Nucleic acid aptamers and enzyme sensors for enrofloxacin and ciprofloxacin and their applications

Abstract

The present invention discloses a nucleic acid aptamer for enrofloxacin and ciprofloxacin, an enzyme sensor, and applications thereof, belonging to the technical field of nucleic acid aptamers. The nucleotide sequence of the nucleic acid aptamer for enrofloxacin and ciprofloxacin is shown in SEQ ID NO. 3, and the nucleic acid aptamer is used for detecting enrofloxacin and ciprofloxacin. The enzyme sensor comprises the following components: nucleic acid aptamers for enrofloxacin and ciprofloxacin, auxiliary chain H1, auxiliary chain H2, auxiliary chain H3, copper sulfate, and TMB colorimetric solution. The enzyme sensor is used for detecting enrofloxacin and ciprofloxacin. The nucleic acid aptamer for enrofloxacin and ciprofloxacin of the present invention is obtained through optimization and modification, and has a higher affinity for the target, with a Kd value of 15 nM for enrofloxacin and a Kd value of 123 nM for CIP. The enzyme sensor of the present invention can achieve specific recognition of ENR and CIP, has high sensitivity, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to a nucleic acid aptamer of enrofloxacin and ciprofloxacin, an enzyme sensor and applications thereof, and belongs to the technical field of nucleic acid aptamers. Background Art

[0002] Enrofloxacin (ENR) is an antibiotic with a broad antimicrobial spectrum and strong antimicrobial activity, widely used in the prevention and treatment of bacterial diseases in aquaculture. Because ENR is partially metabolized to ciprofloxacin (CIP) by P450 in animals, the sum of ENR and CIP is used as the final residue of ENR in food.

[0003] One common method for detecting ENR and CIP residues is the use of nucleic acid aptamers and enzyme sensors. The core of this method is a nucleic acid aptamer with high affinity for both enrofloxacin and ciprofloxacin. However, there are relatively few nucleic acid aptamers for enrofloxacin and ciprofloxacin reported in the prior art, and the development of high-affinity nucleic acid aptamers for these two drugs is a research hotspot. Summary of the Invention

[0004] In view of the above-mentioned prior art, the present invention provides a nucleic acid aptamer for enrofloxacin and ciprofloxacin, an enzyme sensor and applications thereof, belonging to the technical field of nucleic acid aptamers.

[0005] The present invention is achieved through the following technical solutions:

[0006] A nucleic acid aptamer for enrofloxacin and ciprofloxacin, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0007] Application of the nucleic acid aptamers of enrofloxacin and ciprofloxacin in detecting enrofloxacin and ciprofloxacin.

[0008] Application of the nucleic acid aptamers of enrofloxacin and ciprofloxacin in preparing reagents, kits or enzyme sensors for detecting enrofloxacin and ciprofloxacin.

[0009] An enzyme sensor comprises the following components: nucleic acid aptamers for enrofloxacin and ciprofloxacin, an auxiliary chain H1, an auxiliary chain H2, an auxiliary chain H3, copper sulfate, and a TMB colorimetric solution; wherein the nucleotide sequence of the nucleic acid aptamers for enrofloxacin and ciprofloxacin is shown as SEQ ID NO.3, the nucleotide sequence of the auxiliary chain H1 is shown as SEQ ID NO.5, the nucleotide sequence of the auxiliary chain H2 is shown as SEQ ID NO.6, and the nucleotide sequence of the auxiliary chain H3 is shown as SEQ ID NO.7.

[0010] Furthermore, the enzyme sensor is composed of the following components: 10 μL of a 2 μM enrofloxacin and ciprofloxacin nucleic acid aptamer solution; 20 μL of a 1 μM auxiliary chain H1 solution; 20 μL of a 1 μM auxiliary chain H2 solution; 20 μL of a 1 μM auxiliary chain H3 solution; 20 μL of a 1 mM copper sulfate solution; and 80 μL of a TMB colorimetric solution.

[0011] Application of the enzyme sensor in detecting enrofloxacin and ciprofloxacin.

