Small peptide for improving abiotic stress of tartary buckwheat and application thereof

Abstract

The invention discloses a small peptide for improving abiotic stress of tartary buckwheat and application of the small peptide, and relates to the technical field of biotechnology and botany, the small peptide is FtRALF6, and the amino acid sequence of the FtRALF6 is as shown in SEQ ID No.1. By exogenous application of the FtRALF6 small peptide, salt stress resistance, heavy metal stress resistance, cold stress resistance and heat stress resistance of the tartary buckwheat can be remarkably improved, normal growth and physiological functions of the tartary buckwheat under adversity are effectively maintained, and yield and quality are improved. The small peptide is small in molecular weight, easy to absorb, environment-friendly and large in application potential, the tartary buckwheat planting range can be expanded, the planting economic benefits are improved, and a new thought is provided for crop stress resistance research and technical development.

Description

Technical Field

[0001] The present invention relates to the technical fields of biotechnology and botany, and particularly relates to a small peptide for improving abiotic stress of tartary buckwheat and its application. Background Art

[0002] Abiotic stress refers to abiotic environmental conditions that are not conducive to the survival, growth and development of plants and may even cause damage, destruction and death. It includes low temperature, high temperature, drought, salinity, waterlogging, excessive light, ultraviolet radiation, mineral nutrient deficiency, oxygen deficiency, strong wind, damage, and pollution of air, soil or water bodies such as heavy metal, pesticide, ozone and sulfur dioxide pollution, etc. Common abiotic stresses are extreme temperature, high salt and heavy metal pollution.

[0003] At present, improving the tolerance of tartary buckwheat to abiotic stress mainly relies on traditional breeding methods and cultivation management measures. Traditional breeding methods have a long cycle, low efficiency and are limited by the genetic resources of tartary buckwheat. Although cultivation management measures such as reasonable irrigation and fertilization can alleviate the impact of abiotic stress to a certain extent, the effect is limited. In recent years, it has been found that polypeptides are a new type of plant growth regulator. In addition to having the characteristics of protein molecules, they also play an extremely important regulatory role in regulating plant growth, development, reproduction and response to external environmental stress. As a kind of polypeptide, small peptides have the advantages of small molecular weight, easy absorption and high activity. In other crops, it has been shown that certain small peptides can improve the tolerance of plants to abiotic stresses such as salt stress and drought stress. However, the research on small peptides in tartary buckwheat is relatively less, especially the small peptides capable of improving the abiotic stress tolerance of tartary buckwheat and their action mechanisms are still unclear. Therefore, developing a small peptide that can improve the abiotic stress tolerance of tartary buckwheat has important theoretical and practical significance. Summary of the Invention

[0004] In view of the above deficiencies of the prior art, the present invention provides a small peptide for improving abiotic stress of tartary buckwheat and its application.

[0005] To achieve the above invention purpose, the technical solution adopted by the present invention is as follows: Provide a small peptide for improving abiotic stress of tartary buckwheat, the small peptide is FtRALF6, and the amino acid sequence of FtRALF6 is shown in SEQ ID No.1.

[0006] The present invention also provides the application of the above small peptide, and the small peptide is used to improve the tolerance of tartary buckwheat to abiotic stress.

[0007] Further, the abiotic stress is salt stress, heavy metal stress, cold stress and heat stress.

[0008] Furthermore, the heavy metal stress is cadmium stress or antimony stress; the cold stress is when the temperature is less than or equal to 4°C; the heat stress is when the temperature is greater than or equal to 40°C.

[0009] Furthermore, the application method of the small peptide is spraying or irrigation. When applying the small peptide, it is dissolved in water or nutrient solution, and the application concentration of the small peptide is 1 μM.

[0010] Furthermore, the application period of the small peptide is the 3-4 leaf stage of the crop.

[0011] The present invention also provides a preparation for improving the abiotic stress resistance of tartary buckwheat, and the preparation includes the FtRALF6 small peptide.

