Rice dreg short peptide and application thereof in reducing uric acid

Abstract

The application belongs to the technical field of biochemistry, and particularly relates to a rice residue short peptide and application thereof in reducing uric acid, wherein the amino acid sequence of the rice residue short peptide is any one of SEQ ID NO: 3, SEQ ID NO: 9 and SEQ ID NO: 10. The rice residue short peptide can realize simultaneous intervention of multiple links of uric acid metabolism, has the characteristics of inhibiting uric acid generation, promoting uric acid excretion and antioxidation, can realize excellent uric acid reduction effect, and provides further theoretical basis for deep development of rice processing by-products.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemistry, and particularly relates to a rice residue short peptide and application thereof in reducing uric acid. Background Art

[0002] The global prevalence of hyperuricemia (HUA) has increased significantly due to the increased consumption of foods rich in purine and fructose, such as seafood, broth, milk tea, and beer. Uric acid (UA) is the end product of the purine metabolic pathway. Abnormal serum uric acid (SUA) levels occur due to high production by liver metabolism and cell renewal, low excretion by the kidneys and gastrointestinal tract, or a combination of both processes. Uric acid is mainly excreted by the proximal renal tubules. The kidneys play a vital role in regulating circulating uric acid levels. Dysfunction of the kidneys in processing UA may be a common pathophysiological feature supporting HUA. And persistently above the serum uric acid point (>6.8 mg / dL) leads to the conversion of uric acid into monosodium urate (MSU) crystals.

[0003] To overcome the burden of HUA, one of the main approaches is to reduce UA levels, which can be achieved by inhibiting UA synthesis and reabsorption or increasing its excretion. Many drugs are commercially available for the treatment of HUA, such as allopurinol, which reduces UA production, and benzbromarone, which increases UA excretion. However, long-term use may lead to hepatotoxicity, renal toxicity, and allergic reactions. Therefore, there is a need to explore alternative treatment options that can effectively manage HUA with few or no side effects. Natural compounds extracted from foods and plants have the potential to reduce UA levels. Food-derived bioactive peptides (Fbp) have attracted widespread attention as functional ingredients with bioactivity. Fbp can reduce blood UA levels and alleviate HUA by inhibiting key enzymes such as xanthine oxidase, increasing renal UA excretion and reabsorption, increasing antioxidant activity, regulating inflammatory mediators, and resolving gut microbiome dysbiosis. They hold great research potential. Rice processing in my country generates a large amount of by-products annually, such as broken rice, rice bran, and rice residue. A large number of uric acid-lowering peptides are present in the protein hydrolyzates of these by-products.

[0004] Existing related studies have used multi-stage separation technology or single receptor screening to identify uric acid-lowering peptides. The resulting peptides have good uric acid-lowering ability, but these methods are time-consuming and costly, and the resulting uric acid-lowering peptides are often limited to one type of mechanism of action. Summary of the Invention

[0005] The purpose of the present invention is to provide a rice residue short peptide that can intervene in uric acid metabolism at multiple targets to achieve the effect of lowering uric acid.

[0006] The above-mentioned objectives are achieved by the following technical solutions.

[0007] A first aspect of the present invention provides a rice residue short peptide, wherein the amino acid sequence of the rice residue short peptide is any one of SEQ ID NO: 3, SEQ ID NO: 9 and SEQ ID NO: 10.

[0008] In some embodiments, the amino acid sequence of the rice residue short peptide is shown in SEQ ID NO: 3.

[0009] In some embodiments, the amino acid sequence of the rice residue short peptide is shown as SEQ ID NO: 10.

[0010] A second aspect of the present invention provides a use of the rice residue short peptide as described above in the preparation of a preparation for inhibiting uric acid production.

[0011] In some embodiments, the amino acid sequence of the rice residue short peptide is shown as SEQ ID NO.10.

[0012] A third aspect of the present invention provides a use of the rice residue short peptide described above in the preparation of a preparation for promoting uric acid excretion.

[0013] In some embodiments, the amino acid sequence of the rice residue short peptide is shown as SEQ ID NO.3.

[0014] A fourth aspect of the present invention provides a use of the rice residue short peptide as described above in the preparation of a uric acid-lowering drug.

[0015] In some embodiments, the rice residue peptide reduces uric acid levels by inhibiting uric acid production, regulating uric acid reabsorption and excretion, and enhancing the body's antioxidant level.

[0016] In some embodiments, the rice residue peptide reduces uric acid levels by inhibiting XOD activity, regulating the expression of uric acid transporters GLUT9 and OAT1, binding to Keap1 receptors, and inhibiting sodium urate crystallization.

[0017] A fifth aspect of the present invention provides a pharmaceutical composition, the active ingredient of which includes the rice residue short peptide as described above; wherein the dosage form of the pharmaceutical composition can be tablets, capsules, powders, granules, pills, etc.

[0018] The sixth aspect of the present invention provides a preparation for inhibiting uric acid production or promoting uric acid excretion, wherein the active ingredient of the preparation includes the rice residue short peptide as described above; wherein the dosage form of the preparation can be tablets, capsules, powders, granules, pills, etc.

[0019] A seventh aspect of the present invention provides a nutritional preparation composition, wherein the active ingredient of the nutritional preparation composition includes the rice residue short peptide described above.

