Cell strain causing pathogenic splicing mutation of female HA patient, construction method and application
The F8c.602-1G>T point mutant cell line was constructed in human liver stellate cells through CRISPR/Cas9 gene editing technology, which solved the research and treatment problems of female hemophilia A, enriched the gene mutation database, and provided accurate treatment strategies.
Patent Information
- Application Number
- CN202510497410.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-21
- Publication Date
- 2025-07-22
AI Technical Summary
The prior art is difficult to effectively study and treat female hemophilia A caused by F8 gene splicing mutations, and there is a lack of accurate genetic research and treatment strategies.
Using CRISPR/Cas9 gene editing technology, the F8c.602-1G>T point mutant cell line was constructed in human liver stellate cells by designing sgRNA sequences and homologous directed repair of HDR, so as to achieve genome editing and stable cell line acquisition.
The F8 gene mutation database has been enriched, the precise treatment strategy for female hemophilia A is provided, and a model of pathogenic splicing mutations has been constructed, providing guidance for gene therapy.
Smart Images

Figure CN120349972A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of cell engineering technology, and specifically relates to a cell line, a construction method and an application thereof that cause a pathogenic splicing mutation in female HA patients. Background Art
[0002] Haemophilia A (HA) is one of the most common monogenic genetic diseases caused by defects in the F8 (Factor 8) gene. This defect leads to impaired synthesis or abnormal molecular structure of Factor 8 in the body, thereby causing a reduction or complete absence of coagulation factor F8. Due to the X-linked recessive inheritance of haemophilia, women rarely show symptoms of haemophilia. The most common pathogenesis of female haemophilia is the combination of F8 gene mutation and skewed X chromosome inactivation. More rarely, homozygous or compound heterozygous mutations of the F8 gene and abnormalities in chromosome number or structure can also cause female haemophilia.
[0003] The most common abnormality associated with HA is the inversion of intron 1 or 22. Other HA cases are caused by various point mutations distributed throughout the gene, including missense, nonsense, splicing site, frameshift mutations and severe deletions. According to relevant statistics, point mutations affecting splicing sites account for about 10% of the reported F8 gene mutations. mRNA splicing is crucial for protein translation, and recent studies have emphasized the abundance and importance of splicing mutations in the etiology of genetic diseases.
[0004] Therefore, targeted genetic research on F8 gene splicing mutations in female haemophilia has potential clinical significance for genetic counseling and individualized treatment of haemophilia patients. Summary of the Invention
[0005] The purpose of the present invention is to provide a cell line, a construction method and an application thereof that cause a pathogenic splicing mutation in female HA patients, so as to enrich the F8 gene mutation database and provide a new strategy for the precise treatment of HA in the future.
[0006] In the first aspect of the present invention, a cell line that causes a pathogenic splicing mutation in female HA patients is provided, which is an F8 c.602-1G>T point mutation cell line.
[0007] In the second aspect of the present invention, a construction method of a cell line that causes a pathogenic splicing mutation in female HA patients is provided. The construction method of the F8 c.602-1G>T point mutation cell line is specifically as follows:
[0008] S1. Design several sgRNA sequences based on the mutation site of the target gene F8;
[0009] S2. Based on several sgRNA sequences and the CRISPR / Cas9 gene editing technology, construct several pX458-sgRNA plasmids respectively using the pX458 plasmid as a vector;
[0010] S3. Based on the selected sgRNA sequence and the pX458-sgRNA plasmid, construct the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid using the pMD-18T-pGK-puro-mcherry plasmid as a vector;
[0011] S4. Transfect the pX458-sgRNA plasmid and the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid in step S3 into cells simultaneously, and obtain a stable cell line through drug screening.
[0012] 4. Preferably, in step S2, use liposomes to transfect the pX458-sgRNA plasmid into human hepatic stellate cells, and verify whether the target gene is successfully cleaved by T7e1 enzyme. The condition for successful cleavage is that the PCR product can be cut into two fragments;
[0013] In addition, the selected pX458-sgRNA plasmid in step S3 must be successfully cleaved.