[0012] The beneficial effects of the present invention are as follows: By exogenously applying the FtRALF6 small peptide, the present invention can significantly improve the salt stress resistance, heavy metal stress resistance, cold stress resistance and heat stress resistance of tartary buckwheat, effectively maintain the normal growth and physiological functions of tartary buckwheat under adversity, and improve the yield and quality. Moreover, the small peptide has a small molecular weight, is easy to absorb, is environmentally friendly, and has great application potential. It can not only expand the planting range of tartary buckwheat and improve the planting economic benefits, but also provide new ideas for crop stress resistance research and technology development. Description of the Drawings

[0013] Figure 1 It is a comparative statistical chart of the effects of different abiotic stresses on the expression of the FtRALF6 gene in the roots and leaves of tartary buckwheat in Example 1; Figure 2 It is a comparative chart of the phenotypes of hydroponic tartary buckwheat under different abiotic stresses in Example 2; Figure 3 It is a comparative statistical chart of the root phenotypes, main root lengths and fresh weights of tartary buckwheat under different abiotic stresses in Example 2; Figure 4 It is a comparative statistical chart of malondialdehyde and superoxide anion of tartary buckwheat under different abiotic stresses in Example 3; Figure 5 It is a comparative statistical chart of the dehydrogenase activity of tartary buckwheat under different abiotic stresses in Example 4; Figure 6 It is a comparative statistical chart of the photosynthetic pigment content of tartary buckwheat under different abiotic stresses in Example 5. Detailed Embodiments

[0014] The following describes the specific embodiments of the present invention to facilitate those skilled in the art of this technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art of this technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions made using the inventive concept of the present invention are within the scope of protection.

[0015] The sources of the raw materials used in the embodiments of the present invention are shown in Table 1 below: Table 1

[0016] The tartary buckwheat used in the embodiments of the present invention is Chengku No. 2, an independently selected and bred variety successfully identified by Chengdu University on March 16, 2023.

[0017] Example 1: Batch hydroponics of tartary buckwheat was carried out in the same environment. When the tartary buckwheat grew 3 - 4 true leaves, seedlings with similar growth vigor were selected and divided into six groups, with 12 plants in each group. Among them, the control group was cultured with normal Hoagland nutrient solution, while the stress groups were hydroponically treated with 150 mM of NaCl, 100 μM of Sb(III) (analytical grade, C8H4K2O 12 Sb2), 200 μM of CdCl2, and in cold (4°C) and hot (40°C) environments; at 0, 6, 12, and 24 h of the treatment, the leaves and roots of the seedlings were collected, and the total RNA of the samples was extracted according to the instructions of the plant total RNA isolation kit. The qualified RNA was reverse transcribed into cDNA using the HiScript® III RT SuperMix for qPCR (+gDNA wiper) kit. Using the Ftactin gene as an internal reference, the primer sequences were: Ftactin - F: GGAAGTATAGCGTCTGGATTGGC; (as shown in SEQ ID No.2) Ftactin - R: CACTTGCGGTGAACGATTGC. (as shown in SEQ ID No.3) At the same time, gene - specific primers were designed: FtRALF6 - F: GCGGAGGAGGACGAGGAGATG; (as shown in SEQ ID No.4) FtRALF6 - R: GGCGGCAGTTGTAGTAGGATGTTC. (as shown in SEQ ID No.5) Three biological replicate experiments were conducted, and the expression level of FtRALF6 was detected on a BAI7500 real - time fluorescence quantitative PCR instrument using real - time fluorescence quantitative PCR technology. The 2 -ΔΔCT algorithm was used to calculate the relative expression level of the target gene; the 2 -ΔΔCT value at 0 h of induced expression was set to 1, and the expression fold at 0, 6, 12, and 24 h under Control, 150 mM of NaCl, 100 μM of Sb, 200 μM of CdCl2, cold (4°C), and hot (40°C) environments was calculated.

[0018] The results are as Figure 1 shown, where Figure 1 A and Figure 1 B are the expression levels of FtRALF6 in root hairs and leaves at different treatment times under NaCl environment, respectively; Figure 1 C and Figure 1 D are the expression levels of FtRALF6 in root hairs and leaves at different treatment times under CdCl2 environment, respectively; Figure 1 E and Figure 1 F are the expression levels of FtRALF6 in root hairs and leaves at different treatment times under Sb environment, respectively; Figure 1 G and Figure 1 H are the expression levels of FtRALF6 in root hairs and leaves at different treatment times under 4°C environment, respectively; Figure 1 I and Figure 1 J are the expression levels of FtRALF6 in root hairs and leaves at different treatment times under 40°C environment, respectively; where Control is the control group.

