1 modification and nucleic acid modification. (A) Schematic diagram of UX1 secondary structure and pseudo-segment (PK) obtained from SHAPE-Map analysis. (B) Screening of UX1 mutants. (C) Three modified nucleotides, m6A, m1Ψ, and N4-Ac-C, were used in mRNA synthesis at proportions of 5%, 20%, and 100%, and the GLUC activities of these mRNAs were compared.

[0043] Figure 5 Evaluation of uncapped linear mRNA expression based on UPA sequence. (A) Comparison of protein expression levels of uncapped linear mRNAs with UPA, 2UPA, and 3UPA, uncapped linear mRNAs with only EV-A-S1 or PolyA+EV-A-S1, capped mRNA (CAP), and capped modified mRNA (mCAP) after 48 hours of transfection into HEK293T cells. (B) Cell supernatant was collected and washed from days 1 to 5 of HeLa cell transfection with mRNA in Figure (A), and GLUC activity in the supernatant relative to day 1 was detected. (C) Changes in total fluorescence value (Total Flux) of mice over time after injection of four FLUC mRNAs (UPA, 2UPA, mCAP, and CAP) into mouse muscle. (D) In ​​vivo fluorescence images of animals containing data from Figure (C).

[0044] Figure 6Analysis of UPA-binding proteins in cells. (A) Schematic diagram of the method for analyzing UPA sequence-binding proteins: Adding an avidin aptamer sequence after the UPA sequence and binding it with streptavidin magnetic beads to separate the binding proteins in HeLa cells (pull down). Differential bands are collected for mass spectrometry analysis. After identifying candidate proteins, Western blot and RNA immunoprecipitation (RIP) analysis are performed. An aptamer sequence alone is used as a control group. (B) Results of silver staining of proteins separated by pull down. (C) Western blot verification results of candidate proteins. (D) RIP verification results of candidate proteins. The values ​​above the bars indicate the fold enrichment of UPA RNA in the corresponding protein group relative to the control IGG group.

[0045] Figure 7 Safety assessment of the UPA capless linear mRNA vaccine in mice. (A) Changes in mouse body weight after injection of UPA-E6E7, 2UPA-E6E7, and mCAP-E6E7 vaccines. (B) Serum ALT levels in mice before and after two doses of the vaccine. (C) Serum AST levels in mice before and after two doses of the vaccine. (D) Histological staining of major organs in mice two weeks after the second dose of the vaccine.

[0046] Figure 8 Evaluation of the therapeutic effect of UPA capless linear mRNA tumor vaccine. (A) Tumor volume data of B16F10-OVA. (B) Changes in mouse body weight at the same time point. (C) Tumor volume of individual mice in the four groups administered mCAP-FLUC, UPA-OVA, 2UPA-OVA, and mCAP-OVA, and images of tumors excised after euthanasia on day 20 after tumor inoculation; circles indicate mice without tumors. (D) Representative results and statistics of flow cytometry analysis of OVA antigen peptide (SIINFEKL) MHC tetramer-positive T cells.

[0047] Figure 9 Screening for 5' end protective structures of capless linear mRNA. (A) TC-1 tumor volume data. (B) Changes in mouse body weight at the same time point. (C) Tumor volume of individual mice in the four groups treated with mCAP-FLUC, UPA-E6E7, 2UPA-E6E7, and mCAP-E6E7, and subcutaneous tumor images on day 23 after tumor inoculation. (D) Representative results and statistics of flow cytometry analysis of IFNγ-positive T cells. Detailed Implementation

[0048] Terminology Definition

[0049] As used in this article, "xrRNA," or "exoribonuclease-resistant RNA," is an RNA molecule that resists degradation by host exonucleases through a special three-dimensional structure. It is widely present in the genomes of Flaviviridae viruses (such as dengue virus, Zika virus, and West Nile virus). xrRNA forms stable pseudoknot or stem-loop structures through base pairing, hindering the degradation by exonucleases (such as Xrn1 in host cells) along the 5'→3' direction. Its nucleotide sequence is highly conserved in Flaviviridae and is typically located in the 3' uncoding region (3'-UTR) of the viral genome RNA.

[0050] As used in this article, "RNA-binding protein binding motif" refers to a sequence on RNA that binds to an RNA-binding protein motif.