[0020] The present invention obtains three rice residue short peptides with excellent uric acid-lowering effects, and finds that the three rice residue short peptides can achieve multi-target intervention in multiple links of uric acid metabolism at the same time, have the characteristics of inhibiting uric acid production, promoting uric acid excretion and anti-oxidation (the rice residue short peptide shown in SEQ ID NO.3 has excellent antioxidant activity and performance of promoting uric acid excretion, and the rice residue short peptide shown in SEQ ID NO.10 has excellent performance of inhibiting uric acid production). They can achieve excellent uric acid-lowering effects, and provide a further theoretical basis for the in-depth development of rice processing by-products. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The XOD inhibition rates of the hydrolysate after GI under different material-liquid ratios and the XOD inhibition rates of the three components after ultrafiltration of the hydrolysate at a material-liquid ratio of 1:25; *: p < 0.05, there is a significant difference compared with the control group; **: p < 0.01, there is an extremely significant difference compared with the control group.

[0022] Figure 2 This is an analysis of the antioxidant activity of three components after ultrafiltration of the enzymatic hydrolysate with a material-liquid ratio of 1:25.

[0023] Figure 3 The in vitro XOD inhibition rates and fitted IC values ​​of the positive control allopurinol and five pure peptides are shown in Table 2. 50 .

[0024] Figure 4 This is a graph showing the effects of RPH and RPH (<3kDa) on the uric acid content in the hyperuricemic zebrafish larvae induced by XSS+PO. #: p < 0.05 has a significant difference compared with the blank group, *: p < 0.05 has a significant difference compared with the control group.

[0025] Figure 5 This is a graph showing the effects of five peptides at different concentrations on the uric acid content in zebrafish larvae with high uric acid levels induced by XSS+PO, and a comparison of the uric acid-lowering strength of five peptides from the same batch. #: p < 0.05 shows significant differences compared with the blank group, *: p < 0.05 shows significant differences compared with the control group.

[0026] Figure 6 The five peptides showed significant effects on the uric acid content in the modeling fluid of hyperuricemic zebrafish larvae induced by XSS+PO 1 day after treatment, *: p < 0.05 compared with the control group.

[0027] Figure 7 This is a diagram showing the effects of the three peptides on the expression of HPRT1, a uric acid production gene homologous to zebrafish and humans; #: p < 0.05, there is a significant difference compared with the blank group; *: p < 0.05, there is a significant difference compared with the control group.

[0028] Figure 8 Figure 8 is a graph showing the effect of three peptides on the expression of zebrafish and human homologous uric acid excretion genes GLUT9 and OAT1; #: p<0.05 has a significant difference compared with the blank group, *: p<0.05 has a significant difference compared with the control group.

[0029] Figure 9 Figure 9 is a graph showing the effect of five peptides on superoxide anion clearance rate.

[0030] Figure 10 Figure 10 is a graph showing the effect of No. 117 peptide on ROS clearance in zebrafish. #: p<0.05 has a significant difference compared with the blank group. *: p<0.05 has a significant difference compared with the control group.

[0031] Figure 11 Figure 11 is a graph showing the effect of No. 117 peptide on the activity of antioxidant enzymes in zebrafish. #: p<0.05 has a significant difference compared with the blank group. *: p<0.05 has a significant difference compared with the control group.

[0032] Figure 12 Figure 12 is a graph showing the effect of No. 56 peptide on the activity of ADA and XOD in zebrafish. #: p<0.05 has a significant difference compared with the blank group. *: p<0.05 has a significant difference compared with the control group.

[0033] Figure 13 Figure 13 is a graph showing the effect of rice dreg short peptides on the urea and creatinine contents in zebrafish larvae. #: p<0.05 has a significant difference compared with the blank group, *: p<0.05 has a significant difference compared with the control group.

[0034] Figure 14 Figure 14 is a graph showing the inhibitory effect of rice dreg short peptides on sodium urate crystallization, including a sedimentation effect graph and a 24h supernatant uric acid content change graph.

[0035] Figure 15 Figure 15 is a graph showing the 24h sodium urate crystallization morphology of the sodium urate crystallization system after adding rice dreg short peptides.

[0036] Figure 16 Figure 16 is a graph showing the infrared spectrum of 24h sodium urate crystals of the sodium urate crystallization system after adding rice dreg short peptides.

[0037] Figure 17 Figure 17 is a graph showing the chemical parameters and amino acid sequences of three rice dreg short peptides.

[0038] Figure 18 Figure 18 is a graph showing the molecular docking results of the three peptide sequences best for uric acid generation, uric acid excretion, and antioxidant activity, respectively. DETAILED DESCRIPTION

[0039] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.

[0040] In the following examples, the experimental methods without specific conditions are generally carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0042] The meanings of the English abbreviations in the following embodiments are shown in Table 1.1.

[0043] Table 1.1 English abbreviations

[0044]

[0045] Example 1 Preparation and characterization of rice residue protein hydrolysate

[0046] Experimental methods

[0047] Preparation and enzymatic hydrolysis of rice residue protein

[0048] 1.1 Rice residue protein hydrolysis

[0049] One gram of freeze-dried rice dregs protein (88% crude protein, Zhejiang Hecheng Biotechnology Co., Ltd.) was dispersed in distilled water at dilution ratios of 1:20, 1:25, and 1:30 (g / mL). The solution was stirred at 50°C for 60 minutes to ensure full hydration. The pH of the sample solution was adjusted to 3 with 1 mol / L hydrochloric acid. Pepsin (1:3000) was then added, and the solution was incubated in a 37°C waterbath for 2 hours to maintain a constant pH, simulating gastric digestion. The pH was then adjusted to 7 with 1 mol / mL sodium hydroxide, and pancreatin (1:100) was added. The solution was incubated in a 37°C waterbath for 2 hours to maintain a constant pH, simulating intestinal digestion. Digestion was terminated by placing the sample in a boiling water bath for 10 minutes. The sample was centrifuged at 8000g for 20 minutes, and the supernatant was collected, freeze-dried, and stored at 4°C for further analysis.