[0019] It can be seen from Figure 1 that the expression levels of FtRALF6 under the five abiotic stresses all showed significant up-regulation. Under salt (NaCl) stress (12 hours), the expressions in its roots and leaves reached 10.7 times and 30.2 times that of the control, respectively. After 6 hours of cadmium (CdCl2) exposure, the expression of FtRALF6 in roots showed a 4.04-fold induction relative to the control group, and after 12 hours, the expression in leaves increased to 18.62 times. After 12 hours of antimony (Sb) treatment, the expressions in roots and leaves increased by 4.0 times and 42.28 times, respectively. After 24 hours of cold (4°C) exposure, the expression levels of FtRALF6 in roots and leaves increased by 5.10 times and 8.57 times relative to the control group, respectively, while after 6 hours of heat stress (40°C), the expression level in roots increased by 14.17 times, and the expression level in leaves increased by 13.86 times. These results prove that FtRALF6 has the ability of multi-stress response regulation in different abiotic stresses.

[0020] Example 2: The small peptide FtRALF6 was synthesized by Fmoc solid-phase synthesis method. The amino acid sequence of the small peptide FtRALF6 is: RYISYGALKRDYIPCS (SEQ ID No.1); The prepared small peptide powder of FtRALF6 was centrifuged at 4000 rpm / min for 5 minutes and dissolved in the nutrient solution to obtain the FtRALF6 / nutrient solution mixture, so that the concentration of the small peptide FtRALF6 in the nutrient solution was 1 μM. Select 3-4 seedlings at the true leaf stage with similar growth and intervene with the FtRALF6 / nutrient solution mixture for one day.

[0021] The seedlings after FtRALF6 peptide intervention were subjected to abiotic stresses, including salt (NaCl), heavy metals (Sb, CdCl2), cold (4°C), and heat (40°C); the groups that needed to be subjected to abiotic stresses were stressed for two days, and the phenotypes were observed; the results are as Figure 2 shown, where the white block in the lower right corner is the scale bar (4 cm); CK is the seedling of the CK control group that was not intervened with FtRALF6 peptide and not subjected to abiotic stress; FtRALF6 is the seedling of the FtRALF6 treatment group that was intervened with FtRALF6 peptide but not subjected to abiotic stress; NaCl is the seedling that was not intervened with FtRALF6 peptide and subjected to salt stress; CdCl2 is the seedling that was not intervened with FtRALF6 peptide and subjected to heavy metal cadmium stress; Sb is the seedling that was not intervened with FtRALF6 peptide and subjected to heavy metal antimony stress; Cold is the seedling that was not intervened with FtRALF6 peptide and subjected to cold stress; Heat is the seedling that was not intervened with FtRALF6 peptide and subjected to heat stress; NaCl+FtRALF6 is the seedling that was intervened with FtRALF6 peptide and subjected to salt stress; CdCl2+FtRALF6 is the seedling that was intervened with FtRALF6 peptide and subjected to heavy metal cadmium stress; Sb+FtRALF6 is the seedling that was intervened with FtRALF6 peptide and subjected to heavy metal antimony stress; Cold+FtRALF6 is the seedling that was intervened with FtRALF6 peptide and subjected to cold stress; Heat+FtRALF6 is the seedling that was intervened with FtRALF6 peptide and subjected to heat stress; It can be seen from Figure 2 that there is no obvious difference in the phenotypes between the CK control group and the FtRALF6 treatment group. Compared with the CK control group, the growth of tartary buckwheat was significantly inhibited under different abiotic stresses (i.e., NaCl, CdCl2, Sb, Cold, Heat). And compared with the single abiotic stress (i.e., NaCl, CdCl2, Sb, Cold, Heat), the exogenous application of FtRALF6 (i.e., NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) effectively reduced the inhibitory effect of stress on the growth of tartary buckwheat.