[0051] Design of uncapped linear RNA

[0052] This invention provides a method for designing capless linear mRNA and the UPA capless linear mRNA designed by this method. The UPA capless linear mRNA of this invention does not require the addition of a 5' cap or the use of a capping enzyme for capping during in vitro transcription synthesis, nor does it require nucleic acid modification. It can be synthesized using classic ribonucleotides catalyzed by RNA polymerase and can be expressed efficiently and stably. It can be used as a tumor vaccine expression system and has a stronger induction of immunity and tumor inhibition effect than conventional mRNA.

[0053] In some embodiments, the design and optimization process of the capless linear mRNA of the present invention mainly includes the following steps:

[0054] 1) First, the structure UX1 of the protective capless linear mRNA in the 3'UTR of flavivirus was obtained by screening and then combined with EV-A-S1 IRES to design a capless linear mRNA.

[0055] 2) Further screening and optimization of the untranslated region sequence of capless linear mRNA revealed that using a combination of UX1 and PolyA (UPA) at the 5' end can achieve the highest expression level of capless linear mRNA.

[0056] 3) The protein expression levels and stability of uncapped linear mRNA with UPA, uncapped linear mRNA without UPA sequence, and CleanCap capped linear mRNA were evaluated and compared in cell lines and mice. It was found that the protein expression levels and stability of the two tandem UPA (2UPA) uncapped linear mRNAs in cell lines were close to those of the capped mRNAs, while they had better expression stability in mice.

[0057] 4) Further evaluation of the safety of the UPA capless linear mRNA vaccine showed that the vaccine did not cause significant toxicological changes in mice. Finally, the UPA capless linear mRNA vaccine was used to treat B16F10-OVA and HPV-related TC-1 mouse tumors, and it was found that the UPA capless linear mRNA vaccine induced high levels of tumor-specific immunity and significantly inhibited tumor growth.

[0058] In some embodiments, the UPA uncapped linear mRNA of the present invention is as shown in the appendix. Figure 1 As shown. The 5' to 3' sequences of the UPA capless linear mRNA are UX1 (an xrRNA sequence of Usutu virus USUV) (SEQ ID NO:1), polyA (polyadenylated nucleotide sequence) (SEQ ID NO:2), EV-A-S1 or EV-A-S2 (engineered enterovirus EV-A IRES) (SEQ ID NO:3, 4), 5' UTR (such as SEQ ID NO:5 or others), target gene (drug protein or vaccine), 3' UTR (3' untranslated region sequence) (such as SEQ ID NO:6, 7 or others), and polyA tail (polyadenylated nucleotide tail) (SEQ ID NO:10). Among them, the functions of UX1 and polyA sequences are to stabilize the capless linear mRNA by binding proteins in the cell and inhibit the degradation of XRN-1 enzyme; while the function of EV-A-S1 is to initiate the translation of the capless linear mRNA to efficiently express the target gene. The UX1 sequence is only 88 nt in length and contains only two small stem-loop structures.

[0059] In this invention, the protective combination of UX1 and polyA is referred to as the UPA sequence (SEQ ID NO:8), and this cap-independent linear mRNA is called UPA-uncapped linear mRNA. By using two repeated UPA sequences (2UPA (SEQ ID NO:9)) at the 5' end of the UPA-uncapped linear mRNA, its intracellular stability is further improved, enabling more sustained and stable expression of the target gene and achieving better drug efficacy.

[0060] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0061] Unless otherwise defined, the technical or scientific terms used herein shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0062] Example 1: Synthesis of capless linear mRNA of UPA

[0063] Construction of capless linear mRNA plasmid for UPA: The pUC57 plasmid was constructed by inserting the T7 promoter (SEQ ID NO:11), UPA (SEQ ID NO:8) or 2UPA sequence (SEQ ID NO:9), EV-A-S1 IRES (SEQ ID NO:3), human β-globin 5'UTR (SEQ ID NO:5), the target gene, human HBA13'UTR (SEQ ID NO:6), and a 105 nt poly(A) sequence as the template plasmid for capless linear mRNA of UPA. The DNA fragment was synthesized by Genewiz and amplified by PCR. Seamless cloning was performed using the Novozymes ClonExpress II one-step cloning kit.