[0050] 1.2 Determination of molecular weight distribution of rice residue protein hydrolysate

[0051] The rice residue protein hydrolysate obtained above was used to determine the relative molecular weight distribution of the hydrolyzate using a TSKgel G2000 SWXL (300 nm x 7.8 mm) gel chromatography column. The mobile phase was a mixture of acetonitrile, water, and trifluoroacetic acid in a ratio of 45:55:0.1. Sample testing conditions included an injection volume of 10 μL, a flow rate of 0.5 mL / min, a measurement wavelength of 214 nm, a run time of 30 min, and a sample protein concentration of 4 mg / mL. Protein standards included cytochrome C (12,384 Da), aprotinin (6,511.44 Da), bacitracin (1,423 Da), oxidized glutathione (612.63 Da), Gly-GlyTyr-Arg (451 Da), and Gly-Gly-Gly (189 Da). The standard curve regression equation was then calculated and substituted into the solution.

[0052] 1.3 Ultrafiltration separation of components from rice dregs protein hydrolysate

[0053] The post-GI enzymatic hydrolysate or lyophilized powder solution was passed through the Guxin nanofiltration tangential flow separation system, and 5kDa and 3kDa ultrafiltration membranes were used to intercept and separate the components before and after, respectively. The components >5kDa, 3-5kDa and <3kDa were collected, freeze-dried and stored at 4℃ for further analysis.

[0054] 1.4 Determination of XOD inhibitory activity of hydrolysates and ultrafiltration fractions under different conditions

[0055] Mix 50 μL of sample with 50 μL of XOD (0.05 U / mL) and incubate at 25°C for 5 minutes. Then add 150 μL of the substrate xanthine solution (0.48 mM), mix thoroughly, and incubate at 25°C for 25 minutes. Measure the absorbance at 290 nm using a microplate reader. Prepare PBS reagent: Dissolve 7.16 g of sodium dihydrogen phosphate and 3.12 g of sodium dihydrogen phosphate in 100 mL of distilled water. Mix 81 mL of the sodium dihydrogen phosphate solution with 19 mL of the sodium dihydrogen phosphate solution and adjust the pH to 7.4 to obtain 0.2 mol / L PBS reagent. Fill the blank with PBS.

[0056] Calculation formula:

[0057] XOD inhibition rate (%) = (1-(A1-A2) / (A3-A4)) × 100%

[0058] Wherein: A1: absorbance of sample plus enzyme plus substrate at 290 nm; A2: absorbance of sample plus substrate at 290 nm; A3: absorbance of enzyme plus substrate at 290 nm; A4: absorbance of substrate at 290 nm.

[0059] 1.5 Determination of antioxidant activity of hydrolysates and ultrafiltration fractions under different conditions

[0060] The ABTS clearance rate was tested using the national standard method. 200 mg ABTS and 34.4 mg potassium persulfate were dissolved in 50 mL distilled water and kept at room temperature in the dark for 24 h to obtain the mother solution. When used, it was diluted with 95% ethanol to an absorbance of 0.7 ± 0.02 (OD 734 3.6 mL of ABTS working solution was mixed with 0.4 mL of sample and reacted at room temperature in the dark for 5 min.

[0061] Calculation formula:

[0062] ABTS clearance rate (%) = (A b -A s ) / A b )×100%

[0063] Where: A b Absorbance of distilled water plus ABTS at 734 nm; A s : Absorbance of sample plus ABTS at 734 nm.

[0064] DPPH scavenging rate was determined using the national standard method. Weigh 5.0 mg of DPPH and dilute to 100 mL of anhydrous ethanol to make a 50 μg / mL solution. Mix 1 mL of sample with 3 mL of DPPH solution and incubate at room temperature in the dark for 30 minutes. Measure absorbance at 517 nm, and adjust the sample solvent to zero.

[0065] Calculation formula:

[0066] DPPH clearance rate (%) = (1-(A s -A c ) / A b )×100%

[0067] Where: A b Absorbance of distilled water plus DPPH at 517nm; A s : Absorbance of sample with DPPH at 517nm, A C : The absorbance of the sample added with anhydrous ethanol at 517 nm.

[0068] Superoxide radical scavenging activity was measured using a previously reported method. Luminol buffer solution was prepared by mixing 0.1 mol / L luminol solution with 0.05 mol / L carbonate buffer solution (pH 10.2) in a ratio of 1:9. The sample solution, 1.0 mol / L pyrogallol solution, and luminol buffer solution were then added sequentially to a measuring tube. Finally, the luminescence intensity of the sample solution was measured using a BPCL ultra-weak luminescence meter. A blank sample was prepared in the same manner as above, except that pure water was used instead of the sample solution. Peak luminescence intensity was recorded. Scavenging rate = (blank - sample) / blank.

[0069] 1.6 Results Analysis

[0070] 1.6.1 Analysis of XOD inhibitory activity of GI hydrolysates at different material-liquid ratios

[0071] The enzyme labeling method is a simple and widely used method for determining the XOD inhibition rate. Xanthine reacts with XOD to produce uric acid. The enzyme activity of XOD can be inferred by measuring the content of uric acid. Figure 1 As shown in the figure, it can be seen that the GI hydrolysate has the best XOD inhibition effect when the material-liquid ratio is 1:25, and the 1:25 condition was used for subsequent GI.