[0014] Preferably, 2 sgRNA sequences were designed in step S1, namely F8-sgRNA1 and F8-sgRNA2. The forward and reverse sequences of the 2 sgRNA sequences are respectively:
[0015] The forward sequence of F8-sgRNA1 is: 5’-CACCGtgtaggaaattgtcactagg-3’, and the reverse sequence is: 5’-AAACcctagtgacaatttcctacaC-3’;
[0016] The forward sequence of F8-sgRNA2 is: 5’-CACCGcattgtaggaaattgtcact-3’, and the reverse sequence is: 5’-AAACagtgacaatttcctacaatgC-3’.
[0017] Preferably, step S3 is specifically:
[0018] S31. Design left and right homologous arms according to the position of the selected sgRNA sequence;
[0019] S32. Design left and right homologous arm primers according to the position of the selected sgRNA sequence and the position of the point mutation;
[0020] S33. Use the DNA of the patient with splicing mutation as a template to PCR amplify the left and right homologous arms;
[0021] S34. Gel extraction of the PCR products of the left and right homologous arms. The PCR product of the right homologous arm is F8-RA, and the PCR product of the left homologous arm is F8-LA;
[0022] S35. Ligate and transform the pMD-18T-pGK-puro-mcherry plasmid with F8-RA, and obtain the pMD-18T-pGK-puro-mcherry-RA plasmid after sequencing by BGI;
[0023] S36. Ligate and transform the pMD-18T-pGK-puro-mcherry-RA plasmid with F8-LA, and obtain the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid after sequencing by BGI.
[0024] Preferably, the base sequence of the right homologous arm designed based on the position of the selected sgRNA sequence is shown in SEQ ID NO:1, and the base sequence of the left homologous arm designed based on the position of the selected sgRNA sequence is shown in SEQ ID NO:2.
[0025] Preferably, the upstream primer of the right homologous arm designed based on the position of the selected sgRNA sequence and the position of the point mutation is: 5’-gcgGGATCCgtgacaatttcctacaatgag-3’, and the downstream primer is: 5’-agcGGTACCtttaggaaaccgagacaca-3’; the upstream primer of the left homologous arm designed based on the position of the selected sgRNA sequence and the position of the point mutation is: 5’-gcgGTCGACgccaacaagctcaacagtt-3’, and the downstream primer is: 5’-ataGCGGCCGCtaggaggagacagttcttcat-3’.
[0026] Preferably, in step S4, the pX458-sgRNA plasmid and the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid are co-transfected into human hepatic stellate cells by liposome transfection; in addition, the drug screening is antibiotic screening, and the resistance drug is puromycin.
[0027] Preferably, before transfection in step S4, human hepatic stellate cells need to be resuscitated, cultured, and the drug screening concentration determined. The drug screening concentration determined for the LX-2 cell line is 1 μg / ml.
[0028] The third aspect of the present invention provides the use of a cell line with a pathogenic splicing mutation causing female HA patients or a cell line with a pathogenic splicing mutation obtained by the construction method of a cell line with a pathogenic splicing mutation causing female HA patients in the prevention, early diagnosis or treatment of hemophilia in women.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] 1. The present invention constructs a novel splicing mutation c.602-1G>T point mutation model on the genome of human hepatic stellate cells expressing F8 protein by using the gene editing technology of CRISPR / Cas9 and homologous directed repair HDR. It not only provides a model for the study of the pathogenic mechanism of splicing mutations, the formation of inhibitors and gene therapy mediated by CRISPR / Cas9 gene editing technology, but also provides guidance for the precise treatment of the proband.