[0064] In vitro transcription synthesis of capless linear mRNA using UPA: Using the T7 High Yield RNA Synthesis Kit from Yisheng Biotechnology, ATP, UTP, CTP, GTP, and 10× Transcription Buffer were mixed sequentially. Linearized template plasmid DNA (500 ng per 20 μL system) and T7 RNA Polymerase Mix were added, followed by the addition of an appropriate amount of RNase-free Wattler. The mixture was incubated at 37°C for 2 hours. RNA was purified and quality controlled.

[0065] In vitro transcription synthesis of capped linear mRNA: All capped linear mRNA templates were constructed using Takara Bio's mRNA template cloning kit (Baori Medical, catalog number 6143). The template plasmid in this kit contained the T7 promoter, human β-globin 5'UTR, human HBA1 3'UTR, and a 105 nt poly(A) sequence. Using Yisheng Bio's T7 High YieldRNA Synthesis Kit for Co-transcription, ATP, N1-Me-Pseudo UTP (modified) or UTP (unmodified), CTP, GTP, and cap1 m7GAG cap, along with 10×Transcription Buffer, were added. Linearized template plasmid DNA (500 ng in a 20 μL system) and T7 RNA Polymerase Mix were added, followed by the addition of an appropriate amount of RNase Free Water. The mixture was incubated at 37°C for 2 h. RNA was purified and quality controlled.

[0066] Example 2: Screening for 5' end protective structures of capless linear mRNA

[0067] The inventors previously designed EV-A-S1 IRES through large-scale screening and engineering, which can replace the 5' cap structure of traditional mRNA for efficient initiation of target protein translation. However, another function of the linear mRNA cap is to inhibit the degradation of the major intracellular RNA 5' exonuclease XRN-1, thus achieving stable mRNA expression. Therefore, it is necessary to find a sequence that can play a similar inhibitory role to combine with EV-A-S1 IRES to construct a stable linear mRNA that does not require capping. According to literature reports, the 3'UTR of flavivirus genomic RNA contains structures that can inhibit XRN-1 degradation, including xrRNA structures and dumbbell structures. Therefore, the inventors used RNAfold to analyze the secondary structure of the 3'UTR sequences (SEQ ID NO: 12-16) of flaviviruses CFAV, DENV, USUV, YFV, and ZIKV, identifying a total of 18 xrRNA and dumbbell-type structures. Figure 2A)(SEQ ID NO:1, 17-33), and these structures were constructed one by one into the 5' end of a linear Gaussian luciferase (GLUC) mRNA with EV-A-S1 IRES (separated from EV-A-S1 IRES by a polyA to avoid mutual interference between secondary structures). By comparing the luciferase activity of the cell supernatant of these uncapped linear mRNAs after 48 h of transfection into HEK239T cells (cells were transfected using CALNP mRNA reagent from Beijing Dona Pharmaceuticals, and luciferase activity was detected using the Beyotime Gaussian luciferase reporter gene assay kit), the inventors found that when the 5' end of the uncapped linear mRNA used the five structures UX1, DX1, ZX1, DD1, and DX2, its luciferase expression level was significantly higher than that of the uncapped linear mRNA without the protective structure before EV-A-S1 IRES. Figure 2 (B) Specifically, adding UX1 from USUV (Usutu virus) before EV-A-S1 IRES increased luciferase expression levels to approximately 6.5 times that of the unprotected group. These results demonstrate that adding certain flavivirus 3'UTR structures to the 5' end of uncapped linear mRNA does indeed enhance its expression levels. The UX1 (SEQ ID NO: 1) structure showed the greatest effect in increasing uncapped linear mRNA expression.

[0068] UX1 (SEQ ID NO: 1)

[0069] aatttgatagtcaggccagggcaacctgccaccggaagttgagtagacggtgctgcctgcgactcaaccccaggc ggactgggttagc (SEQ ID NO: 1)

[0070] Example 3: Untranslated region sequence screening, UX1 modification, and nucleic acid modification

