Application of USP1 inhibitor in preparation of medicine for preventing and / or treating non-alcoholic fatty liver disease

By using USP1 inhibitors such as prasugrel and ML323, the key factor SREBP-1C and the enzyme SCD1, inhibiting the de novo synthesis of fatty acids in hepatocytes, solve the problem of treatment of non-alcoholic fatty liver disease and achieve effective prevention and treatment effects.

CN120346328APending Publication Date: 2025-07-22AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510364836.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

Currently, there is a lack of effective drugs for the treatment of non-alcoholic fatty liver disease. The relationship between USP1 and NAFLD has not been reported. The prior art is difficult to block the progress of NAFLD by inhibiting the de novo synthesis of fatty acids in hepatocytes.

Method used

The pathological progress of NAFLD was blocked by reducing USP1 expression or degrading its products by inhibiting the de novo synthesis of key transcription factors SREBP-1C and the enzyme SCD1 by hepatocyte fatty acids.

Benefits of technology

It significantly inhibits the de novo synthesis of fatty acids in hepatocytes, reduces liver lipid deposition, and effectively prevents and treats non-alcoholic lipohepatitis, providing a new therapeutic option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120346328A_ABST
    Figure CN120346328A_ABST
Patent Text Reader

Abstract

The invention provides application of a USP1 inhibitor in preparation of a medicine for preventing and / or treating non-alcoholic fatty liver disease, and belongs to the technical field of biological medicine. Research finds that USP1 is an important functional factor for NAFLD attack, and the progress of NAFLD can be remarkably accelerated by promoting the de novo synthesis route of fatty acid. According to the invention, the USP1 is inhibited to significantly inhibit the synthesis of fatty acid in liver cells from the beginning, so that the disease progress of NAFLD is significantly inhibited, and therefore, more choices are provided for clinical prevention and / or treatment of the NAFLD.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the use of a USP1 inhibitor in the preparation of a drug for preventing and / or treating non-alcoholic fatty liver disease. Background Art

[0002] Ubiquitin specific protease 1 (USP1) is a member of the USP family and is a cysteine isopeptidase containing a Cys90, His593, and Asp751 triad structure. The USP1 gene encodes a 785-amino acid protein. USP1 itself has no obvious deubiquitination activity, but when it binds to USP1-associated factor 1 (UAF1) to form a binary heterocomplex, it can exhibit obvious deubiquitination activity. Research has shown that USP1 is related to a variety of biological functions, especially the occurrence, growth, and differentiation of tumors, and is involved in the DNA-damage response (DDR) process.

[0003] Non-alcoholic fatty liver disease (NAFLD) refers to a pathological syndrome characterized by excessive lipid deposition in liver cells caused by factors other than alcohol and other clear liver-damaging factors (such as drugs, viral infections, or autoimmunity). According to the development process, non-alcoholic fatty liver disease can be divided into simple fatty liver, non-alcoholic steatohepatitis, and liver cirrhosis. Currently, the prevalence of non-alcoholic fatty liver disease worldwide is showing a rapid increase. Moreover, due to the complex and diverse pathogenesis of non-alcoholic fatty liver disease, there is currently no specific drug for the treatment of non-alcoholic fatty liver. Therefore, strengthening the research on NAFLD, especially the research on the pathogenesis of NAFLD, is of great significance for promoting the prevention and treatment of NAFLD. So far, there have been no reports on the relationship between USP1 and NAFLD.

[0004] Prasugrel is an antiplatelet drug belonging to the thienopyridine class. It prevents thrombosis by inhibiting platelet aggregation, generates active metabolites after metabolism in the liver, irreversibly binds to the P2Y12 receptor on the platelet surface, inhibits adenosine diphosphate (ADP)-induced platelet aggregation, and reduces the risk of thrombosis. It is mainly used for the treatment of acute coronary syndrome. Currently, there have been no reports on the use of prasugrel for the prevention and / or treatment of NAFLD. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide an application of a USP1 inhibitor in the preparation of a drug for preventing and / or treating non-alcoholic fatty liver disease. The USP1 inhibitor can significantly inhibit de novo synthesis of fatty acids in hepatocytes, especially inhibit the key transcription factor SREBP-1C of de novo synthesis of fatty acids in hepatocytes, and prevent and / or treat non-alcoholic fatty liver disease.

[0006] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an application of a USP1 inhibitor in the preparation of a drug for preventing and / or treating non-alcoholic fatty liver disease.

[0008] Preferably, the USP1 inhibitor includes one or both of a reagent for reducing the expression of USP1 and a reagent for reducing the product of USP1.

[0009] Preferably, the reagent for reducing the product of USP1 includes a protease or nuclease for degrading the product of USP1; the reagent for reducing the expression of USP1 includes a reagent for knocking down USP1.

[0010] Preferably, the reagent for knocking down USP1 includes RNAi.

[0011] Preferably, the USP1 inhibitor includes one or more of prasugrel, ML323, and RNAi with the sequence shown in SEQ ID NO.2.

[0012] Preferably, the USP1 inhibitor is prasugrel.

[0013] Preferably, the USP1 inhibitor significantly inhibits the hindrance of de novo synthesis of fatty acids in hepatocytes.

[0014] The present invention provides a drug for preventing and / or treating non-alcoholic fatty liver disease, which includes the above-mentioned USP1 inhibitor and its pharmaceutically acceptable excipients.

[0015] The present invention provides a method for screening a drug for preventing and / or treating non-alcoholic fatty liver disease, which includes the following steps: treating a non-alcoholic fatty liver receptor animal with a test drug, and detecting the expression level of USP1 in the receptor animal.