[0031] 2. The discovery of a novel pathogenic splicing mutation in the present invention not only enriches the F8 gene mutation database, but also provides a new strategy for the precise treatment of female HA patients in the future. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0033] Figure 1 It is the structural diagram of the pX458 plasmid in the present invention;
[0034] Figure 2 It is the position expression diagram of two designed sgRNA sequences in the F8 gene in the present invention;
[0035] Figure 3 It is the sequencing identification diagram of the successfully constructed pX458-sgRNA1 plasmid in the present invention;
[0036] Figure 4 It is the sequencing identification diagram of the successfully constructed pX458-sgRNA2 plasmid in the present invention;
[0037] Figure 5 It is the T7e1 enzyme digestion verification gel electrophoresis diagram in the present invention;
[0038] Figure 6 It is the structural diagram of the pMD-18T-pGK-puro-mcherry plasmid in the present invention;
[0039] Figure 7Sequencing diagram of the pMD-18T-pGK-puro-mcherry-RA plasmid in the present invention;
[0040] Figure 8 Sequencing diagram of the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid in the present invention;
[0041] Figure 9 Structural diagram of the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid in the present invention;
[0042] Figure 10 Diagram of monoclonal cell clusters of LX-2 drug screening in the present invention;
[0043] Figure 11 Gel electrophoresis identification diagram of the cell line screened in the present invention;
[0044] Figure 12 Sequencing diagram of the F8 c.602-1G>T point mutation cell line in the present invention, where Figure 12 a is the sequencing diagram before mutation of the mutant cell line, that is, the sequencing diagram of the wild cell line; Figure 12 b is the sequencing diagram after mutation of the mutant cell line;
[0045] Figure 13 Results of molecular genetic examinations of the proband and his / her family in the present invention, where Figure 13 A is the pedigree map information of the proband, Figure 13 B is the X chromosome inactivation analysis of the proband, Figure 13 C is the splicing prediction of the pathogenic mutation c.602-1G>T of the F8 gene from the RDDC database, Figure 13 D is the Sanger sequencing result of c.602-1G>T, Figure 13 E is the X chromosome inactivation pattern of female members of the proband's family, Figure 13 F is the laboratory test results of the proband and his / her family. Detailed implementation manners
[0046] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0047] The present invention provides a cell line with a pathogenic splicing mutation that causes female HA patients, which is the F8 c.602-1G>T point mutation cell line.
[0048] AsFigure 12 The sequencing map of the F8 c.602-1G>T point mutation cell line provided, where Figure 12 a is the sequencing map before the mutation of the cell line, that is, the sequencing map of the wild cell line, Figure 12 The base sequence listed in a is the base sequence before the mutation, and the area indicated by the arrow is the area to be mutated; Figure 12 b is the sequencing map after the mutation of the cell line, Figure 12 The base sequence listed in b is the successfully mutated base sequence, and the area indicated by the arrow is the mutated area.
[0049] In this application, the proband is a female hemophilia patient, a 9-month-old girl, who sought medical treatment due to a hematoma after hitting her head. Examination found that APTT was prolonged and the activity of factor VIII was <1%, and she was diagnosed with severe HA. She reported that she was prone to purpura after hitting, and there was no family history of abnormal bleeding. Whole exome sequencing found a new pathogenic splicing mutation F8 c.602-1G>T. Genetic analysis showed that the mutation was inherited from her mother and grandmother. Genetic linkage analysis and X chromosome inactivation analysis showed that the X chromosome derived from her father had extreme skewed inactivation, and the X chromosome inactivation rate was 94%. There was no history of abnormal bleeding in the family members of the patient. The c.602-1G>T mutation is a new mutation not reported at present, and pathogenicity prediction shows that this mutation is pathogenic (Mutation taster score: 1.0 disease causing). Prediction from the RDDC database shows that the abnormal splicing of this mutation may cause exon 5 to be deleted, resulting in the phenotype of hemophilia.
[0050] The subject has signed the informed consent form, and this study has been approved by the Ethics Committee of the Second Hospital of Shanxi Medical University.