[0071] Following the initial screening, the inventors selected UX1, which demonstrated the highest efficiency, as the 5' end protective sequence for the uncapped linear mRNA. To further optimize the expression level of the uncapped linear mRNA, the inventors also used uncapped linear GLUC mRNA to screen the spacer sequence between UX1 and EV-A-S1 IRES, as well as the 5' and 3' untranslated regions of the mRNA. Figure 3 A). The results showed that adding polyA between UX1 and EV-A-S1, compared with no sequence or the addition of other polysequences such as PolyC (SEQ ID NO:34) and PolyT (SEQ ID NO:35), significantly increased the expression level of luciferase. Figure 3B). The inventors then compared the effects of several 5'UTR (SEQ ID NO: 5, 36, 37) and 3'UTR (SEQ ID NO: 6, 7, 38, 39) sequences when used in uncapped linear mRNA, and found that uncapped linear mRNA with both 3'UTR and 5'UTR using β-globin UTRs had the highest translation efficiency. Figure 3 C, 3D).

[0072] Previous studies have shown that the inhibitory effect of xrRNA on XRN-1 is regulated by pseudo-segments in its structure. Therefore, modifying the pseudo-segment structure of UX1 may further enhance its effect in capless linear mRNA. To verify this hypothesis, the secondary structure of UX1 was first resolved using SHAPE-Map technology, and the pseudo-segment structure of UX1 was analyzed using IPknot software. It was found that UX1 contains two pseudo-segment structures, PK1 and PK2. Figure 4 A). UX1 mutants with extended pseudo-intercalation sequences (Long-PK1 (SEQ ID NO:40), Long-PK2 (SEQ ID NO:41)) or increased PK2 GC ratio (mPK2 (SEQ ID NO:42)) were designed. Validation in uncapped linear GLUC mRNA revealed that the three mutants did not enhance but rather reduced the expression of uncapped linear GLUC. Figure 4 B). This shows that simply modifying the length of pseudo-segments or the GC ratio cannot enhance the effect of UX1; on the contrary, it may change the stability of the overall structure of UX1.

[0073] Nucleic acid modifications such as pseudouracil can regulate mRNA stability and translation efficiency. Therefore, this study attempted to introduce nucleic acid modifications into capless linear mRNA and evaluate its protein expression level. Different proportions of m6A, m1Ψ, and N4-Ac-C modified nucleotides were incorporated into capless linear GLUC mRNA during in vitro transcription. After transfection into HEK293T cells for 48 hours, GLUC luciferase activity was measured. The results showed that with increasing proportions of the three nucleic acid modifications, the expression of capless linear GLUC mRNA decreased. Figure 4 C). This may be because the functions of UX1 and EV-A-S1 IRES in capless linear mRNA depend on the formation of specific secondary structures, and the introduction of non-classical nucleotides alters the secondary structures of these sequences, thus disrupting their functions.

[0074] Example 4: Evaluation of Uncapped Linear mRNA Expression Based on UPA Sequence

[0075] Based on the previous experimental results, it was determined that capless linear mRNAs with a UX1 plus PolyA sequence at the 5' end (hereinafter referred to as UPA sequences) had the highest protein expression level. Next, capless linear mRNAs with one (UPA) (SEQ ID NO:43), two (2UPA) (SEQ ID NO:44), and three (3UPA) (SEQ ID NO:45) tandem UPA sequences at the 5' end were designed. These UPA capless linear mRNAs were compared with CleanCap-capped linear mRNAs (unmodified CAP and m1Ψ-modified mCAP) (SEQ ID NO:48) and capless linear mRNAs without UPA (pA-EV-A-S1 (SEQ ID NO:46), EV-A-S1 (SEQ ID NO:47)). It was found that the introduction of UPA significantly improved the expression of capless linear mRNAs, but the expression level was still slightly lower than that of CleanCap-capped linear mRNAs. Figure 5 A). By comparing multiple tandem UPA uncapped linear mRNAs, the inventors found that the uncapped linear mRNA with two tandem UPAs had the highest expression level. Figure 5 A). Further investigation was conducted into the stability of uncapped linear mRNAs based on the UPA sequence in HeLa cell lines during long-term protein expression. Results showed that the expression stability of 2UPA and 3UPA uncapped linear mRNAs in cells was comparable and largely consistent with that of capped linear mRNAs produced using the CleanCap technique. The stability of single-UPA uncapped linear mRNAs was slightly lower than that of capped mRNAs, while the expression stability of uncapped linear mRNAs containing only PolyA and EV-A-S1, or only EV-A-S1, was significantly lower than that of other mRNAs. Figure 5 B). To further evaluate the ability of UPA capless linear mRNA to express drug proteins in mammals, BALB / c mice were intramuscularly injected with SM102 LNP-encapsulated UPA, 2UPA capless linear FLUC (firefly luciferase) mRNA, and CAP, mCAP FLUC mRNA. Unlike the results in HeLa cells, luciferase activity in mice was continuously monitored up to 120 h. The results showed that the luciferase level of 2UPA capless linear FLUC was consistently higher than that of the two modified mRNAs, mCAP FLUC and unmodified CAP FLUC, from 48 h to 120 h. Figure 5 C, 5D).