[0016] Preferably, the method further sets a negative control group, and the negative control is a non-alcoholic fatty liver receptor animal not treated with any drug;

[0017] Compared with the negative control group, when the expression level of USP1 in the receptor animal is significantly reduced after treating the receptor with the test drug, it can be determined that the test drug is a drug for preventing and / or treating non-alcoholic fatty liver disease.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention provides an application of a USP1 inhibitor in the preparation of a drug for preventing and / or treating non-alcoholic fatty liver disease. The present invention has found through research that USP1 is an important functional factor in the pathogenesis of NAFLD and can significantly accelerate the progression of NAFLD by promoting de novo fatty acid synthesis. By inhibiting USP1, the present invention significantly inhibits de novo fatty acid synthesis in hepatocytes, thereby significantly inhibiting the progression of NAFLD. Therefore, the present invention provides a new option for clinically preventing and / or treating non-alcoholic fatty liver disease. Brief Description of the Drawings

[0020] Figure 1 To show that USP1 deubiquitinates and stabilizes SREBP-1C, a key transcription factor for de novo fatty acid synthesis, in hepatocytes. A shows the results of fluorescence co-localization of USP1 and SREBP-1C in the hepatocyte cell line SK-Hep1 induced by palmitic acid or fructose for de novo fatty acid synthesis in hepatocytes; B shows the results of detecting the endogenous interaction of USP1 and SREBP-1C in SK-Hep1 cells by reciprocal immunoprecipitation; C shows the experimental results that the protein expression of SREBP-1C decreased significantly after USP1 knockdown and was then reversed by the proteasome inhibitor MG132; D shows the results of detecting the ubiquitination level of SREBP-1C after USP1 knockdown;

[0021] Figure 2 To show that USP1 deubiquitinates and stabilizes SCD1, a key enzyme for de novo fatty acid synthesis, in hepatocytes. A shows the enrichment of SCD1 protein detected by silver staining after immunoprecipitation of USP1 in the hepatocyte cell line SK-Hep1; B shows the results of detecting the endogenous and exogenous interactions of USP1 and SCD1 in SK-Hep1 by immunoprecipitation; C shows the results that the protein expression of SCD1 decreased significantly after USP1 knockdown and was then reversed by the proteasome inhibitor MG132; D shows the results of detecting the ubiquitination level of SCD1 after USP1 knockdown;

[0022] Figure 3In the mouse NAFLD model, the use of USP1 inhibitors and liver USP1 silencing significantly inhibited the progression of NAFLD. A shows the results of detecting liver lipid deposition after intraperitoneal injection of the USP1 inhibitor ML323 and tail vein injection of AAV-USP1 RNAi in the mouse NAFLD model; B shows the results of HE staining, Oil Red staining, and immunohistochemistry detecting that USP1 inhibition can significantly improve the pathological progression of NAFLD, lipid deposition, and reduce the expression of the de novo fatty acid synthesis transcription factor SREBP-1C and the key enzymes ACACA, FASN, and SCD1; C shows the results of WB experiments detecting that USP1 inhibition can significantly improve the pathological progression of NAFLD, lipid deposition, and reduce the expression of the de novo fatty acid synthesis transcription factor SREBP-1C and the key enzymes ACACA, FASN, and SCD1.

[0023] Figure 4 Prasugrel, as a USP1 inhibitor, can significantly hinder hepatic de novo fatty acid synthesis and treat NAFLD. A shows the results of the effects of prasugrel, aspirin, or clopidogrel on the expression of the key transcription factor SREBP-1C and key enzymes in SK-Hep1 fatty acid de novo synthesis; B shows the results that prasugrel can inhibit the USP1-regulated fatty acid de novo synthesis substrate proteins SREBP-1C and SCD1, and this inhibitory effect can be reversed by the proteasome inhibitor MG132; C shows the results of detecting the ubiquitination level of SREBP-1C by prasugrel, prasugrel + transfection of wild-type USP1 overexpression plasmid, or prasugrel + transfection of USP1 overexpression plasmid with mutated enzyme active site; D shows the results of detecting the ubiquitination level of SCD1 by prasugrel, prasugrel + transfection of wild-type USP1 overexpression plasmid, or prasugrel + transfection of USP1 overexpression plasmid with mutated enzyme active site; E shows the results of detecting the effects of prasugrel, aspirin, or clopidogrel on palmitic acid (PA)- and fructose (Fru)-induced lipid formation by Nile Red staining in SK-Hep1 cells; F shows the results of the effects of oral administration of prasugrel on the expression of SREBP-1C and SCD1 in the mouse NAFLD model; G shows the results of oral administration of prasugrel on the treatment of NAFLD in the mouse NAFLD model; H shows the results of detecting the treatment of NAFLD by HE staining, Oil Red staining, and immunohistochemistry in the mouse NAFLD model. Detailed implementation manners

[0024] The present invention provides an application of a USP1 inhibitor in the preparation of a drug for preventing and / or treating non-alcoholic fatty liver.

[0025] The present invention has found through research that USP1 is an important functional factor in the pathogenesis of NAFLD, and can significantly accelerate the progression of NAFLD by promoting de novo fatty acid synthesis. USP1 transcriptionally regulates the transcription levels of a series of key enzymes in de novo fatty acid synthesis through SREBP-1C, and at the same time individually regulates the expression of SCD1 through deubiquitination, thus USP1 significantly affects the de novo fatty acid synthesis pathway in hepatocytes.

[0026] In the present invention, the USP1 inhibitor includes one or both of a reagent that reduces the expression of USP1 and a reagent that reduces the product of USP1. The reagent that reduces the product of USP1 includes a protease or nuclease that degrades the product of USP1; the reagent that reduces the expression of USP1 includes a reagent that knocks down USP1. The reagent that knocks down USP1 preferably includes RNAi. The USP1 inhibitor preferably includes one or more of prasugrel, ML323, and the RNAi shown in SEQ ID NO.2. As a preferred embodiment, the USP1 inhibitor is preferably prasugrel. The present invention uses the antiplatelet drug prasugrel to significantly inhibit de novo fatty acid synthesis in hepatocytes, thereby achieving the effect of preventing and / or treating non-alcoholic fatty liver disease, while other common antiplatelet drugs such as aspirin and clopidogrel do not have this effect.

[0027] The present invention provides a drug for preventing and / or treating non-alcoholic fatty liver, and the drug includes the above-mentioned USP1 inhibitor and its pharmaceutically acceptable excipients.

[0028] In the present invention, the drug can use the USP1 inhibitor as the active ingredient and combine with other drugs for preventing and / or treating non-alcoholic fatty liver to jointly achieve the purpose of preventing and / or treating non-alcoholic fatty liver disease, or can use the USP1 inhibitor as the sole active ingredient for preventing and / or treating non-alcoholic fatty liver. The excipients include one or more of lentivirus, adenovirus, adeno-associated virus, or excipients such as solvents. The drug is administered orally or by injection; the injection administration method is preferably selected from intravenous injection, intramuscular injection, intracoronary injection, and myocardial injection. Packaging circ-CHACR with an appropriate carrier or excipient forms a drug combination, and is administered by oral, intravenous injection, intramuscular injection, intracoronary injection, or direct myocardial injection to achieve the effect of preventing or treating non-alcoholic fatty liver.