[0012] A method for simultaneously detecting enrofloxacin and ciprofloxacin comprises the following steps:

[0013] (1) Take the standard solution of ENR and the standard solution of CIP respectively, add the nucleic acid aptamers of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary chains H1, H2 and H3, and react at room temperature; then add copper sulfate and shake the reaction; take the reaction mixture, add TMB colorimetric solution, react for 5 minutes, take a picture with a smart phone to record the color of the well plate, identify the RGB value of the corresponding reaction well, calculate the signal change rate, and draw the standard curve of ENR and the standard curve of CIP; wherein the nucleotide sequence of the nucleic acid aptamers of enrofloxacin and ciprofloxacin is shown in SEQ ID NO.3, the nucleotide sequence of the auxiliary chain H1 is shown in SEQ ID NO.5, the nucleotide sequence of the auxiliary chain H2 is shown in SEQ ID NO.6, and the nucleotide sequence of the auxiliary chain H3 is shown in SEQ ID NO.7;

[0014] (2) Take the sample to be tested, add the nucleic acid aptamers of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary chains H1, H2, and H3, and react at room temperature; then add copper sulfate and shake the reaction; take the reaction mixture, add TMB colorimetric solution, react for 5 minutes, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate;

[0015] (3) Substitute the signal change rate of the sample to be tested into the standard curve to calculate the concentration of ENR and CIP in the sample to be tested.

[0016] Furthermore, the specific operations of step (1) are:

[0017] Take 10 μL of ENR standard solution, add 10 μL of nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL of auxiliary chain H1 solution with a concentration of 1 μM, auxiliary chain H2 solution with a concentration of 1 μM, and auxiliary chain H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of copper sulfate solution with a concentration of 1 μM, and shake for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of TMB colorimetric solution, and react for 5 min. Use a smartphone to take a picture to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0-Ai| / A0; ENR standard solution with different concentration gradients was tested, and a standard curve of signal change rate versus ENR concentration was drawn; the concentration gradients of ENR standard solution were: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM;

[0018] Take 10 μL of CIP standard solution, add 10 μL of nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL of auxiliary chain H1 solution with a concentration of 1 μM, auxiliary chain H2 solution with a concentration of 1 μM, and auxiliary chain H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of copper sulfate solution with a concentration of 1 μM, and shake for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of TMB colorimetric solution, and react for 5 min. Use a smartphone to take a picture to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0-Ai| / A0; ENR standard solution with different concentration gradients was tested, and a standard curve of signal change rate versus ENR concentration was drawn; the concentration gradient of ENR standard solution was: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM.

[0019] Furthermore, the specific operation of step (2) is as follows: take 10 μL of the sample to be tested, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL each of the auxiliary chain H1 solution with a concentration of 1 μM, the auxiliary chain H2 solution with a concentration of 1 μM, and the auxiliary chain H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and shake for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of TMB colorimetric solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0-Ai| / A0.

[0020] The enrofloxacin and ciprofloxacin nucleic acid aptamer of the present invention is a split, integrated aptamer. It uses aptamer D1, which has a certain affinity for ENR and CIP, as the initial chain. This aptamer was optimized and modified through a novel modification method (analyzing the binding between the aptamer and the target, identifying the core binding domain, cleaving the aptamer near the key base, and connecting the 5' and 3' ends of the original aptamer to expose the binding sites at both ends of the new chain). The modified aptamer D1-2 has a higher affinity for the target, with a Kd value of 15 nM for enrofloxacin and 123 nM for CIP. Compared with aptamer D1, the affinity for enrofloxacin is increased by 133.3 times and the affinity for ciprofloxacin is increased by 5.8 times, a significant effect.

[0021] The enzyme sensor of the present invention is constructed based on the principle that the aptamer D1-2, the auxiliary chain H1, the auxiliary chain H2 and the auxiliary chain H3 form a DNA nanosphere. 2+ High capacity (DNA nanospheres can give Cu 2+ The enzyme sensor provides more binding sites, thereby further enhancing the peroxidase activity of the Cu-based nanozyme, enabling specific recognition of ENR and CIP with high sensitivity. The enzyme sensor of the present invention has broad application prospects in practical food safety monitoring and opens up a new approach for the detection of enrofloxacin and ciprofloxacin.