[0076] In summary, tandem UPA sequences significantly enhance the protein expression stability of uncapped linear mRNAs. Uncapped linear mRNAs with two tandem UPA sequences have a stronger ability to continuously express proteins in mammals than linear mRNAs with CleanCap modified by m1Ψ.

[0077] Example 5: Analysis of UPA sequence binding proteins in cells

[0078] As an artificially modified viral sequence, the UPA sequence may interact with some proteins in human cells, affecting the function and safety of uncapped linear UPA mRNA. Therefore, a single RNA sequence (SEQ ID NO:49) consisting of UPA and an avidin aptamer (SEQ ID NO:50) was designed to isolate binding proteins from HeLa cell lysates. The interactions between the UPA sequence and these proteins were analyzed and verified using mass spectrometry, Western blot, and RNA immunoprecipitation (RIP). Figure 6 (A, 6B). After mass spectrometry analysis detected differentially expressed proteins such as YBX1, PABPC1, ILF2, ILF3, IGF2BP1, EIF2AK2, DDX3X, and HNRNPR, the inventors performed Western blot verification. The results showed that the UPA sequence was indeed enriched in these seven proteins (YBX1, PABPC1, ILF2, ILF3, IGF2BP1, EIF2AK2, and HNRNPR), but not in DDX3X. Further RIP experiments were used to verify the binding of RNA to these proteins in living cells, finding that all seven proteins except HNRNPR were enriched in UPA RNA. HNRNPR is mainly distributed in the nucleus, not the cytoplasm, which may explain why it did not enrich in UPA RNA transfected into the cytoplasm. These data indicate that the UPA sequence interacts with proteins such as YBX1, PABPC1, ILF2, ILF3, IGF2BP1, and EIF2AK2 in living cells. Among these proteins, ILF2, ILF2, and EIF2AK2 are all immune regulation-related proteins, and their binding to UPA may affect the immune-inducing ability of UPA uncapped linear mRNA. PABPC1 is a polyA-binding protein that can stabilize RNA and promote translation; therefore, it can bind to the polyA of the UPA sequence to enhance the stability and translation level of UPA uncapped linear mRNA. YBX1 and IGF2BP1 are common RNA-binding proteins with RNA-stabilizing functions; their interaction with UPA may further stabilize UPA uncapped linear mRNA. These results suggest that the UPA sequence may stabilize RNA not only by inhibiting XRN-1 but also by binding to RNA-binding proteins and regulating RNA recognition and immune induction.

[0079] Example 5: Safety assessment of UPA capless linear mRNA vaccine in mice

[0080] The preceding data demonstrates that the 2UPA plus EV-A-S1 design enables capless linear mRNA to achieve translational levels similar to, and even better than, CleenCap capped mRNA with a capping efficiency of approximately 95%. Capless linear mRNA omits the capping step of linear mRNA, simplifying production and, more importantly, breaking down the technological barriers between mRNA capping and capped analogues. However, considering the immunostimulatory properties of both the triphosphate ends and virus-derived sequences of capless linear mRNA, assessing its safety is a crucial step in the development process. Therefore, a capless linear mRNA HPV E6E7 fusion protein vaccine with clinical application potential was designed, and its safety was evaluated in mice. The inventors injected 5 μg RNA / dose / mouse of uncapped linear mRNA LNP vaccine SM102 (UPA-E6E7 (SEQ ID NO:51), 2 μg RNA / dose / mouse) of UPA-E6E7 (SEQ ID NO:52), and capped modified mCAP-E6E7 (SEQ ID NO:53) mRNA LNP vaccine SM102 into the muscle of three groups of C57BL / 6 mice, respectively. One week later, a booster dose of the same vaccine was administered. During this period, mouse body weight and serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were monitored. Results showed that within one week after the first and booster doses, the body weight of the three groups of mice did not differ significantly from the untreated group. Figure 7 A). Meanwhile, on day 7 after the first and booster doses of the vaccine, the serum ALT and AST levels in the treated mice showed no significant changes compared to the pre-treatment or untreated groups. Figure 7 B, 7C). Finally, the mice were euthanized two weeks after receiving the booster vaccine, and major internal organs were collected for histological staining. Histological results showed that the heart, liver, spleen, lungs, and kidneys of the treated mice did not exhibit obvious drug-related pathological features. Figure 7 D). The above results indicate that the capless linear mRNA vaccines of UPA and 2UPA are safe in mice when administered with 5ug RNA / dose / two doses only.