[0029] The present invention provides a method for screening drugs for preventing and / or treating non-alcoholic fatty liver, including the following steps: treating a non-alcoholic fatty liver receptor animal with a test drug, and detecting the expression level of USP1 in the receptor animal.

[0030] In the present invention, the method further sets a negative control group, and the negative control is a non-alcoholic fatty liver receptor animal without any drug treatment; compared with the negative control group, when the expression level of USP1 in the receptor animal is significantly reduced after treating the receptor with a test drug, it can be determined that the test drug is a drug for preventing and / or treating non-alcoholic fatty liver.

[0031] In the above method, the method for detecting the expression level of USP1 can adopt real-time fluorescence quantitative PCR detection. There are no special limitations on the PCR reaction system and PCR reaction program adopted by the method for detecting the expression level of USP1 by real-time fluorescence quantitative PCR of the present invention, and conventional methods in the art can be used.

[0032] In the present invention, unless otherwise specified, all raw material components are commercially available products well-known to those skilled in the art.

[0033] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0034] In the following embodiments, the ML323 was purchased from Shelleck, and the product number is S7529.

[0035] In the following embodiments, the experimental methods involved are carried out with reference to the following:

[0036] Immunofluorescence:

[0037] (1) Place small round pieces in a 24-well plate and inoculate SK-Hep1 cells at an appropriate density. Add different stimuli according to different groups.

[0038] (2) Fixation: Take the cells out of the incubator, aspirate the culture medium, wash with PBS 5 min × 3 times, fix the cells on the small round pieces with 4% paraformaldehyde, gently add 500 μL of paraformaldehyde to each well along the well wall of the 24-well plate and fix at room temperature for 40 min; aspirate the paraformaldehyde and quickly wash with PBS on a shaker for 10 min × 3 times.

[0039] (3) Blocking: Block with serum for 2 h (add 1% Triton in the blocking solution for nuclear antigens)

[0040] (4) Primary antibody: After blocking, dilute the primary antibody with 5% BSA and drop it onto the small round pieces, and incubate overnight at 4°C.

[0041] (5) Rewarming: Place at room temperature for 30 min, discard the primary antibody, wash with PBS 10 min × 3 times (on a shaker); aspirate the PBS completely.

[0042] (6) Secondary antibody: Dilute the fluorescent secondary antibody in a certain proportion, add the corresponding fluorescent secondary antibody and DAPI (for nuclear staining) under light-proof conditions, incubate at room temperature in the dark for 1 h. After incubation, discard the fluorescent secondary antibody, place it on a shaker in the dark with experimental tin foil, and quickly shake and wash with cell PBS for 10 min × 3 times. Aspirate the cell PBS completely for the last time.

[0043] (7) Mounting: Add 5 μL of glycerol mounting medium on the glass slide, and invert the small round piece in the 24-well plate onto the glass slide (pay attention to avoid generating air bubbles).

[0044] (8) Photographing: Take pictures under the confocal microscope.

[0045] Cell transfection:

[0046] (1) Add an appropriate volume of serum-free basal medium to an EP tube according to the lipo3000 instruction manual, then mix p3000 and plasmid according to the corresponding proportion, and let it stand for 5 min.

[0047] (2) Mix the mixture in step (1) with lipo3000 again, and let it stand for 20 min.

[0048] (3) Discard the medium in the culture dish, and wash it 2 - 3 times with PBS.

[0049] (4) Add an appropriate volume of serum-free medium to the culture dish, add the above mixture to the medium, and continue to culture for 6 - 8 h.

[0050] (5) Aspirate and discard the serum-free medium, replace it with complete medium, and put it back into the incubator.

[0051] (6) Determine the culture time according to the experimental requirements, generally collect cells 48 - 72 h after transfection for transfection efficiency identification and subsequent experiments. If it is a fluorescent plasmid, the success of cell transfection can be understood by observing the fluorescence expression in the cells.

[0052] Protein sample preparation:

[0053] B1. Preparation of tissue protein samples:

[0054] (1) Take the patient's liver tissue (appropriate amount, weigh and record), put it into a grinding tube, add grinding beads, add pre-cooled PBS containing PMSF to each tube, and grind thoroughly in a tissue grinder.

[0055] (2) Centrifuge at 10000 rpm for 10 min at 4 °C, discard the supernatant, add a potent lysis buffer (add protease inhibitor and phosphatase inhibitor in advance according to the proportion) according to the tissue weight, and pipette evenly.

[0056] (3) Incubate on ice for 30 min, transfer the well-lysed suspension to a pre-cooled 1.5 mL Eppendorf tube, and then centrifuge at 12,000 rpm for 5 min at 4°C;

[0057] (4) Transfer the supernatant in the Eppendorf tube to a new pre-cooled Eppendorf tube, add 5×loading buffer according to the volume of the lysis solution (for example, if the lysis solution is 400 μL, add 100 μL of 5×loading buffer), boil in a water bath for 10 min, and store it in a -80°C refrigerator for later use. Just dissolve the protein in a water bath before the next loading.

[0058] B2. Preparation of cell protein samples

[0059] (1) First aspirate and discard the culture medium, and wash the cells 2 - 3 times with pre-cooled PBS.

[0060] (2) Add an appropriate amount of strong lysis solution according to the number of cells per dish (add protease inhibitor and phosphatase inhibitor in advance according to the ratio), use a clean cell scraper to scrape the cells in the culture dish, and incubate on ice for 30 min.

[0061] (3) Transfer the well-lysed suspension to a pre-cooled 1.5 mL centrifuge tube. Centrifuge at 12,000 rpm for 5 min at 4°C;

[0062] (4) Transfer the supernatant in the Eppendorf tube to a new Eppendorf tube, add 5×loading buffer according to the volume of the lysis solution, boil in a water bath for 10 min, and store it in a -80°C refrigerator for later use. Just dissolve the protein in a water bath before the next loading.

[0063] Immunoblotting (Western Blot):

[0064] (1) Load the corresponding amounts of protein samples and protein Marker into the corresponding lanes in sequence, and add electrophoresis buffer to the designated position in the electrophoresis tank.

[0065] (2) Connect the electrophoresis apparatus. You can run the whole process at a voltage of 90 V, or set the initial voltage to 80 V. After the bromophenol blue runs into the separating gel, the voltage can be adjusted to 120 - 150 V.