[0022] Various terms and phrases used herein have the general meanings that are well understood by those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 : Schematic diagram of the secondary structure of aptamer D1, where a, b, and c represent the three cleavage positions, respectively.

[0024] Figure 2: Schematic diagram of the molecular docking simulation results of aptamer D1 with ENR and CIP.

[0025] Figure 3 : Schematic diagram of the affinity test results between aptamer D1 and ENR, wherein the upper part represents the heat change when aptamer D1 binds to ENR, and the lower part represents the enthalpy change when aptamer D1 binds to ENR.

[0026] Figure 4 : Schematic diagram of the affinity test results between aptamer D1 and CIP, wherein the upper part represents the heat change when aptamer D1 binds to CIP, and the lower part represents the enthalpy change when aptamer D1 binds to CIP.

[0027] Figure 5 : Schematic diagram of the secondary structure of aptamer D1-1.

[0028] Figure 6 : Schematic diagram of the affinity test results between aptamer D1-1 and ENR, wherein the upper part represents the heat change when aptamer D1-1 binds to ENR, and the lower part represents the enthalpy change when aptamer D1-1 binds to ENR.

[0029] Figure 7 : Schematic diagram of the affinity test results between aptamer D1-1 and CIP, wherein the upper part represents the heat change when aptamer D1-1 binds to CIP, and the lower part represents the enthalpy change when aptamer D1-1 binds to CIP.

[0030] Figure 8 : Schematic diagram of the secondary structure of aptamer D1-2.

[0031] Figure 9 : Schematic diagram of the affinity test results between aptamer D1-2 and ENR, wherein the upper part represents the heat change when aptamer D1-2 binds to ENR, and the lower part represents the enthalpy change when aptamer D1-2 binds to ENR.

[0032] Figure 10 : Schematic diagram of the affinity test results between aptamer D1-2 and CIP, wherein the upper part represents the heat change when aptamer D1-2 binds to CIP, and the lower part represents the enthalpy change when aptamer D1-2 binds to CIP.

[0033] Figure 11 : Schematic diagram of the secondary structure of aptamer D1-3.

[0034] Figure 12: Schematic diagram of the affinity test results between aptamer D1-3 and ENR, wherein the upper part represents the heat change when aptamer D1-3 binds to ENR, and the lower part represents the enthalpy change when aptamer D1-3 binds to ENR.

[0035] Figure 13 : Schematic diagram of the affinity test results between aptamer D1-3 and CIP, wherein the upper part represents the heat change when aptamer D1-3 binds to CIP, and the lower part represents the enthalpy change when aptamer D1-3 binds to CIP.

[0036] Figure 14 : Signal response curve of ENR.

[0037] Figure 15 : Signal response curve of CIP.

[0038] Figure 16 : Standard curve of ENR.

[0039] Figure 17 : Standard curve of CIP.

[0040] Figure 18 : Schematic diagram of the signal change rate of 6 antimicrobial drugs, where MIX represents a mixture of 6 antimicrobial drugs. DETAILED DESCRIPTION

[0041] The present invention will be further described below in conjunction with the embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will appreciate that various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention.

[0042] Unless otherwise specified, the instruments, reagents, and materials used in the following examples are all conventional instruments, reagents, and materials available in the prior art and can be obtained through regular commercial channels. The experimental methods and detection methods used in the following examples are all conventional experimental methods and detection methods available in the prior art, unless otherwise specified.

[0043] The present invention uses isothermal titration microcalorimetry to determine the affinity of nucleic acid aptamers for their targets. Isothermal titration microcalorimetry is the only technology capable of simultaneously determining all binding parameters in a single experiment. It can measure the affinity of binding partners in their native state, without the need for modification through fluorescent labeling or immobilization. By measuring heat transfer during the binding process, the binding constant can be accurately determined. The specific determination method is as follows: the nucleic acid aptamer is dissolved and diluted to a clear solution of a certain concentration. This solution is placed in a temperature-controlled sample cell, which is coupled to a reference cell via a thermocouple circuit. Enrofloxacin and ciprofloxacin sample solutions are placed in a syringe as ligands. The instrument is programmed to dispense 25 drops of sample solution, 2 μl per drop, with a titration interval of 120 seconds, a temperature of 25°C, and a stirring speed of 350 rpm. The resulting curve is fitted to obtain the affinity constant, or Kd value.