[0081] Example 6: Evaluation of the therapeutic effect of UPA capless linear mRNA tumor vaccine

[0082] Four groups of C57BL / 6 mice were subcutaneously injected with B16F10-OVA tumor cells. On days 3 and 10 post-cell injection, mice were intramuscularly injected with 3 μg RNA / dose / mouse of UPA, 2UPA uncapped linear mRNA vaccines encoding the OVA antigen (UPA-OVA (SEQ ID NO:54), 2UPA-OVA (SEQ ID NO:55)), and a modified capped mCAP mRNA vaccine (mCAP-OVA (SEQ ID NO:56)), as well as the control mCAP FLUC (mCAP-FLUC). Tumor volume was continuously measured from day 3 to 20 post-cell inoculation. The results showed that tumor growth was significantly slower in mice treated with the three OVA vaccines compared to the control group, with the 2UPA-OVA group exhibiting the slowest tumor growth. Figure 8 A, 8C). Simultaneous measurements of mouse body weight showed no abnormal changes in mouse body weight after administration of the UPA, 2UPA capless linear mRNA vaccine, and modified capped mRNA vaccine, further demonstrating the safety of the UPA capless linear mRNA vaccine. Figure 8 B). To compare the efficacy of vaccine-induced tumor antigen T-cell immunity, peripheral blood was collected from mice one week after the second immunization to detect the proportion of T cells targeting the OVA antigen in PBMCs. Flow cytometry analysis showed that, compared with the control group, all three OVA vaccines significantly induced high levels of OVA antigen-specific T cells (mean proportion of MHC tetramer-positive T cells for OVA antigen peptide (SIINFEKL, SEQ ID NO: 57): UPA-OVA 15.8%; 2UPA-OVA 22.9%; mCAP-OVA 19.1%; mCAP-FLUC 0.7%). Figure 8 (D) Consistent with its tumor growth inhibition effect, the 2UPA-OVA group showed the highest average proportion of tumor OVA antigen-specific T cells. These results demonstrate that UPA-based capless linear mRNA tumor vaccines have excellent specific immune induction and tumor therapeutic effects.

[0083] Example 7: Evaluation of the efficacy of UPA uncapped linear mRNA HPV E6E7 vaccine in treating HPV-related tumors.

[0084] Human papillomavirus (HPV) is closely associated with the development of various cancers, including cervical cancer, anal cancer, and oropharyngeal cancer. Tumor cells in these cancers typically express HPV proteins such as E6 and E7. Therefore, the HPV E6E7 UPA capless linear mRNA vaccine designed by the inventors has potential clinical value in treating HPV-related tumors. To investigate the vaccine's tumor therapeutic effect, C57BL / 6 mice were subcutaneously injected with TC-1 cells expressing HPV E6 and E7 proteins. By day nine of tumor growth, the average tumor volume was approximately 50 mm².3 Mice were injected with several vaccines, including UPA-E6E7, 2UPA-E6E7, and mCAP-E6E7 (3ug / dose / mouse). Results showed that after two injections, the tumor volume of mice in all three groups treated with the E6E7 vaccine shrank significantly and persistently, while the tumor volume of mice in the control group continued to increase. Figure 9 A, 9C). The stable increase in mouse body weight during the same period also indicates that the UPA uncapped linear mRNA HPV E6E7 vaccine has good safety. Figure 9 B). One week after the second vaccination, mouse PBMCs were isolated and stimulated with E6 and E7-derived antigenic peptides (GenScript Biotech) to analyze the proportion of E6 and E7 antigen-specific T cells. Results showed that all three E6 and E7 vaccines successfully induced a high proportion of antigen-specific T cells (mean proportion of IFNγ-positive T cells: UPA-OVA 9.6%; 2UPA-OVA 15.5%; mCAP-OVA 13.6%; mCAP-FLUC 0.1%). Figure 9 (D) The 2UPA-E6E7 vaccine induced the highest proportion of antigen-specific T cells, significantly higher than the UPA-E6E7 vaccine group, indicating that the two tandem UPA sequences significantly enhanced the immunogenicity of the capless linear mRNA vaccine. These results demonstrate that the capless linear mRNA HPV E6E7 vaccine based on the UPA sequence can efficiently induce antigen-specific T cell immunity and treat HPV-related tumors, possessing significant clinical application potential.