[0066] (3) Activate the PVDF membrane in methanol solution for 30 - 60 s in advance, then equilibrate it in ddH2O and transfer it to the transfer buffer for later use.

[0067] (4) Immerse the transfer cassette in pre-cooled transfer buffer, and sequentially place a sponge pad and filter paper on the transfer cassette. Take out the glass plate that has completed electrophoresis from the electrophoresis tank, remove the separating gel, cover it on the filter paper, cover the prepared PVDF membrane on the separating gel, expel the air bubbles, and then sequentially cover filter paper and sponge pad.

[0068] (5) Place the transfer sandwich into the transfer tank according to the color matching, and add the pre-cooled transfer buffer prepared. Place the entire transfer tank into ice water to keep it at a low temperature, set a constant current of 300 mA, and determine the transfer time according to the molecular weight of the target protein.

[0069] (6) After the transfer is completed, take out the PVDF membrane, place it face up into the prepared blocking solution, and block it on a shaker at room temperature for 1 - 2 h.

[0070] (7) Wash the PVDF membrane thoroughly with TBST. Add the primary antibody dilution in the antibody incubation box, invert the PVDF membrane onto the primary antibody dilution, and incubate it overnight in a 4°C refrigerator.

[0071] (8) Take out the PVDF membrane, warm it at room temperature for half an hour, and wash it with TBST for 10 min × 3 times.

[0072] (9) Add the secondary antibody dilution in the antibody incubation box, invert the PVDF membrane onto the secondary antibody dilution, and incubate it at room temperature for 2 h. If the room temperature is too low, the incubation time can be appropriately extended.

[0073] (10) Wash it with TBST for 10 min × 3 times.

[0074] (11) Drop the chemiluminescence solution on the front side of the PVDF membrane, and then put it into the developing machine for development.

[0075] Co - immunoprecipitation:

[0076] ① Take out the treated cells from the incubator, place them on ice, aspirate the culture medium, wash them 3 times with pre - cooled PBS, add an appropriate amount of prepared medium - strength lysis buffer, use a clean cell scraper to completely scrape the cells in the culture dish, place them on ice for lysis for 30 min. After sufficient lysis, add the lysate to a pre - cooled EP tube and then add protein A / G in an appropriate proportion, and rotate at 4°C for 3 h.

[0077] ② Centrifuge at 1200 rpm, 4°C for 5 min, take the supernatant and add it to a new pre - cooled EP tube, add an appropriate amount of antibody and isotype IgG of the same origin according to the antibody instruction manual, and rotate overnight at 4°C.

[0078] ③ Add protein A / G (add 32 μL of protein A / G to 400 μL of protein lysate), 4°C

[0079] ④ Rotate for 2.5 h.

[0080] ⑤ Centrifuge at 1200 rpm, 4°C for 5 min, discard the supernatant (pay attention to sucking it clean), and wash it 2 times with 1 mL of medium - strength lysis buffer.

[0081] ⑥ Add 8 μL of 5× Loading buffer into an EP tube, boil it in a water bath for 10 min, and use it immediately or store it at -80 °C for later use.

[0082] ⑦ Detect the results by immunoblotting.

[0083] Silver staining:

[0084] After the electrophoresis is completed, take out the polyacrylamide gel from the electrophoresis tank, put it into the fixing solution for 10 min. After completion, take out the gel and put it into the silver staining solution for 10 min for staining. After staining, take out the gel from the silver staining solution, put it into the developing solution for development until the target band is clear, take out the gel from the developing solution, and put it into the stopping solution to stop the development. Observe and take pictures for recording.

[0085] PCR:

[0086] Extract RNA by TRIzol method

[0087] (1) If it is a cell sample, aspirate the culture medium and wash it 3 times with pre-cooled PBS, then add TRIzol to the culture dish at a ratio of 10 cm 2 / mL; if it is a tissue sample, add TRIzol proportionally according to the volume of the specimen (50 - 100 mg / mL), and use a tissue grinder to fully grind the tissue specimen.

[0088] (2) Place the sample on ice and fully digest and lyse it for 30 min. Aspirate the lysed suspension and transfer it to a sterile 1.5 mL EP tube. At the same time, add 200 μL of chloroform, mix it up and down, and let it stand for 2 min.

[0089] (3) Centrifuge at 4 °C, 12000 rpm, for 5 min. The sample is divided into three layers. Carefully transfer the upper liquid to a new pre-cooled sterile EP tube.

[0090] (4) Add an equal volume of isopropanol, mix it well, and let it stand for 10 min.

[0091] (5) Centrifuge at 4 °C, 12000 rpm, for 10 min. Discard the supernatant, and be careful not to touch the precipitate when aspirating the supernatant.

[0092] (6) Add 1 mL of 75% ethanol prepared with DEPC water and alcohol to each EP tube (pre-cooled at 4 °C 48 h in advance), gently shake the RNA precipitate, centrifuge at 4 °C, 7500 rpm, for 10 min.

[0093] (7) Repeat step (6) once.

[0094] (8) Aspirate the ethanol, open the lid of the EP tube and air-dry the precipitate at room temperature. Add DEPC water, measure the concentration and record it, and store it in a -80 °C refrigerator.

[0095] Reverse transcription

[0096] (1) Prepare a 20 μL reverse transcription reaction system:

[0097] (2) After thoroughly mixing the above system, centrifuge it, then place it in a PCR instrument, set the reverse transcription program (42 °C for 1 h, 70 °C for 5 min). After completion, take out the cDNA, dilute each tube with 180 μL of DEPC water, and store it at -20 °C.

[0098] Real-time Quantitative PCR

[0099] (1) Prepare a 20 μL PCR system.

[0100] (2) Set the cycling program.

[0101] (3) Analyze the cycle number of the target gene using GAPDH as an internal reference.

[0102] Histopathological observation:

[0103] (C1) Sampling and fixation

[0104] After the experiment, sacrifice the mice, and then quickly take out the mouse livers and fix them in a 4% paraformaldehyde solution. Then perform paraffin embedding and sectioning and frozen sectioning respectively.

[0105] (C2) HE staining

[0106] (1) Deparaffinization and hydration: Take out the paraffin sections, and place the sections successively in xylene (5 min / twice), absolute ethanol (2 min), 95% ethanol (2 min), 80% ethanol (2 min), 70% ethanol (2 min), and finally rinse with running tap water for 5 min.