[0044] Example 1 Optimization of original aptamers for enrofloxacin and ciprofloxacin

[0045] The nucleotide sequence of the original aptamer for enrofloxacin and ciprofloxacin, aptamer D1, is shown in SEQ ID NO. 1 and is as follows (direction 5'-3'): ACTCGATTTGACAATGAAGATGGATGCTGTAGTTGATTG.

[0046] The secondary structure of aptamer D1 was predicted using the online tool "the mfold web server". The secondary structure diagram of aptamer D1 is shown in Figure 1 shown.

[0047] The molecular docking simulation software Autodock was used to simulate the binding of the aptamer to the target (ENR, CIP). The schematic diagram of the molecular docking simulation results of aptamer D1 with ENR and CIP is shown in the figure below. Figure 2 As shown in the figure, based on the clustering results and the minimum energy principle, the key sites predicted for the interaction between aptamer D1 and the two targets are G22, G23, G29, T30, A31, G32, and T33.

[0048] The affinity of aptamer D1 to ENR and CIP was tested using isothermal titration microcalorimetry. The affinity test results of aptamer D1 to ENR are shown in the figure below. Figure 3 The affinity test results of aptamer D1 and CIP are shown in the figure. Figure 4 As shown, the results showed that the Kd value of aptamer D1 for ENR was 2000 nM, and the Kd value of aptamer D1 for CIP was 716 nM.

[0049] In order to obtain a more optimized aptamer, the aptamer D1 was split and then integrated. According to the key base information obtained by molecular docking, three sites a, b, and c were selected for splitting (e.g. Figure 1 After splitting, aptamer D1-1, aptamer D1-2, and aptamer D1-3 were obtained. The secondary structure diagram of aptamer D1-1 is shown in FIG. Figure 5 As shown, the secondary structure diagram of aptamer D1-2 is shown in Figure 8 As shown, the secondary structure diagram of aptamer D1-3 is shown in Figure 11 shown.

[0050] The nucleotide sequence of aptamer D1-1 is shown in SEQ ID NO. 2, as follows (direction 5'-3'): ATGCTGTAGTTGATTGACTCGATTTGACAATGAAGATGG.

[0051] The nucleotide sequence of aptamer D1-2 is shown in SEQ ID NO. 3, as follows (direction 5'-3'): CTGTAGTTGATTGACTCGATTTGACAATGAAGATGGATG.

[0052] The nucleotide sequence of aptamer D1-3 is shown in SEQ ID NO. 4, as shown below (direction 5'-3'): GTAGTTGATTGACTCGATTTGACAATGAAGATGGATGCT.

[0053] The affinity of aptamers D1-1, D1-2, and D1-3 to ENR and CIP was tested using an isothermal titration microcalorimeter. The affinity test results of aptamer D1-1 to ENR are shown in the figure below. Figure 6 As shown, the affinity test results of aptamer D1-1 and CIP are shown in the figure. Figure 7 The affinity test results of aptamer D1-2 and ENR are shown in the figure. Figure 9 As shown, the affinity test results of aptamer D1-2 and CIP are shown in the figure. Figure 10 As shown, the affinity test results of aptamer D1-3 and ENR are shown in the figure. Figure 12 As shown, the affinity test results of aptamer D1-3 and CIP are shown in the figure. Figure 13The results showed that the Kd values of aptamers D1-1, D1-2, and D1-3 for ENR were 428 nM, 15 nM, and 526 nM, respectively, which were 4.7-fold, 133.3-fold, and 3.8-fold higher than those of aptamer D1. The Kd values of aptamers D1-1, D1-2, and D1-3 for CIP were 259 nM, 123 nM, and 202 nM, respectively, which were 2.8-fold, 5.8-fold, and 3.5-fold higher than those of aptamer D1. The modified aptamers significantly improved their affinity for enrofloxacin and ciprofloxacin, with aptamer D1-2 showing the most significant improvement.