[0072] 1.6.2 Analysis of molecular weight distribution of hydrolysates under optimal production conditions

[0073] Table 1.2 Molecular weight distribution of hydrolysate with a feed-liquid ratio of 1:25

[0074] Relative molecular weight / Da Rice residue protein hydrolysate <200 6.66±0.02％ 200-1000 44.45±1.24％ 1000-3000 31.29±0.63％ 3000-5000 9.19±0.18％ 5000-10000 6.67±0.46％ >10000 1.75±0.02％

[0075] The regression equation obtained by calculation of standard products is: y = -4.0816x + 29.1788 (R 2 =0.9629). Where x is the logarithm of the sample molecular weight and y is the retention time (min). The molecular weight distribution of the rice residue protein hydrolysate can be calculated using the equation. As shown in Table 1.2, components <3 kDa account for more than 80% of the hydrolysate, components 3-5 kDa account for 9.19 ± 0.18%, and components >5 kDa account for less than 10%. Based on the production yield, the subsequent separation and purification are into components <3 kDa, 3-5 kDa, and >5 kDa.

[0076] 1.6.3 Analysis of uric acid-lowering activity of different hydrolysate components in vitro

[0077] like Figure 1 As shown in the figure, the fraction <3 kDa has stronger XOD inhibitory activity than the fractions 3-5 kDa and >5 kDa at all concentrations. Therefore, the fraction <3 kDa is more suitable for subsequent experiments.

[0078] When XOD is abnormally activated, it will not only generate a large amount of uric acid but also generate excessive ROS. The accumulation of ROS will cause oxidative stress in the body and even lead to cell apoptosis, thereby providing the body with more endogenous raw materials for uric acid production, further promoting the accumulation of uric acid. Therefore, antioxidant activity can help patients with hyperuricemia control and reduce uric acid. DPPH, ABTS, and superoxide anions are common free radicals, and the scavenging activity of free radicals can reflect the antioxidant strength of the sample. Figure 2As shown, the three components all had good scavenging ability against the three free radicals, indicating that they all had antioxidant activity potential. Combined with the results of XOD inhibition in vitro, the component <3kDa was finally selected for subsequent experiments.

[0079] Example 2 Identification and Simulation Screening of Rice Dregs Protein Hydrolysates

[0080] Experimental methods

[0081] 2.1 LC-MS / MS identification of peptide sequences

[0082] After desalting, the peptide sample was centrifuged and dried, then redissolved in 100 μL of Nano-LC mobile phase A (0.1% formic acid in water) and bottled for online LC-MS analysis. The sample was injected into a nanoViper C18 pre-column (3 μm particles, The sample was desalted on a pre-column and then separated on an analytical column (Acclaim PepMap RSLC, 75 μm × 25 cm, C18, 2 μm, 1 μm). The gradient of mobile phase B (80% acetonitrile, 0.1% formic acid) was gradually increased from 5% to 38% over 60 minutes.

[0083] The mass spectrometer was a ThermoFisher Q Exactive system (Thermo Fisher, USA) equipped with a NanoFlex nanospray ion source (Thermo Fisher, USA). The spray voltage was 1.9 kV, and the ion transfer tube heating temperature was set to 275°C. Data-dependent analysis (DDA) was used for mass spectrometry. The primary mass spectrometer scan resolution was set to 70,000, the scan range was 100–1500 m / z, and the maximum injection time was 100 ms. In each DDA cycle, up to 20 secondary mass spectra were acquired for precursor ions with charge states ranging from 1+ to 3+. The maximum injection time for the secondary mass spectrometer was 50 ms, and the high-energy collision-induced dissociation (HCD) collision energy was set to 28 eV for all precursor ions, with a dynamic exclusion time of 6 s.

[0084] 2.2 Bioinformatics screening of peptide sequences

[0085] PiptideRanker (http: / / distilldeep.ucd.ie / PeptideRanker / ) is a website widely used to predict the activity potential of peptides. It gives a score based on the input peptide sequence comparison database. The score is between 0 and 1, and the predicted activity is proportional to the score value.

[0086] 2.3 Molecular docking screening of uric acid-lowering rice residue short peptides

[0087] Through forward molecular docking with XOD, short peptides targeting rice residue were initially screened for uric acid reduction. The selected peptide sequences were then reversely docked with uric acid excretion receptors and antioxidant receptors. The comprehensive docking results screened out potential multi-target uric acid reduction peptides targeting rice residue.

[0088] The crystal structure of XOD (PDB ID: 3NVZ) was obtained from the Protein Data Bank (PDB, https: / / www.rcsb.org / ). After dehydration and hydrogenation, the ligand was removed and converted into a pdbqt file. The rice residue short peptide structure was mapped and modeled using KingDraw software, followed by semi-flexible molecular docking using Autodock Vina software. The protein sequences of URAT1 and GLUT9 were obtained from the NCBI database. Homology modeling was performed using Swissmodel using the optimal template to obtain the protein 3D structure. The 3D structure of Keap1 (PDB ID: 2FLU) was obtained from the PDB database similarly to XOD. The PDB file was modified by adding hydrogen atoms and removing water molecules, and semi-flexible molecular docking was also performed using Autodock Vina software. Nine optimal positions were identified through docking, and the Vina interaction energy was used as the criterion for predicting the optimal position for peptide binding. Schematic diagrams of the interaction between the optimal binding energy ligand and receptor were drawn using ligplot and pymol.

[0089] 2.4 Bioinformatics prediction of the physicochemical properties of high-potential uric acid-lowering rice residue short peptides (hereinafter referred to as uric acid-lowering peptides)

[0090] ToxinPred (https: / / webs.iiitd.edu.in / raghava / toxinpred / ) can be used to predict peptide properties such as toxicity, molecular weight, and isoelectric point, and admetSAR (http: / / lmmd.ecust.edu.cn / admetsar3 / ) can be used to predict peptide blood-brain penetrance and gastrointestinal absorption.

[0091] 2.5 Results Analysis

[0092] 2.5.1 Identification of peptide sequences in rice residue protein hydrolysates

[0093] According to the Peaks Studio software scoring and the uniprot database search, 2446 peptides were identified from RPH, and the obtained peptide sequences were all rice homologous proteins or polypeptides.