[0022] The seedlings of different treatment groups were taken out, and their roots were washed with clean water. After washing, the roots were scanned and analyzed using the WinRHIZO root scanning system (Version 2007d, Regent Instrument Inc, Canada). The primary root length of each seedling was measured with a ruler, and the fresh weight was weighed with an electronic balance. The results are as Figure 3 shown (p<0.05), where Figure 3 A-E are the phenotypic comparisons of the seedlings; Figure 3 F-J are the statistical comparisons of the primary root lengths under salt, cadmium, antimony, cold, and heat stresses in sequence; Figure 3 K-O are the statistical comparisons of the fresh weights of the primary roots under salt, cadmium, antimony, cold, and heat stresses in sequence; It can be Figure 3 seen that different abiotic stresses significantly inhibited the root development of tartary buckwheat. Compared with the CK control group, under salt, cadmium, antimony, cold, and heat treatments, the primary root lengths decreased by 30.34%, 41.24%, 34.73%, 43.81%, and 50.19% respectively, and the fresh weights decreased by 66.16%, 49.47%, 54.31%, 75.42%, and 84.88% respectively. Compared with the stress control group, after exogenous application of FtRALF6, the primary root lengths increased by 46.72%, 35.37%, 46.60%, 87.87%, and 80.51% respectively, while the fresh weights increased by 91.28%, 38.96%, 44.89%, 108.43%, and 228.64% respectively.

[0023] Example 3: Root samples of different treatment groups in Example 2 were taken, and the samples were ground into a homogenate using the extraction solution under ice bath conditions. After centrifugation, the supernatant was taken, and the malondialdehyde (MDA) detection working solution was added. After boiling water bath treatment for 60 min, it was cooled to room temperature in an ice bath. After centrifugation, the absorbance values of the supernatant were measured at wavelengths of 450 nm, 532 nm, and 600 nm respectively to detect the MDA content in the roots.

[0024] In addition, the extraction solution and hydroxylamine hydrochloride were added to the supernatant, mixed well, reacted at 37°C for 20 min, then p-aminobenzenesulfonic acid and α-naphthylamine were added, reacted at 37°C for 20 min, then chloroform was added, mixed well, and after centrifugation, the absorbance value was measured at 530 nm to determine the content of superoxide anion (O2• - ) in different roots. The results are as Figure 4 shown (p<0.05), Figure 4 A-E are the statistical comparisons of the MDA content in the roots under salt, cadmium, antimony, cold, and heat stresses in sequence; Figure 4 F-J are the statistical comparisons of the O2• - content in the roots under salt, cadmium, antimony, cold, and heat stresses in sequence; It can be Figure 4It can be seen that compared with the CK control group, the MDA content in the roots of the stress control groups (NaCl, CdCl2, Sb, Cold, Heat) increased by 10.97%, 22.78%, 11.82%, 24.83% and 63.65%, and the O2• - content increased by 193.61%, 258.93%, 349.18%, 997.73% and 133.27% respectively. For the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) after applying exogenous FtRALF6, the MDA content in the roots decreased by 11.8%, 17.89%, 14.26%, 18.83% and 6.5%, and the O2• - content decreased by 89.26%, 71.35%, 82.42%, 57% and 77.94% respectively. Thus, the application of FtRALF6 alleviated root oxidative stress.

[0025] Example 4: Take the root tip samples of different treatment groups in Example 2, add 2,3,5-triphenyltetrazolium chloride, and culture them in the dark at 37°C for 3 hours. Immediately ice-bath for 5 minutes, and then observe the distribution of plant dehydrogenase (PDHA) in the roots under a microscope. Preheat the microplate reader for more than 30 min, adjust the wavelength to 485 nm, and zero with ethyl acetate. Add reagents in the centrifuge tube in sequence. After adding ethyl acetate, grind thoroughly until homogenized, transfer to the centrifuge tube, and make up the volume to 2 mL with ethyl acetate. Mix well, centrifuge at 10000g at 4°C for 5 min, and take the supernatant. After centrifugation, measure the absorbance of the supernatant at a wavelength of 485 nm to measure the PDHA activity. The results are as Figure 5 shown (p<0.05). Figure 5 A-E are the activity staining diagrams of PDHA under salt, cadmium, antimony, cold and heat stresses in sequence. Figure 5 F-J are the PDHA activity comparisons under salt, cadmium, antimony, cold and heat stresses in sequence.