[0054] Example 2 Construction of enzyme sensor

[0055] Through the optimization of Example 1, an aptamer D1-2 with high affinity for enrofloxacin and ciprofloxacin was obtained. An enzyme sensor was constructed based on the aptamer D1-2, including the following components: aptamer D1-2, auxiliary chain H1, auxiliary chain H2, auxiliary chain H3, copper sulfate, and TMB colorimetric solution; wherein, the auxiliary chain H1 was designed with a sequence complementary to the aptamer D1-2, and in addition, the auxiliary chains H2 and H3 were complementary to the auxiliary chain H1.

[0056] The nucleotide sequence of auxiliary chain H1 is shown in SEQ ID NO. 5 and is as follows (direction 5'-3'): AGTACGCGTACTCATCCATCTTCATTGTCAAATCGAGTCAATCAACTACAG.

[0057] The nucleotide sequence of auxiliary chain H2 is shown in SEQ ID NO. 6 and is as follows (direction 5'-3'): AGCTCGAGCTACACTCGCTCGCACGAGCTAAAGACAATGAAGATGGATG.

[0058] The nucleotide sequence of auxiliary chain H3 is shown in SEQ ID NO. 7 and is as follows (direction 5'-3'): AGCTCGAGCTCTGTAGTTGATTGACTTCGTGCGAGCGAGTGT.

[0059] Specifically, the enzyme sensor consists of the following components (the amounts of each component are the minimum required for a single sample detection): 10 μL of a 2 μM aptamer D1-2 solution; 20 μL of a 1 μM auxiliary chain H1 solution; 20 μL of a 1 μM auxiliary chain H2 solution; 20 μL of a 1 μM auxiliary chain H3 solution; 20 μL of a 1 mM copper sulfate solution; and 80 μL of a TMB colorimetric solution (consisting of 5 μL of TMB solution, 5 μL of H₂O₂ solution, and the remainder of acetate buffer). All solutions were prepared using ultrapure water.

[0060] The copper sulfate solution was prepared using anhydrous copper sulfate, which was purchased from Shanghai Hushi Analytical Instrument Co., Ltd.

[0061] The TMB solution was a 1% TMB solution purchased from Beijing Solebow Technology Co., Ltd., product number: T8120.

[0062] The H2O2 solution was 30% H2O2 purchased from Sinopharm Chemical Reagent Co., Ltd., item number: 10011208.

[0063] The acetate buffer has a concentration of 1 M and a pH of 5.0.

[0064] Example 3 Detection of ENR and CIP using enzyme sensors

[0065] The enzyme sensor constructed in Example 2 was used to detect ENR and CIP in the following steps:

[0066] (1) Detection of standard solution

[0067] To 10 μL of the ENR standard solution, 10 μL of the aptamer D1-2 solution was added, and the reaction was allowed to proceed at room temperature for 10 minutes. Then, 20 μL each of the auxiliary chain H1 solution, auxiliary chain H2 solution, and auxiliary chain H3 solution were added, and the reaction was allowed to proceed at room temperature for 30 minutes. Then, 20 μL of the copper sulfate solution was added, and the reaction was shaken for 20 minutes. Finally, 20 μL of the reaction mixture was added to 80 μL of the TMB colorimetric solution, and the reaction was allowed to proceed for 5 minutes. The plate color was recorded using a smartphone, and the RGB values of the corresponding reaction wells were identified. The signal change rate |A0 - Ai| / A0 was calculated. Different concentration gradients of the ENR standard solution were tested, and a standard curve of the signal change rate versus ENR concentration was plotted. The concentration gradient of the ENR standard solution was 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, and 1000 nM.

[0068] According to the same method, the CIP standard solution with different concentration gradients was tested to obtain the spectrum of the CIP standard, as shown in the following figure: Figure 12 The concentration gradient of CIP standard solution is as follows: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, and 1000 nM.