[0051] The results of molecular genetics examination of the proband and the family in this application are as Figure 13 shown. Figure 13 A is the pedigree map information of the proband. From Figure 13 A, it can be seen that the proband (6.5) carries the pathogenic heterozygous mutation c.602-1G>T of the F8 gene, and the mother and grandmother of the proband are carriers of the pathogenic mutation c.602-1G>T of the F8 gene. In this application, 8 X-linked short tandem repeat (STR) markers are used for genetic linkage analysis.
[0052] Figure 13 B is the X chromosome inactivation analysis of the proband, Figure 13 In B, (1) and (2) are the peak maps of the HUMARA gene locus (274bp and 280bp) of the PCR products before and after digestion with HpaII enzyme of the proband.
[0053] Figure 13C is the splicing prediction of the pathogenic mutation c.602-1G>T of the F8 gene from the RDDC database.
[0054] Figure 13 D is the Sanger sequencing result of c.602-1G>T. Figure 13 In D, (1)-(5) are the Sanger sequencing results of the proband, the proband's mother, the proband's maternal grandmother, the proband's father, and the proband's maternal grandfather, respectively. The nucleotide indicated by the arrow in the figure represents the position of the mutation.
[0055] Figure 13 E is the X chromosome inactivation pattern of the female members of the proband's family, showing non-random inactivation of the X chromosome inherited from the father by the proband.
[0056] In this application, the main reagents and main instrument equipment used are shown in Table 1 and Table 2.
[0057] Table 1 Main Reagents
[0058]
[0059] Table 2 Main Instrument Equipment
[0060]
[0061] Example 1. Construction of pX458-sgRNA Plasmid
[0062] 1. Design of sgRNA and Synthesis
[0063] 1) Download the F8 gene sequence in Homo sapiens on the NCBI website, and determine the specific sequence to be edited according to the mutation site of the patient.
[0064] 2) Enter the F8 gene sequence containing the mutation site on the CRISPOR website to design sgRNA.
[0065] In this application, 2 sgRNA sequences closer to the mutation site were selected according to the score, namely F8-sgRNA1 and F8-sgRNA2. The positions of the 2 sgRNA sequences designed in this application in the F8 gene are as Figure 2 shown, and the sgRNA is on the upstream intron of the mutation site.
[0066] The website of NCBI is https: / / www.ncbi.nlm.nih.gov / , and the website of CRISPOR is http: / / crispor.tefor.net / .
[0067] 3) The selected forward and reverse sequences of sgRNA were sent to BGI for synthesis. The pX458 plasmid was digested with BpiI to form sticky ends for ligating sgRNA. The forward and reverse sequences of sgRNA are shown in Table 3.
[0068] Table 3 sgRNA Sequences
[0069]
[0070] Note: F, forward primer, forward sequence; R, reverse primer, reverse sequence
[0071] 2. Construct pX458-sgRNA1 plasmid and pX458-sgRNA2 plasmid
[0072] In this application, the specific steps for constructing pX458-sgRNA1 plasmid / pX458-sgRNA2 plasmid are as follows:
[0073] 1) The pX458 plasmid was digested with the restriction endonuclease BpiI. The digestion products were separated on a 1% agarose gel in 1×TAE electrophoresis buffer at a voltage of 110V for 30 min. The digestion reaction conditions were: 37°C for 1 h. The digestion reaction system is shown in Table 4.
[0074] Table 4 Digestion Reaction System
[0075]
[0076] As Figure 1 shown, the pX458 vector used in this application is also called pSpCas9(BB)-2A-GFP, with a size of 9288 bp. It is a plasmid that can transcribe and express CRISPR protein in cells. The replicons are ori and f1 ori, and it has Ampicillin resistance, can be transformed into the corresponding host, and replicate and amplify in large quantities. The culture conditions are LB, 37°C. Behind the U6 promoter of the pX458 vector is the gRNA scaffold sequence, and double digestion with BpiI can insert sgRNA between the U6 promoter and the gRNA scaffold.