[0026] From Figure 5As can be seen from F-J, compared with the CK control group, in the stress control groups (NaCl, Sb, CdCl2, Cold, Heat) under different stress conditions, the PDHA activity decreased by 96.69%, 65.67%, 90.89%, 52.81% and 77.79% respectively. However, the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) after applying exogenous FtRALF6 significantly reversed this inhibitory effect. Compared with the stress control groups (NaCl, CdCl2, Sb, Cold, Heat), the PDHA activity of the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) increased by 346.02% (FtRALF6+NaCl), 54.05% (FtRALF6+Cd), 303.75% (FtRALF6+Sb), 90.58% (FtRALF6+Cold) and 181.11% (FtRALF6+Heat) in sequence.

[0027] Example 5: Take 0.5 g of leaves from different treatment groups in Example 2 and extract them with a mixture of ethanol, acetone and distilled water at a ratio of 4.5∶4.5∶1. The extraction process is carried out in the dark. When the leaves turn white, absorb the supernatant and measure the absorption peaks of chlorophyll a, chlorophyll b and carotenoids at wavelengths of 663 nm, 645 nm and 470 nm respectively. The results are as Figure 6 shown (p<0.05), among which, Figure 6 A-E are the statistical comparisons of the total chlorophyll content in the leaves under salt, cadmium, antimony, cold and heat stresses in sequence; Figure 6 F-J are the statistical comparisons of the carotenoid content in the leaves under salt, cadmium, antimony, cold and heat stresses in sequence.

[0028] From Figure 6It can be seen that the contents of total chlorophyll and carotenoids in the stress control groups (NaCl, CdCl2, Sb, Cold, Heat) decreased significantly under abiotic stress. The total chlorophyll levels decreased by 37.84%, 58.63%, 18.00%, 50.27% and 50.19% in sequence, and the carotenoid contents decreased by 49.48%, 72.83%, 11.56%, 59.00% and 58.70% in sequence. The exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) effectively alleviated the stress-induced photosynthetic damage. Compared with the stress control groups (NaCl, CdCl2, Sb, Cold, Heat), the total chlorophyll contents in the exogenous control groups (NaCl+FtRALF6, CdCl2+FtRALF6, Sb+FtRALF6, Cold+FtRALF6, Heat+FtRALF6) increased by 85.45% (FtRALF6+NaCl), 51.46% (FtRALF6+Cd), 33.10% (FtRALF6+Sb), 33.02% (FtRALF6+Cold) and 73.60% (FtRALF6+Heat) in sequence, and the carotenoid contents increased by 81.31%, 62.30%, 23.57%, 59.22% and 99.81% in sequence.

Claims

1. A small peptide for improving the abiotic stress of tartary buckwheat, characterized in that, The small peptide is FtRALF6, and the amino acid sequence of FtRALF6 is shown in SEQ ID No.

1.

2. Use of the small peptide according to claim 1, characterized in that, The small peptide is used to improve the tolerance of tartary buckwheat to abiotic stress.

3. The application according to claim 2, characterized in that, The abiotic stress includes salt stress, heavy metal stress, cold stress and heat stress.

4. The application according to claim 3, wherein The heavy metal stress is cadmium stress or antimony stress; the cold stress is that the temperature is less than or equal to 4°C; the heat stress is that the temperature is greater than or equal to 40°C.

5. The application according to claim 4, wherein The application method of the small peptide is spraying or irrigation. When the small peptide is applied, it is dissolved in water or nutrient solution, and the application concentration of the small peptide is 1 μM.

6. The application according to claim 5, characterized in that The application period of the small peptide is the 3-4 leaf stage of the crop.

7. A preparation for improving abiotic stress of tartary buckwheat, characterized in that, The preparation includes the FtRALF6 small peptide.

Images