[0069] The ENR standard solution is prepared by the following method: taking an ENR standard, dissolving it with an appropriate amount of 1M NaOH solution, and adding a buffer solution to prepare it to the required concentration.

[0070] The CIP standard solution is prepared by the following method: taking a CIP standard, dissolving it with an appropriate amount of 1M NaOH solution, and adding a buffer solution to prepare it to the required concentration.

[0071] The buffer consists of the following components: 8 mM disodium hydrogen phosphate (Na2HPO4), 1360 mM sodium chloride (NaCl), 2 mM potassium dihydrogen phosphate (KH2PO4), and the balance is water, with a pH of 7.2.

[0072] (2) Establishment of standard curve

[0073] The smartphone extracts the color intensity (RGB) of ENR standard solutions with different concentration gradients after 5 minutes of reaction and obtains the ENR signal response curve, as shown in Figure 2. Figure 14 shown.

[0074] The smartphone extracts the color intensity of CIP standard solutions with different concentration gradients after 5 minutes of reaction and obtains the CIP signal response curve, as shown in Figure 2. Figure 15 shown.

[0075] Depend on Figure 14 、 Figure 15 It can be seen that when the target concentration is 0, the aptamer D1-2 binds to the auxiliary chain H1, and DNA nanospheres cannot be formed, resulting in a smaller peroxidase-like signal amplification ability for Cu and a weaker color intensity; with the increase of target concentration, after the aptamer binds to the target, the auxiliary chains H1, H2, and H3 are pulled closer to self-assemble to generate more DNA nanospheres, and the peroxidase-like signal amplification ability for Cu is significantly enhanced. The extracted RGB value increases with the increase of target concentration.

[0076] The standard curves of ENR and CIP were drawn with the concentration of ENR and CIP as the horizontal axis and the color intensity of the extraction as the vertical axis. The standard curve of ENR is as follows: Figure 16 The standard curve of CIP is shown in Figure 17As shown in the figure, the linear range of the enzyme sensor was calculated to be 1.4-1000 nM, and the detection limits were 342.1 pM (ENR) and 330.8 pM (CIP), respectively.

[0077] (3) Specificity evaluation of enzyme sensors

[0078] Norfloxacin (NOR), tetracycline (TC), oxytetracycline (OTC), chloramphenicol (CAP), enrofloxacin (ENR) and ciprofloxacin (CIP), which have high detection rates in aquatic products, were selected for specificity experiments.

[0079] Norfloxacin, tetracycline, oxytetracycline, chloramphenicol, enrofloxacin, and ciprofloxacin were prepared into solutions with a concentration of 111.1 nM.

[0080] A mixture solution containing the above six antimicrobial drugs was prepared, wherein the concentrations of norfloxacin, tetracycline, oxytetracycline, chloramphenicol, enrofloxacin and ciprofloxacin were all 111.1 nM.

[0081] During preparation, first prepare a 10 mM stock solution using a 1 M NaOH solution as the solvent; then dilute to 111.1 nM using the buffer solution from step (1) above.

[0082] The detection method of step (1) was used for detection: 10 μL of the test solution was added to 10 μL of the aptamer D1-2 solution, and the reaction was carried out at room temperature for 10 min; then 20 μL of the auxiliary chain H1 solution, auxiliary chain H2 solution, and auxiliary chain H3 solution were added, and the reaction was carried out at room temperature for 30 min; then 20 μL of the copper sulfate solution was added, and the reaction was shaken for 20 min; finally, 20 μL of the reaction mixture was taken, 80 μL of the TMB colorimetric solution was added, and the reaction was carried out for 5 min. The color of the well plate was recorded by taking a photo with a smartphone, the RGB value of the corresponding reaction well was identified, and the signal change rate |A0-Ai| / A0 was calculated. The signal change rate diagram of the six antibacterial drugs is shown in the figure below. Figure 18 As shown in the figure, it can be seen that there is an obvious signal only when ENR or CIP exists, which shows that the enzyme sensor of the present invention has good specificity.