[0107] (2) Hematoxylin staining: Blot dry the water, add hematoxylin and stain for 5 min, and rinse with running ddH2O.

[0108] (3) Differentiation: Place the sections in hydrochloric acid ethanol for 30 seconds. Rinse with running ddH2O.

[0109] (4) Eosin staining: Place the sections in eosin solution for 2 min.

[0110] (5) Dehydration: Place the sections successively in 70% ethanol (1 min), 80% ethanol (1 min), 95% ethanol (1 min), absolute ethanol (1 min), and air dry naturally.

[0111] (6) Mounting: Mount the sections with neutral balsam, taking care to prevent the formation of air bubbles.

[0112] (7) Observation under microscope.

[0113] (C3) Oil red staining:

[0114] (1) Place the frozen section at room temperature for 10 min to allow it to warm up and dry.

[0115] (2) Immerse the section in 60% isopropanol and wash for 5 - 10 seconds.

[0116] (3) Place the section in the oil red staining solution and stain for 3 - 5 min, covering it to avoid light.

[0117] (4) Wash with 60% isopropanol for 15 - 30 seconds, then wash with distilled water for 15 - 30 seconds.

[0118] (5) Differentiate the background with 75% alcohol, then wash with distilled water.

[0119] (6) Counterstain with hematoxylin staining solution for 3 - 5 min, then repeat the differentiation step.

[0120] (7) Place the section in water at 55°C to bluing for 5 min, and finally rinse with running water.

[0121] (8) Mount the section with glycerin gelatin mounting medium.

[0122] (C4) Immunohistochemical staining

[0123] (1) Place the paraffin section of mouse liver in an oven at 60°C for baking for 1 - 2 h.

[0124] (2) Deparaffinization and hydration: Place the section successively in xylene (5 min), xylene (5 min), absolute ethanol (2 min), 95% ethanol (2 min), 80% ethanol (2 min), 70% ethanol (2 min), and finally rinse with running tap water for 5 min.

[0125] (3) Antigen retrieval: After the repair solution in the pressure cooker boils, put the section into the repair solution, maintain at 300 W for 18 min, wait for the repair solution to cool naturally to room temperature, and wash with PBS for 5 min × 3 times.

[0126] (4) Blocking: Drop an appropriate amount of hydrogen peroxide solution on the section tissue and incubate at room temperature for 15 min to block endogenous catalase, and wash with PBS for 5 min × 3 times.

[0127] (5) Primary antibody: Prepare the primary antibody according to the instruction manual, and then incubate in a wet box at 4°C overnight.

[0128] (6) Rewarming: Rewarm at room temperature for 30 min, and then wash with PBS for 5 min × 3 times.

[0129] (7) Secondary antibody: Add an appropriate amount of secondary antibody to the tissue sections and incubate at room temperature for 30 min, then rinse with PBS for 5 min × 3 times.

[0130] (8) Chromogenic reaction: Add the prepared DAB solution to the tissue sections, develop for an appropriate time, and rinse with running tap water for 5 min;

[0131] (9) Counterstaining: Counterstain with hematoxylin for 20 s, rinse with running tap water for 5 min, differentiate with hydrochloric acid-ethanol for 10 s, rinse with running tap water for 5 min, and blue in 65 °C for 5 min.

[0132] (10) Dehydration: Place the tissue sections successively in 75% ethanol (1 min), 80% ethanol (1 min), 95% ethanol (1 min), and absolute ethanol (1 min), and air dry naturally.

[0133] (11) Sealing: Seal with neutral balsam to prevent the formation of bubbles.

[0134] Nile red staining:

[0135] (1) Place small round pieces in a 24-well plate and inoculate SK-Hep1 cells at an appropriate density. Add different stimuli according to different groups.

[0136] (2) Fixation: Take the cells out of the incubator, aspirate the culture medium, wash with PBS for 5 min × 3 times, fix the cells on the small round pieces with 4% paraformaldehyde, gently add 500 μL of paraformaldehyde to each well along the wall of the 24-well plate and fix at room temperature for 40 min; aspirate the paraformaldehyde and wash quickly with PBS by shaking for 10 min × 3 times (shaker).

[0137] (3) Staining: Add Nile red staining solution to the well plate and incubate at 37 °C for 10 - 15 min.

[0138] (4) Washing: Cover the well plate with experimental tin foil to avoid light, and wash quickly with cell PBS by shaking for 10 min × 3 times.

[0139] (5) Sealing: Add 5 μL of glycerol mounting medium containing Dapi to the glass slide, and invert the small round pieces in the 24-well plate onto the glass slide (pay attention to avoiding the formation of bubbles).

[0140] Example 1

[0141] 1. USP1 in hepatocytes deubiquitinates and stabilizes the key transcription factor SREBP-1C for de novo fatty acid synthesis

[0142] (1) Small round pieces were placed in 24-well plates, and SK-Hep1 cells at an appropriate density were inoculated. Different stimuli were added, namely the control group (Control), the palmitic acid (PA) group, and the fructose (Fru) group. Among them, the control (Control) was SK-Hep1 cells cultured normally, that is, SK-Hep1 cells not stimulated by palmitic acid and fructose; the palmitic acid (PA) group stimulated SK-Hep1 cells with 0.2 mM palmitic acid (PA) for 24 h; the fructose (Fru) group stimulated SK-Hep1 cells with 8 mM fructose for 48 h. Subsequently, the co-localization of USP1 and SREBP-1C was observed using immunofluorescence.

[0143] In the hepatocyte cell line SK-Hep1, palmitic acid or fructose was used as an inducer respectively to induce de novo fatty acid synthesis in hepatocytes. Figure 1 The result A in [reference] showed that there was significant fluorescence co-localization between USP1 and SREBP-1C.

[0144] (2) Endogenous interaction: SK-Hep1 cell proteins were extracted, and immunoprecipitation was performed using USP1 and SREBP-1C as bait proteins respectively to observe whether there was protein interaction between the two. Among them, the Input group was the SK-Hep1 cell protein sample directly subjected to immunoblotting to observe the two proteins USP1 and SREBP-1C; the negative control IgG group was to add IgG to the SK-Hep1 cell protein to exclude non-specific binding; IP: SREBP-1C group was to precipitate USP1 using SREBP-1C as the bait protein, and if a band appeared in the immunoblotting, it indicated that there was an interaction between the two; IP: USP1 group was to precipitate SREBP-1C using USP1 as the bait protein, and if a band appeared in the immunoblotting result, it was an interaction between the two.