[0094] 2.5.2 Screening of Potentially Bioactive Peptides from Rice Dregs Protein

[0095] The 2446 peptide sequences were placed into the PiptideRanker database for calculation and scoring. Peptide sequences with Ranker values ​​> 0.8 were considered as potential high-bioactive peptides. Finally, there were 119 peptides with Ranker values ​​> 0.8. The peptide sequences were numbered from small to large according to the scores, i.e. peptides 1-119.

[0096] Table 2.1 PeptideRanker Top8 score table

[0097] ID SEQ ID NO: Peptide Score ID SEQ ID NO: Peptide Score 119 1 GGPFVFF 0.983211 115 5 SPPLPFL 0.963825 118 2 FQPMFR 0.978011 114 6 SSLFF 0.961297 117 3 FFAFGR 0.977037 113 7 GWLLPPFA 0.959424 116 4 ALLPFF 0.977022 112 8 GWVGF 0.955818

[0098] 2.5.2 Analysis of forward and reverse molecular docking screening results of uric acid-lowering peptides

[0099] A total of 119 high-potential bioactive peptides were identified. First, 13 peptide sequences with binding energies <-7.5 kcal / mol were screened through forward docking with XOD. These 13 peptide sequences were then reverse docked with the uric acid excretion receptors URAT1 and GLUT9, as well as the antioxidant receptor Keap1, ultimately identifying nine high-potential multi-target uric acid-lowering peptides. The docking scores for all target molecules are shown in Table 2.2.

[0100] Table 2.2 Molecular docking comprehensive binding energy score table

[0101]

[0102]

[0103] The table only shows peptide sequences with docking binding energies less than -7.5 Kcal / mol for all receptors.

[0104] 2.6.3 Bioinformatics Analysis of Physicochemical Properties of Potential Uric Acid-Lowering Peptides

[0105] The basic physicochemical properties of 9 high-potential multi-target uric acid-lowering peptides were calculated using ToxinPred and admetSAR data as shown in Table 2.3, and all 9 peptides were predicted to be non-toxic.

[0106] Table 2.3 Prediction of physicochemical properties of high potential uric acid-lowering peptides

[0107]

[0108] In the table, H+ indicates that the compound has gastrointestinal absorption, and B- indicates that the compound has no blood-brain barrier penetration.

[0109] Example 3 Screening of multi-target uric acid-lowering activity of rice residue short peptides and study of their mechanism

[0110] 3.1 Materials

[0111] 103 synthetic peptide (DSDAGLFGGF), 56 synthetic peptide (FGHPEW), 117 synthetic peptide (FFAFGR), 79 synthetic peptide (FGAPY), 67 synthetic peptide (GVAHWF), 2 synthetic peptide (GSHPFYMDVR), 64 synthetic peptide (PAGVAHWF), 59 synthetic peptide (FNYANW), 36 synthetic peptide (FLPLYI), Sangon Biotech Co., Ltd.

[0112] 3.2 Experimental methods

[0113] 3.2.1 In vitro XOD inhibitory activity and antioxidant activity of uricosuric peptides

[0114] Same as 1.4-1.5

[0115] 3.2.2 Zebrafish culture

[0116] The fish used in this experiment were healthy wild-type zebrafish of the AB strain, purchased from the Hubei Chuangxin Zebrafish Breeding Center. Zebrafish were maintained under the following conditions: Zebrafish were housed in a recirculating aquaculture system, with water purified by reverse osmosis to maintain a pH of 7.0-7.6 and a temperature of 27.5°C-29°C. The photoperiod was 14 hours light and 10 hours dark, and brine shrimp were fed twice daily. Zebrafish embryos were incubated in a 28.5°C incubator. Breeding and egg collection: One hour after dinner, zebrafish were placed in a breeding tank with a 1:1 ratio of male to female, separated by a partition. The tank was filled two-thirds full with water. The partition was removed the following morning, and eggs were collected one hour after spawning. The collected eggs were placed in a Petri dish, free of dead eggs and impurities, rinsed several times with breeding water, and then transferred to a 28.5°C incubator. Eggs were inspected daily, unfertilized and dead eggs removed, and the breeding water replaced. This experiment was performed in accordance with the Guidelines for Laboratory Animal Care of Changsha University of Science and Technology and was approved by the Ethics Committee.

[0117] 3.2.3 Hyperuricemia zebrafish modeling method

[0118] Normally developed 5-dpf juveniles were selected and randomly divided equally into each group. Three parallel wells were set up in each group and placed in a six-well plate, with 40 juveniles per well. The volume of the solution per well was 4 mL. Each culture dish was labeled with the group and treatment method and incubated in a 28.5°C incubator for 24 hours. The blank group received zebrafish culture water; the model group received 200 μM PO + 10 μM XSS; and the positive control group received modeling solution plus 2 mM APL.

[0119] 3.2.4 Acute toxicity study of uricosuric peptide

[0120] Seven concentration gradients of the enzymatic hydrolysate, its components, and each uricosuric peptide were administered: 1000, 500, 200, 100, 50, 20, and 10 μg / mL. Five-day-old zebrafish larvae (50 dpf) were divided into six groups, each with triplicate doses (n=50). Each group was administered with varying concentrations of the enzymatic hydrolysate and uricosuric peptide solutions. After incubation in a 28.5°C incubator for 24 hours, the mortality rate of each group was recorded.

[0121] 3.2.5 Effects of uricosuric peptides on uric acid levels in zebrafish

[0122] The control group, model group and sample group were set up respectively. After the modeling and administration, PBS was added and homogenized. After centrifugation, the tissue supernatant was obtained. The Red Uric Acid / Uricase Assay Kit was used to determine the uric acid content in zebrafish.