[0083] Example 4 Recovery Evaluation of Enzyme Sensor and Simultaneous Detection of ENR and CIP in Aquatic Products

[0084] (1) The ENR standard solution and the CIP standard solution were mixed at different concentration ratios (respectively: 0:1000 nM, 200 nM:800 nM, 500 nM:500 nM, 800 nM:200 nM, and 1000 nM:0) to obtain five mixed solutions. The enzyme sensor constructed in Example 2 was used for analysis (the method was the same as that in Example 3). The recovery rate and relative standard deviation (RSD) were calculated. The recovery rate evaluation information is shown in Table 1. As can be seen from Table 1, the enzyme sensor has a good recovery rate between [83.46%, 105.91%], and the RSD is less than 5%, indicating that the enzyme sensor of the present invention has high accuracy and repeatability.

[0085]

[0086] (2) Inspection of Chinese mitten crabs and whiteleg shrimp purchased from the market

[0087] Sample preparation: 4 g of muscle tissue from each sample (Chinese mitten crab and whiteleg shrimp) was mixed with 20 mL of acetonitrile containing 25 mM phosphoric acid, homogenized for 5 minutes, and centrifuged at 4500 rpm for 20 minutes. The supernatant was collected and centrifuged again at 4500 rpm for 20 minutes. The supernatant was filtered through a 0.22 μm filter to obtain Samples 1 and 3.

[0088] To sample 1, ENR stock solution and CIP stock solution were added to make the final concentration of ENR 200 nM and the final concentration of CIP 800 nM, thereby obtaining sample 2.

[0089] To sample 3, ENR stock solution and CIP stock solution were added to make the final concentration of ENR 500 nM and the final concentration of CIP 500 nM, to obtain sample 4.

[0090] To sample 3, ENR stock solution and CIP stock solution were added to make the final concentration of ENR 800 nM and the final concentration of CIP 200 nM, to obtain sample 5.

[0091] The solvents of the ENR mother liquor and the CIP mother liquor are both 1 M NaOH solution.

[0092] Samples 1-5 were analyzed using the enzyme sensor constructed in Example 2 (using the same method as in Example 3), and the sum of ENR and CIP concentrations was calculated. Samples 1-5 were also tested using HPLC. The results of the enzyme sensor and HPLC tests are shown in Table 2. As can be seen from Table 2, samples 1 and 3 were negative, while the spiked samples 2, 4, and 5 were all positive. The quantitative analysis results were highly accurate, with minimal deviation, and were consistent with the HPLC test results.

[0093]

[0094] The above examples are provided to those skilled in the art to fully disclose and describe how to implement and use the claimed embodiments, rather than to limit the scope of the disclosure herein. Modifications that are obvious to those skilled in the art will fall within the scope of the appended claims.

Claims

1. A nucleic acid aptamer for enrofloxacin and ciprofloxacin, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

3.

2. Use of the nucleic acid aptamers for enrofloxacin and ciprofloxacin according to claim 1 in detecting enrofloxacin and ciprofloxacin.

3. Use of the nucleic acid aptamers for enrofloxacin and ciprofloxacin according to claim 1 in the preparation of reagents, kits or enzyme sensors for detecting enrofloxacin and ciprofloxacin.

4. An enzyme sensor, characterized in that The invention comprises the following components: nucleic acid aptamers for enrofloxacin and ciprofloxacin, an auxiliary chain H1, an auxiliary chain H2, an auxiliary chain H3, copper sulfate and a TMB color developing solution; wherein the nucleotide sequence of the nucleic acid aptamers for enrofloxacin and ciprofloxacin is shown as SEQ ID NO.3, the nucleotide sequence of the auxiliary chain H1 is shown as SEQ ID NO.5, the nucleotide sequence of the auxiliary chain H2 is shown as SEQ ID NO.6, and the nucleotide sequence of the auxiliary chain H3 is shown as SEQ ID NO.

7.

5. The enzyme sensor according to claim 4, characterized in that It consists of the following components: 10 μL of 2 μM enrofloxacin and ciprofloxacin nucleic acid aptamer solution; 20 μL of 1 μM auxiliary chain H1 solution; 20 μL of 1 μM auxiliary chain H2 solution; 20 μL of 1 μM auxiliary chain H3 solution; 20 μL of 1 mM copper sulfate solution; and 80 μL of TMB color development solution.