[0145] Normal IgG does not specifically bind to proteins, so it is used as a negative control to show any non-specific binding signals in the experiment. If the target protein interacts with normal IgG, then this interaction may be non-specific. If there is no band in the IgG group, it indicates that there is no non-specific binding, confirming the specificity of the experiment. The IgG described above is IgG homologous to the SREBP-1C antibody.

[0146] Figure 1The result in B shows that the bands in the Input group lead to the conclusion that both USP1 and SREBP-1C proteins are present in the extracted proteins of SK-Hep1 cells. There are no bands in the IgG group, indicating that the possibility of non-specific binding between the extracted SK-Hep1 cell proteins and the antibody has been excluded. Bands are present for both proteins in the IP: SREBP-1C group and the IP:USP1 group, indicating that the precipitation experiment using the SREBP-1C antibody successfully precipitated SREBP-1C, and at the same time USP1 was also precipitated, thus indicating the intracellular endogenous interaction between USP1 and SREBP-1C in the hepatocyte cell line SK-Hep1.

[0147] (3) Transfect the USP1 shRNA plasmid into SK-Hep1 cells to inhibit the expression of USP1, observe the expression of SREBP-1C, and at the same time use the proteasome inhibitor MG132 on the basis of knocking down USP1 to observe the expression of SREBP-1C.

[0148] The USP1 shRNA plasmid described above is PTSB-SH-copGFP-2A-PURO purchased from Shanghai Quanyang Biotechnology Co., Ltd., with the product number TSB211187.

[0149] Among them, the role of MG132 in the ubiquitination experiment is to inhibit proteasome activity, inhibit the deubiquitination of SREBP-1C, and enable the accumulation of ubiquitinated proteins.

[0150] Figure 1 The result in C shows that after USP1 in SK-Hep1 cells was knocked down, the expression of SREBP-1C protein decreased significantly, and after the SK-Hep1 cells with knocked-down USP1 were treated with the proteasome inhibitor MG132, it was reversed, that is, the expression of SREBP-1C protein was restored.

[0151] (4) Transfect the USP1 shRNA plasmid into SK-Hep1 to inhibit the expression of USP1, extract the proteins of SK-Hep1 cells with knocked-down USP1, use SREBP-1C as the bait protein (that is, add the SREBP-1C antibody) to precipitate ubiquitin, and observe the ubiquitination level of SREBP-1C by immunoblotting.

[0152] Figure 1 The result in D shows that after USP1 was knocked down in SK-Hep1, the ubiquitination level of SREBP-1C increased significantly.

[0153] In summary, after the reduction of USP1 expression, the ubiquitination level of SREBP-1C was significantly increased, thereby reducing the protein expression of SREBP-1C, that is, USP1 deubiquitinates and stabilizes SREBP-1C, a key transcription factor for de novo fatty acid synthesis, in hepatocytes.

[0154] 2. USP1 deubiquitinates and stabilizes SCD1, a key enzyme for de novo fatty acid synthesis, in hepatocytes

[0155] SREBP-1C transcriptionally regulates a series of key enzymes for de novo fatty acid synthesis (including ACLY, ACACA, FASN, SCD1). Therefore, it was studied whether USP1 transcriptionally regulates the transcription level of SCD1, a series of key enzymes for de novo fatty acid synthesis, through SREBP-1C.

[0156] S1. In SK-Hep1 cells, SK-Hep1 cell proteins were extracted, and USP1 was used as a bait protein (i.e., USP1 antibody was added) to precipitate SCD1. The enrichment of SCD1 was observed by silver staining of polyacrylamide gel. The IgG group was used as a negative control (i.e., IgG was added to SK-Hep1 cell proteins) to exclude non-specific binding.

[0157] Figure 2 Result A in shows that in the hepatocyte cell line SK-Hep1, the enrichment of SCD1 protein was visible by silver staining after immunoprecipitation of USP1.

[0158] S2. Endogenous interaction: SK-Hep1 cell proteins were extracted, and immunoprecipitation was performed using USP1 and SCD1 as bait proteins respectively to observe whether there was protein interaction between the two. Among them, the Input group was the SK-Hep1 cell protein sample directly subjected to immunoblotting to observe the two proteins of USP1 and SCD1; the IgG group was used as a negative control (i.e., IgG was added to SK-Hep1 cell proteins) to exclude non-specific binding. IP: SCD1 group was to precipitate USP1 using SCD1 as a bait protein (i.e., SCD1 antibody was added to SK-Hep1 cell proteins), and IP: USP1 group was to precipitate SCD1 using USP1 as a bait protein (i.e., USP1 antibody was added to SK-Hep1 cell proteins).

[0159] Exogenous interaction: In SK-Hep1, USP1 and SCD1 overexpression plasmids were co-transfected, and then cell proteins were extracted for immunoprecipitation.

[0160] Among them, the USP1 overexpression plasmid (Flag-USP1) was a commercial plasmid purchased from Shanghai Quanyang Biotechnology Co., Ltd.: p3×FLAG-CMV-10-USP1. The SCD1 overexpression plasmid (HA-SCD1) was a commercial plasmid purchased from Shanghai Quanyang Biotechnology Co., Ltd.: pTSB-CMV-SCD.

[0161] Figure 2 The results of B in [description] showed that the endogenous and exogenous interactions between USP1 and SCD1 were confirmed by co-immunoprecipitation in SK-Hep1.

[0162] S3. Transfect the USP1 shRNA plasmid into SK-Hep1 to inhibit the expression of USP1, observe the expression of SCD1, and at the same time use the proteasome inhibitor MG132 on the basis of knocking down USP1 to observe the expression of SCD1.

[0163] Figure 2 The results of C in [description] showed that the protein expression of SCD1 decreased significantly after USP1 knockdown, and the protein expression level of SCD1 could be reversed by the proteasome inhibitor MG132.

[0164] S4. Transfect the USP1 shRNA plasmid into SK-Hep1 to inhibit the expression of USP1, and then perform co-immunoprecipitation with SCD1 as the bait protein to observe the ubiquitination level of SCD1.

[0165] Figure 2 The results of D in [description] showed that the ubiquitination level of SCD1 increased significantly after USP1 knockdown.