[0085] References:

[0086] 1.Baden LR,El Sahly HM,Essink B,et al.Efficacy and Safety of themRNA-1273SARS-CoV-2

[0087] Vaccine.N Engl J Med.2021;384(5):403-416.doi:10.1056 / NEJMoa2035389

[0088] 2.Pardi N,Krammer F.mRNA vaccines for infectious diseases-advances, challenges and

[0089] opportunities.Nat Rev Drug Discov.2024;23(11):838-861.doi:10.1038 / s41573-024-01042-y

[0090] 3.Liu C,Shi Q,Huang X,Koo S,Kong N,Tao W.mRNA-based cancertherapeutics.Nat Rev

[0091] Cancer.2023;23(8):526-543.doi:10.1038 / s41568-023-00586-2

[0092] 4.Weber JS,Carlino MS,Khattak A,et al.Individualised neoantigentherapy mRNA-4157(V940)

[0093] plus pembrolizumab versus pembrolizumab monotherapy in resectedmelanoma

[0094] (KEYNOTE-942):a randomised,phase 2b study.Lancet.2024;403(10427):632-644.

[0095] doi:10.1016 / S0140-6736(23)02268-7

[0096] 5.Rojas LA,Sethna Z,Soares KC,et al.Personalized RNA neoantigenvaccines stimulate T cellsin pancreatic cancer.Nature.2023;618(7963):144-150.doi:10.1038 / s41586-023-06063-y

Claims

1. A capless linear mRNA, characterized in that, comprises, in order from 5' to 3', 1-5 tandem 5' protection sequences, an IRES, a 5' UTR, a protein coding region of interest, a 3' UTR, and optionally a polyA tail; wherein the 5' protection sequence is a UPA consisting of the nucleotide sequence set forth in SEQ ID NO: 8; the IRES consists of the nucleotide sequence set forth in SEQ ID NO: 3; the 5' UTR consists of the nucleotide sequence set forth in SEQ ID NO: 5; and the 3' UTR consists of the nucleotide sequence set forth in SEQ ID NO:

6.

2. The mRNA of claim 1, wherein the number of repeats of the UPA in the mRNA is 2.

3. The mRNA of any one of claims 1-2, wherein the protein of interest comprises a tumor antigen, a bacterial antigen, or a viral antigen.

4. The mRNA of claim 3, wherein the tumor antigen is a tumor-associated antigen or a tumor-specific antigen.

5. The mRNA of claim 4, wherein the tumor is cervical cancer or melanoma.

6. The mRNA of claim 3, wherein the virus is selected from the group consisting of HPV, HIV, EBV, and HBV.

7. The mRNA of claim 3, wherein the protein of interest is a HPV E6E7 fusion protein.

8. The mRNA of claim 3, wherein the mRNA comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 51, 52, 54, and 55.

9. A pharmaceutical composition, characterized by, A pharmaceutical composition comprising the mRNA of any one of claims 1-8.

10. Use of the mRNA of any one of claims 1-8 or the pharmaceutical composition of claim 9 in the preparation of a medicament for treating a tumor or an infectious disease.

11. The use of claim 10, wherein the tumor comprises cervical cancer or melanoma.

12. The use of claim 10, wherein the infectious disease is caused by one or more viruses selected from the group consisting of HPV, HIV, EBV, and HBV.

Images