6. Use of the enzyme sensor according to claim 4 or 5 in detecting enrofloxacin and ciprofloxacin.

7. A method for simultaneously detecting enrofloxacin and ciprofloxacin, characterized in that: The following steps are involved: (1) Take the standard solution of ENR and the standard solution of CIP respectively, add the nucleic acid aptamers of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary chains H1, H2 and H3, and react at room temperature; then add copper sulfate and shake the reaction; take the reaction mixture, add TMB colorimetric solution, react for 5 minutes, take a picture with a smart phone to record the color of the well plate, identify the RGB value of the corresponding reaction well, calculate the signal change rate, and draw the standard curve of ENR and the standard curve of CIP; wherein the nucleotide sequence of the nucleic acid aptamers of enrofloxacin and ciprofloxacin is shown in SEQ ID NO.3, the nucleotide sequence of the auxiliary chain H1 is shown in SEQ ID NO.5, the nucleotide sequence of the auxiliary chain H2 is shown in SEQ ID NO.6, and the nucleotide sequence of the auxiliary chain H3 is shown in SEQ ID NO.7; (2) Take the sample to be tested, add the nucleic acid aptamers of enrofloxacin and ciprofloxacin, and incubate at room temperature; then add auxiliary chains H1, H2, and H3, and react at room temperature; then add copper sulfate and shake the reaction; take the reaction mixture, add TMB colorimetric solution, react for 5 minutes, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate; (3) Substitute the signal change rate of the sample to be tested into the standard curve to calculate the concentration of ENR and CIP in the sample to be tested.

8. The method for simultaneous detection of enrofloxacin and ciprofloxacin according to claim 7, wherein The specific operations of step (1) are: Take 10 μL of ENR standard solution, add 10 μL of nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL of auxiliary chain H1 solution with a concentration of 1 μM, auxiliary chain H2 solution with a concentration of 1 μM, and auxiliary chain H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of copper sulfate solution with a concentration of 1 μM, and shake for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of TMB colorimetric solution, and react for 5 min. Use a smartphone to take a picture to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0-Ai| / A0; ENR standard solution with different concentration gradients was tested, and a standard curve of signal change rate versus ENR concentration was drawn; the concentration gradient of ENR standard solution was: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM; Take 10 μL of CIP standard solution, add 10 μL of nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL of auxiliary chain H1 solution with a concentration of 1 μM, auxiliary chain H2 solution with a concentration of 1 μM, and auxiliary chain H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of copper sulfate solution with a concentration of 1 μM, and react with shaking for 20 min; finally, take 20 μL of reaction mixture, add 80 μL of TMB colorimetric solution, and react for 5 min. Use a smartphone to take a picture to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0-Ai| / A0; ENR standard solution with different concentration gradients was tested, and a standard curve of signal change rate versus ENR concentration was drawn; the concentration gradient of ENR standard solution was: 0, 1.4 nM, 4.1 nM, 12.3 nM, 37.1 nM, 111.1 nM, 333.3 nM, 1000 nM.

9. The method for simultaneous detection of enrofloxacin and ciprofloxacin according to claim 7, wherein: The specific operation of step (2) is as follows: take 10 μL of the sample to be tested, add 10 μL of the nucleic acid aptamer solution of enrofloxacin and ciprofloxacin with a concentration of 2 μM, and react at room temperature for 10 min; then add 20 μL each of the auxiliary chain H1 solution with a concentration of 1 μM, the auxiliary chain H2 solution with a concentration of 1 μM, and the auxiliary chain H3 solution with a concentration of 1 μM, and react at room temperature for 30 min; then add 20 μL of the copper sulfate solution with a concentration of 1 μM, and shake for 20 min; finally, take 20 μL of the reaction mixture, add 80 μL of TMB colorimetric solution, react for 5 min, take a photo with a smartphone to record the color of the well plate, identify the RGB value of the corresponding reaction well, and calculate the signal change rate |A0-Ai| / A0.

Images