[0166] Figures 1 - 2 The results showed that USP1 transcriptionally regulated the transcription levels of a series of key enzymes in de novo fatty acid synthesis through SREBP-1C, and at the same time individually regulated the expression of SCD1 through deubiquitination. Therefore, USP1 significantly affected the de novo fatty acid synthesis pathway in hepatocytes.

[0167] Example 2

[0168] Note: Here, "[description]" is used as a placeholder for the specific context which is not provided in the original text. It should be replaced with the actual relevant description in the real scenario.Six-week-old male C57BL / 6 mice were selected and divided into 5 groups, namely the natural control group, the high fructose high fat diet group (HFHF-Diet), the high fructose high fat diet + ML323 group (HFHF-Diet+ML323), the high fructose high fat diet + adenovirus empty vector control group (HFHF-Diet+AAV8 control), and the high fructose high fat diet + adenovirus USP1 knockdown group (HFHF-Diet+AAV8 USP1 RNAi), with 6 mice in each group. In the HFHF-Diet group, six-week-old male C57BL / 6 mice were fed a high fructose high fat diet, which consisted of 5% fructose drinking water and 45% high fat feed, and the high fructose high fat diet was continuously fed for 12 weeks. In the high fructose high fat diet + ML323 group, six-week-old male C57BL / 6 mice were fed a high fructose high fat diet, which consisted of 5% fructose drinking water and 45% high fat feed, and the high fructose high fat diet was continuously fed for 12 weeks. Starting from the 4th week, 10 mg / kg ML323 was intraperitoneally injected once a week and continuously injected until the 12th week. In the high fructose high fat diet + adenovirus empty vector control group and the high fructose high fat diet + adenovirus USP1 knockdown group, six-week-old male C57BL / 6 mice were fed a high fructose high fat diet, which consisted of 5% fructose drinking water and 45% high fat feed, and the high fructose high fat diet was continuously fed for 12 weeks. At the 4th week, an empty adenovirus or a USP1 knockdown adenovirus was injected via the tail vein once. The mice were sacrificed at the 12th week, liver tissues were taken, and liver photos were taken. Subsequently, some liver tissues were fixed and embedded to make frozen sections for oil red staining, and paraffin sections were made for HE staining and immunohistochemical staining. Another part of the liver tissue was taken to extract tissue proteins for Western blot experiments.

[0169] The AAV8 USP1 RNAi was purchased from GeneChem's GIDV0339250.

[0170] Among them, the vector sequence of AAV8 USP1 RNAi:

[0171] TCCCACCCGGGGTTTTCTCGGCATGGACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTGTCTTTCTGTTAAGCTTTCACAGTTTTGGCCACTGACTGACTGTGAAAGTAACAGAAAGACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAAGCTTTAAATAGCTGAGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAATCAGATCTGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGAGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCTTGATGCGGGTTTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGGCAAATCAACCATAGTACGCTCCCTGTATCGGGTGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCATCGTGACCGCTACACTTGCCAGCGCCTTAGCGCCCGCTCCTTTCGTTTACTTCCCTTCCTTTCTCACCACGTTCGCCGGCTTTTCCCCGTCAAGCTCTAAATCGGGGGCTTCCCTTTAGGGTTCCGATGTATGCTTTACGGCACCTCGACCCAAAAAACTTGATTGGGGAGATGGTACAGGTAGTGGGCCATCGCCCCTGATAGAGTGTTTTTCCGCCCTTA(SEQ ID NO.1).

[0172] When constructing the vector of AAV8 USP1 RNAi, the USP1 RNAi sequence is as follows:

[0173] ACCGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTGTCTTTCTGTTAAGCTTTCACAGTTTTGGCCACTGACTGACTGTGAAAGTAACAGAAAGACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAAGCTTGGT (SEQ ID NO.2).

[0174] Figure 3 The results showed that after feeding mice with a high-fructose and high-fat diet for 12 weeks, a high-fructose and high-fat model mouse was successfully constructed.

[0175] Figure 3 Result A in [reference] showed that in the high-fructose and high-fat model mice, after intraperitoneal injection of the USP1 inhibitor ML323 and tail vein injection of AAV-USP1 RNAi, hepatic lipid deposition was significantly improved.

[0176] Figure 3 Results B - C in [reference] showed that HE staining, Oil Red O staining, and immunohistochemistry indicated that inhibiting USP1 could significantly improve the pathological progression of NAFLD, lipid deposition, and reduce the expression of the de novo fatty acid synthesis transcription factor SREBP-1C and the key enzymes ACACA, FASN, and SCD1.

[0177] Example 3

[0178] Prasugrel, as a USP1 inhibitor, can significantly inhibit de novo fatty acid synthesis in hepatocytes and treat NAFLD

[0179] (A1) SK-Hep1 cells were seeded in six-well plates at an appropriate density and stimulated with different stimuli according to different groups. SK-Hep1 cells untreated with any drug were used as the control (con), and SK-Hep1 cells were stimulated with prasugrel 10 μM (Pra 10 μM), prasugrel 20 μM (Pra 20 μM), aspirin (Asp 10 μM), and clopidogrel (Clo 10 μM) for 24 h respectively. Cellular proteins and RNA were extracted for Western Blot and PCR experiments.

[0180] Figure 4The A result in shows that prasugrel can significantly inhibit the expression of USP1, and can also significantly inhibit the expression of the key transcription factor SREBP-1C and the key enzymes in the de novo synthesis of fatty acids in SK-Hep1, while the other two common antiplatelet drugs, aspirin and clopidogrel, have no such effect. Among them, aspirin is completely ineffective, while clopidogrel only inhibits SCD1.

[0181] (A2) SK-Hep1 cells were seeded in six-well plates at an appropriate density and treated with different stimuli according to different groups: control (con), prasugrel (Pra), and prasugrel + proteasome inhibitor MG132 (Pra + MG132). Among them, the control (con) was SK-Hep1 cells without any drug treatment for 24 h; the prasugrel (Pra) group was treated with 30 μM prasugrel to stimulate SK-Hep1 cells for 24 h; the prasugrel + proteasome inhibitor MG132 group was treated with 30 μM prasugrel to stimulate SK-Hep1 cells for 18 h, and then 10 μM MG132 was added to stimulate SK-Hep1 cells for 6 h. Cell proteins and RNA were extracted for Western Blot experiments.