[0123] 3.2.6 Effects of uricosuric peptides on uric acid excretion in zebrafish

[0124] A control group, a model group, and a sample group were established. After modeling and drug administration, the modeling fluid was collected for uric acid analysis. Total RNA was extracted from each zebrafish group using a rapid RNA extraction kit. Total RNA concentration and purity were determined by spectrophotometry and agarose gel electrophoresis. 2.0 μg of zebrafish total RNA was synthesized into 10.0 μL of cDNA according to the instructions of the first-strand cDNA synthesis kit. q-PCR was used to analyze the expression of β-actin, HPRT1, GLUT9, and OAT1 genes. β-actin was used as an internal control for gene expression to calculate the relative RNA expression levels of HPRT1, OAT1, and GLUT9. Primer sequences are shown in Table 3.1.

[0125] Table 3.1 Primer sequence information

[0126] Gene SEQ ID NO: Primer sequence 5'-3' β-actin Forward 17 TCGAGCAGGAGATGGGAACC β-actin Reverse 18 CTCGTGGATACCGCAAGATTC HPRT1 Forward 19 CACGCTAACAGGAAAGAACG HPRT1 Reverse 20 GGTGTCCTCTTCACCAGCAA OAT1 Forward 21 GGACGATATCCTGCCAGCTC OAT1 Reverse 22 CGTCCTGTAAGGCCAGATCC GLUT9 Forward 23 AGATCGAACGCAGCATCACA GLUT9 Reverse 24 GCGTCATATTTCGGTTCCAGC

[0127] 3.2.7 Chronic Toxicity Study of Uric Acid-Lowering Peptides

[0128] Given the acute toxicity of uric acid-lowering peptides within one day, the antioxidant model requires a 4-day treatment period. Therefore, a 4-day chronic toxicity test was conducted on the uric acid-lowering peptides and a positive control. Four concentration gradients were set for both GSH and 117 peptide: 100, 40, 20, and 10 μg / mL. Three-day-old zebrafish larvae were divided into two groups, each with three replicates (n=50). The larvae were incubated in a 28.5°C incubator for four days and treated with the various concentrations of the solution. The mortality rate of each group was recorded.

[0129] 3.2.8 Effects of uricosuric peptide on antioxidant levels in zebrafish

[0130] Modeling method of oxidative stress zebrafish model: The juvenile fish (3 dpf, normal development) were randomly divided into 6 groups: Control: blank control group, Model: H2O2 (300 μM), Positive control: GSH (10 μg / mL) + H2O2 (300 μM), high concentration of 117 peptide: 117 (40 μg / mL) + H2O2 (300 μM), medium concentration of 117 peptide: 117 (20 μg / mL) + H2O2 (300 μM), low concentration of 117 peptide: 117 (10 μg / mL) + H2O2 (300 μM), and treated for 4 days.

[0131] Control, model, and sample groups were set up, each receiving the corresponding modeling solution. After incubation for 4 days, the activities of the antioxidant enzymes CAT, SOD, and GSH-px in zebrafish larvae were measured using a Solebold enzyme activity assay kit. ROS levels in the larvae were assessed using a Nanjing Jiancheng ROS detection kit. The larvae were washed three times with hatching water, then incubated with 1 mL of 10 μmol / L DCFH-DA detection solution at 28.5°C for 30 minutes. After washing three times with hatching water, the larvae were observed using a Zeiss stereo microscope.

[0132] 3.2.9 Effects of uricosuric peptide on zebrafish renal function

[0133] A control group, a model group, and a sample group were set up respectively. The corresponding modeling solution was added and cultured for 1 day. The creatinine and urea nitrogen levels in zebra larvae were determined using the Nanjing Jiancheng kit and the urea nitrogen kit.

[0134] 3.2.10 Effects of uricosuric peptides on ADA and XOD activities in zebrafish

[0135] A control group, a model group, and a sample group were set up respectively, and the corresponding modeling solution was added and cultured for 1 day. The activity of ADA and XOD in zebrafish larvae was determined using Nanjing Jiancheng ADA and XOD kits.

[0136] 3.2.11 Effects of uricosuric peptides on uric acid crystallization

[0137] First, solutions A and B were prepared in a 37°C water bath: 7.5 mL of solution A consisting of 11.73 mM uric acid dissolved in 15 mM NaOH, and 2.5 mL of solution B consisting of 660 mM NaCl. The pH of these solutions was adjusted to 7.4 with 1 M HCl or 1 M NaOH. Mixing solutions A and B allowed MSUM crystals to crystallize at 37°C. To investigate the effect of uricosuric peptides on sodium urate crystallization, a 100 μg / mL solution of uricosuric peptides was used. For the sodium urate system in the early reaction stage, the supernatant was measured for urate concentration using a UV spectrophotometer. For the sodium urate system after 24 hours of crystallization, the sodium urate precipitate was collected by centrifugation at 10,000 rpm for 5 minutes and washed three times with pure water. The crystals were then dried in a vacuum oven at 37°C for 24 hours. The dried crystals were directly observed for morphology and then pulverized to obtain MSUM powder for infrared characterization.

[0138] 3.2.12 Molecular Structure and Molecular Simulation of Multi-target Uric Acid-lowering Peptides to Explain Their Uric Acid-lowering Mechanism

[0139] The molecular structure of the uric acid-lowering peptide was drawn by KingDraw, and the molecular docking results were analyzed in the same way as those obtained by the previous Autodock Vina screening.

[0140] 3.3 Results and Discussion

[0141] 3.3.1 In vitro XOD inhibitory activity and antioxidant activity of uricosuric peptides

[0142] like Figure 3 As shown in Table 3.2, among the nine high-potential multi-target uric acid-lowering peptides screened by molecular docking, five had in vitro IC50 values ​​for XOD < 2000 μg / mL. The top three peptide sequences for in vitro XOD inhibitory activity were 103, 56, and 117, respectively. These five uric acid-lowering peptides consist of 5-10 amino acids with molecular weights between 500 and 1000, suggesting that smaller molecular weight peptides may be more beneficial for uric acid lowering.