[0182] Figure 4 The B result in shows that prasugrel can inhibit the substrate proteins SREBP-1C and SCD1 of de novo fatty acid synthesis regulated by USP1, and this inhibitory effect can be reversed by the proteasome inhibitor MG132.

[0183] (A3): SK-Hep1 cells were seeded in six-well plates at an appropriate density and the cells were treated according to different groups: control (con), prasugrel (Pra), prasugrel + transfection of wild-type USP1 overexpression plasmid (Pra + OE-USP1-WT), prasugrel + transfection of USP1 overexpression plasmid with mutated enzyme active site (Pra + OE-USP1-C90S). Among them, the control group was SK-Hep1 cells without any drug treatment for 24 h; the prasugrel group was treated with 30 μM prasugrel to stimulate SK-Hep1 cells for 24 h; the prasugrel + transfection of wild-type USP1 overexpression plasmid group: SK-Hep1 cells were transfected with wild-type USP1 overexpression plasmid and then stimulated with 30 μM prasugrel for 24 h; the prasugrel + transfection of USP1 overexpression plasmid with mutated enzyme active site group: SK-Hep1 cells were transfected with USP1 overexpression plasmid with mutated enzyme active site and then stimulated with 30 μM prasugrel for 24 h. All cells were treated with the proteasome inhibitor MG132 for 6 h before protein extraction, and then cell proteins were extracted for immunoprecipitation experiments.

[0184] Among them, the wild-type USP1 overexpression plasmid was purchased from p3×FLAG-CMV-10-USP1 of Quanyang Biotechnology, and the USP1 overexpression plasmid with mutated enzyme active site was purchased from p3×FLAG-CMV-10-USP1-C90S of Quanyang Biotechnology.

[0185] Figure 4 The results in C showed that prasugrel could enhance the ubiquitination level of SREBP-1C, and this effect could only be reversed by wild-type OE-USP1-WT, rather than the inactivated mutant USP1 C90S.

[0186] Figure 4 The results in D showed that prasugrel could enhance the ubiquitination level of SCD1, and this effect could only be reversed by wild-type OE-USP1-WT, rather than the inactivated mutant USP1 C90S.

[0187] (A4): SK-Hep1 cells were seeded in a six-well plate at an appropriate density, and different stimuli were added according to different groups. Those without any drug treatment were used as the control (con), prasugrel 10 μM (Pra 10 μM), prasugrel 20 μM (Pra 20 μM), aspirin (Asp 10 μM), and clopidogrel (Clo 10 μM) were used to stimulate for 24 h respectively, and Nile red staining was performed to observe the intracellular lipid droplets.

[0188] Figure 4 The results in E showed that in SK-Hep1 cells, through Nile red staining, it was visible that the lipid formation induced by palmitic acid (PA) and fructose (Fru) could be significantly inhibited by prasugrel, while aspirin was ineffective, and clopidogrel could also partially inhibit lipid formation (possibly related to its inhibition of the expression of SCD1).

[0189] (A5): The construction of the mouse NAFLD model was the same as in Example 2 and was divided into 3 groups: control (natural control), high fructose high fat diet group (High fructose high fat diet, HFHF-Diet), and high fructose high fat diet + prasugrel group (HFHF-Diet+Pra). Among them, in the control group, 6-week-old male C57BL / 6 mice were fed a normal diet with regular feed; in the HFHF-Diet group, 6-week-old male C57BL / 6 mice were fed a high fructose high fat diet, and the high fructose high fat diet contained 5% fructose drinking water and 45% high fat feed, and the high fructose high fat diet was continuously fed for 12 weeks; in the HFHF-Diet+Pra group, 6-week-old male C57BL / 6 mice were fed a high fructose high fat diet, and the high fructose high fat diet contained 5% fructose drinking water and 45% high fat feed, and the high fructose high fat diet was continuously fed for 12 weeks. From the fourth week, 200 μg / kg / day of prasugrel was administered by gavage every day, and prasugrel was continuously fed until the 12th week. The mice were sacrificed at the 12th week, liver tissues were taken, liver photos were taken, and then some liver tissues were fixed and embedded to make frozen sections for oil red staining, and paraffin sections were made for HE staining and immunohistochemical staining; another part of the liver tissue was taken to extract tissue protein for Western blot experiments.

[0190] Figure 4 The results in F showed that in the mouse high fat and high fructose NAFLD model, oral administration of prasugrel could significantly inhibit the expression of SREBP-1C and SCD1.

[0191] Figure 4 The results in G-H showed that in the mouse high fat and high fructose NAFLD model, oral administration of prasugrel could significantly hinder the progression of NAFLD.

[0192] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a USP1 inhibitor in the preparation of a medicament for preventing and / or treating non-alcoholic fatty liver disease.

2. The application according to claim 1, characterized in that, The USP1 inhibitor includes one or both of a reagent for reducing USP1 expression and a reagent for reducing USP1 product.

3. The application according to claim 2, wherein The reagent for reducing USP1 product includes a protease or nuclease that degrades the USP1 product; the reagent for reducing USP1 expression includes a reagent for knocking down USP1.

4. The application according to claim 2, wherein The reagent for knocking down USP1 includes RNAi.

5. The application according to any one of claims 1 to 4, characterized in that, The USP1 inhibitor includes one or more of prasugrel, ML323, and RNAi with a sequence as shown in SEQ ID NO.

2.

6. The application according to claim 5, characterized in that, The USP1 inhibitor is prasugrel.

7. The application according to claim 5, wherein The USP1 inhibitor significantly inhibits de novo synthesis of fatty acids in hepatocytes.

8. A drug for preventing and / or treating non-alcoholic fatty liver, characterized in that, The medicament includes the USP1 inhibitor described in any one of claims 1 to 7 and its pharmaceutically acceptable excipients.

9. A method for screening drugs for preventing and / or treating non-alcoholic fatty liver disease, characterized in that, Comprising the following steps: Treat a non-alcoholic fatty liver receptor animal with a test drug, and detect the expression level of USP1 in the receptor animal.

10. The method according to claim 9, wherein The method also sets a negative control group, and the negative control is a non-alcoholic fatty liver receptor animal not treated with any drug; Compared with the negative control group, when the expression level of USP1 in the receptor animal is significantly reduced after treating the receptor with the test drug, it can be determined that the test drug is a medicament for preventing and / or treating non-alcoholic fatty liver disease.