[0143] Table 3.2 IC50 of uricosuric peptides against xanthine oxidase

[0144] name Fitting optimal IC50 (μg / mL) IC50 range (μg / mL) APL 133.8 124.0-143.5 56 476.3 451.6-502.4 67 1053.0 958.5-1156 79 705.8 664.2-750.1 103 200.5 186.7-214.3 117 673.8 631.3-719.3

[0145] Superoxide anion is an important byproduct in the production of uric acid and is also the main cause of subsequent oxidative stress. The antioxidant activity of 5 XOD inhibitory peptides was reflected by detecting their superoxide anion free radical scavenging activity. Figure 9 As shown in the figure, except for peptide 79, four of the five XOD inhibitory peptides exhibited some superoxide anion scavenging activity, suggesting that these four peptides have the potential to lower uric acid through multiple targets. Peptide 117 exhibited the highest free radical scavenging activity and was therefore selected for subsequent antioxidant studies.

[0146] 3.3.2 Toxicity Analysis of Uric Acid-Lowering Peptides

[0147] As shown in Table 3.3, the experimental results show that the concentrations and doses selected for the <3 kDa hydrolysate were 500, 200, and 100 μg / mL; the concentrations and doses selected for the complete hydrolysate were 200, 100, and 50 μg / mL; the concentrations and doses selected for peptides 56, 67, and 117 were 100, 50, and 20 μg / mL; and the concentrations and doses selected for peptides 79 and 103 were 50, 20, and 10 μg / mL. At these concentrations, the corresponding samples showed no toxic effects.

[0148] Table 3.3 Acute toxicity of enzymatic hydrolysates and uricosuric peptides to 5dpf zebrafish over 1 day

[0149]

[0150] As shown in Table 3.4, the experimental results show that the concentration dosage groups selected for peptide 117 are 40, 20, and 10 μg / mL, and the concentration dosage group selected for GSH is 10 μg / mL.

[0151] Table 3.4 Chronic toxicity of GSH and peptide 117 to 3dpf zebrafish over 4 days

[0152]

[0153] 3.3.3 Analysis of the uric acid-lowering effect of uricosuric peptides in vivo

[0154] Depend on Figure 4 and Figure 5 As shown, uric acid production increased in the model group after PO and XSS treatment. Compared with the model group, uric acid content in zebrafish was significantly reduced after treatment with the enzymatic hydrolysate and its fractions, as well as peptides 56, 67, 79, 103, and 117. With the exception of peptide 67, the other four peptides showed concentration-dependent effects in the corresponding dose groups. Subsequently, the optimal uric acid-lowering concentrations of the five peptides were compared in the same experiment. The strongest uric acid-lowering effect in vivo was found to be peptide 56, and the maximum uric acid-lowering effect of peptides 56 and 117 was 100 μg / mL, indicating their enhanced biocompatibility.

[0155] HPRT1 low expression will lead to excessive purine being broken down into uric acid and excreted from cells, which is one of the reasons for the increase in blood uric acid concentration. qRT-PCR is a commonly used method for quantitative detection of mRNA expression. Figure 7 It can be seen that the expression of HPRT1 gene in the model group was significantly decreased after PO and XSS treatment; compared with the model group, the expression of HPRT1 gene was significantly increased after treatment with the optimal concentrations of peptides 56, 103, and 117.

[0156] 3.3.4 Analysis of the uric acid excretion-promoting ability of uricosuric peptides

[0157] Depend on Figure 6 The experimental results show that peptides 56, 103, and 117 can significantly promote uric acid excretion in hyperuricemic zebrafish. Based on this, the peptide sequences that simultaneously have uric acid-lowering, uric acid-promoting, and antioxidant activities are determined to be peptides 56, 103, and 117, which means that peptides 56, 103, and 117 are preliminarily considered to be multi-target uric acid-lowering peptides.

[0158] GLUT9 is a transporter involved in the reabsorption of urate by the renal tubules, allowing urate to be reabsorbed from the renal tubular cell membrane back into the blood; while OAT1 is a transporter for uric acid excretion, and its function is to absorb uric acid from the blood into the renal tubular cells. Figure 8 The experimental results showed that after PO and XSS treatment in the model group, OAT1 gene expression was significantly reduced, while GLUT9 gene expression was significantly increased. Compared with the model group, peptides 56, 103, and 117 all significantly reduced GLUT9 expression after treatment, while peptides 56 and 117 increased OAT1 expression. Therefore, all three peptides can reduce uric acid content in zebrafish by promoting uric acid excretion. Combining all previous results, it can be concluded that peptide 56 has the strongest inhibitory effect on uric acid production, while peptide 117 has the strongest antioxidant and uric acid excretion-promoting effects. Further research will be conducted on these two peptides.

[0159] 3.3.5 Effects of uricosuric peptide on antioxidant activity in zebrafish

[0160] DCFH-DA itself is non-fluorescent and can freely cross the cell membrane. Once inside the cell, it is hydrolyzed by the cell's esterases into DCFH (Dichlorofluorescin). DCFH cannot penetrate the cell membrane, making it easy for the probe to be labeled inside the cell. In the presence of reactive oxygen species within the cell, DCFH is oxidized into a strong green fluorescent substance.

[0161] Depend on Figure 10 It can be seen that the amount of ROS generated increased after H2O2 treatment; compared with the H2O2 group, the amount of ROS generated decreased after treatment with peptide 117 and GSH; compared with GSH, peptide 117 significantly inhibited ROS secretion. Figure 11 It can be seen that the antioxidant enzyme activity decreased after H2O2 treatment; compared with the H2O2 group, the three enzyme activities were significantly restored after treatment with peptide 117, indicating that peptide 117 in the high concentration group can improve the body's antioxidant enzyme activity.

[0162] 3.3.6 Effects of uricosuric peptides on uricase activity in zebrafish

[0163] like Figure 12It can be seen that the ADA and XOD enzyme activities in the model group were significantly increased after PO and XSS treatment; compared with the model group, 20-100 μg / mL of peptide 56 could reduce the enzyme activity, but only at 100 μg / mL could peptide 56 significantly reduce the ADA enzyme activity, and at 50-100 μg / mL could peptide 56 significantly reduce the XOD enzyme activity.

[0164] 3.3.7 Effects of uricosuric peptide on renal function in zebrafish

[0165] Creatinine, blood urea nitrogen (BUN), and creatinine (Cr) are commonly used as important indicators of kidney health. Cr is a metabolite of creatine and creatine phosphate, indirectly reflecting glomerular filtration. BUN is a major product of protein metabolism, and its level is affected by protein intake, metabolic levels, and liver function.

[0166] Depend on Figure 13 As shown, after PO and XSS treatment in the model group, Cr and BUN levels in the zebrafish tissue fluid increased; compared with the model group, Cr and BUN levels decreased after treatment with peptides 56, 103, and 117. All three peptides significantly reduced Cr levels in the tissue fluid of juvenile fish; compared with peptides 56 and 103, 117 also significantly reduced BUN levels. Therefore, all three multi-target uric acid-lowering peptides can improve renal function damage caused by uric acid accumulation.

[0167] 3.3.8 Effects of uricosuric peptides on uric acid crystallization

[0168] When uric acid accumulates to a certain level in the human body, it forms needle-shaped monohydrated sodium urate crystals. Deposition of these crystals in joints and tissue fluid can cause gouty arthritis, while deposition in the kidneys can lead to uric acid nephritis and stones. Deposition in blood vessels can lead to atherosclerosis, increasing the risk of hypertension, heart disease, and stroke. Therefore, directly inhibiting the growth of pathological uric acid crystals is also of great clinical significance.

[0169] Depend on Figure 14 It can be seen that white precipitate began to precipitate at 2 hours in the blank group, which is its nucleation induction time. Compared with the blank group, the nucleation induction time was delayed to 4 hours after the addition of peptides 56 and 103, while the nucleation induction time was extended to 6 hours after the addition of peptide 117. At 12 hours, except for the group with peptide 117, the urate content in the supernatant had completed nucleation and reached the lowest level. At 24 hours, the urate in the supernatant of all groups had completed nucleation.

[0170] Depend on Figure 15 It can be seen that the morphology of the dried crystals separated after 24 hours is different under the microscope. The crystals generated by the blank group are obviously more slender at the same scale, while the growth of sodium urate crystals is from short to long, which indicates that the addition of peptides inhibits the growth of crystals. Figure 16The infrared data showed that the addition of peptides slowed down the crystal growth without changing the structural composition of the crystals.

[0171] Therefore, peptide No. 117 is most capable of significantly inhibiting the rate of uric acid crystal formation and has good potential to inhibit the formation of MSUM.

[0172] 3.3.9 Analysis of molecular simulation results of multi-target uric acid-lowering peptides and multiple receptors

[0173] From Table 3.5 and Figure 17 It can be seen that the multi-target uric acid-lowering peptides are mainly bound to each key target through hydrogen bonds and hydrophobic forces. Combined with all previous data, it shows that peptide No. 56 has the strongest XOD inhibitory activity, and peptide No. 117 has the strongest uric acid excretion promotion and antioxidant activity. Therefore, residues such as Asn650, Gln1122, and Asp1115 in the table may be important active sites of XOD, residues such as Ala368, Gly202, and Phe451 may be important active sites of GLUT9, and residues such as Asp389 and Ser431 may be important active sites of Keap1. Figure 18 This is an example diagram of molecular docking between each verified target and the most active uric acid-lowering peptide.

[0174] Table 3.5 Docking interaction forces between multi-target uric acid-lowering peptides and receptor molecules

[0175]

[0176] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0177] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A rice residue short peptide, characterized in that The amino acid sequence of the rice residue short peptide is any one of SEQ ID NO: 3, SEQ ID NO: 9 and SEQ ID NO:

10.

2. The rice residue short peptide according to claim 1, wherein The amino acid sequence of the rice residue short peptide is shown in SEQ ID NO:

3.

3. The rice residue short peptide according to claim 1, wherein The amino acid sequence of the rice residue short peptide is shown in SEQ ID NO:

10.

4. Use of the rice residue short peptide according to any one of claims 1 to 3 in the preparation of a preparation for inhibiting uric acid production.

5. The use according to claim 4, wherein the amino acid sequence of the rice residue short peptide is shown in SEQ ID NO:

10.

6. Use of the rice residue short peptide according to any one of claims 1 to 3 in the preparation of a preparation for promoting uric acid excretion.

7. The use according to claim 6, wherein the amino acid sequence of the rice residue short peptide is shown in SEQ ID NO:

3.

8. Use of the rice residue short peptide according to any one of claims 1 to 3 in the preparation of uric acid-lowering drugs.

9. A pharmaceutical composition, characterized in that The active ingredient of the pharmaceutical composition comprises the rice residue short peptide according to any one of claims 1 to 3.

10. A preparation for inhibiting uric acid production or promoting uric acid excretion, characterized in that: The active ingredient of the preparation comprises the rice residue short peptide according to any one of claims 1 to 3.

Images