[0077] 2) Gel extraction of the pX458 digestion products
[0078] In the examples of this application, a Sangon EZ-10 Gel Extraction Kit was used for gel extraction, and the specific steps were operated according to the instructions.
[0079] (3) sgRNA annealing: Anneal the oligonucleotide strands to form double-stranded DNA. The annealing program of the PCR instrument is as follows: 95°C for 5 min, the temperature drops by 0.1 every 8 s until 25°C (or wrap it for 20 min to cool to room temperature after taking it out of the PCR instrument), and store it at 4°C for later use. The annealing reaction system is shown in Table 5.
[0080] Table 5 Annealing reaction system
[0081]
[0082] 4) Linear ligation of the sgRNA double strand and the pX458 enzyme-digested and gel-extracted product. The reaction conditions are: 22°C, 30 min. The linear ligation reaction system is shown in Table 6.
[0083] Table 6 Linear ligation reaction system
[0084]
[0085] 5) Transformation of the ligation product: Transform the ligation product into E. coli competent cells. Specifically:
[0086] ① Take out the DH5α competent cells from the -80°C refrigerator and quickly insert them into ice to melt them;
[0087] ② Pipette 50 μL of competent cells into a sterile EP tube and add 5 μL of the DMT enzyme digestion product;
[0088] ③ After heat shock in a 42°C water bath for 90 s, immediately place it on ice for 3 min;
[0089] ④ Add 800 μL of LB medium, 200 rpm, 37°C for 1 hour;
[0090] ⑤ Centrifuge at 4000 rpm for 1 min, discard the supernatant medium, and resuspend the remaining 50 μL of bacterial solution by pipetting. Spread it evenly on an agar plate with ampicillin (Amp) resistance and incubate overnight at 37°C;
[0091] ⑥ Pick a single colony from the agar culture plate and inoculate it into 800 μL of LB medium containing ampicillin, 200 rpm, 37°C for 2 hours;
[0092] ⑦ Pipette 100 μL of the bacterial solution and send it to BGI in Beijing for sequencing. Add 300 μL of 80% sterile glycerol to the remaining 700 μL of bacterial solution and store it at -20°C for subsequent plasmid extraction.
[0093] 6) Plasmid extraction: Use the Omega plasmid mini-prep kit to extract the FVIII mutant plasmid. The specific steps are detailed in the instruction manual. Then, use a NanoDrop micro-spectrophotometer to detect the concentration and OD value of the obtained DNA solution. After passing the detection, store the DNA product at -20°C.
[0094] In this application, the qualified standards for detecting the concentration and OD value of the obtained DNA solution using a NanoDrop micro-spectrophotometer are as follows: the concentration of the DNA solution > 10 ng / μl, and OD260 / OD280 is between 1.7 and 1.9.
[0095] The present invention successfully constructed pX458-sgRNA1 plasmid and pX458-sgRNA2 plasmid. The sequencing identification of the successfully constructed pX458-sgRNA1 plasmid is as Figure 3 shown, and the sequencing identification of the successfully constructed pX458-sgRNA2 plasmid is as Figure 4 shown. As Figure 3-4 shown, the U6 promoter is followed by the gRNA scaffold, whose main function is to connect the gRNA and the Cas9 protein. After double digestion with BpiI, both sgRNA1 and sgRNA2 were successfully inserted between the U6 promoter and the gRNA scaffold.
[0096] Example 2. Verification of sgRNA cleavage efficiency
[0097] 1) Cell resuscitation and culture of human hepatic stellate cells (LX-2 cell line)
[0098] ① Take out 1 tube of LX-2 cells from the liquid nitrogen tank, place it in a 37 °C water bath, shake quickly until the cell solution in the cryopreservation tube is completely melted, and centrifuge at 800 r / min for 5 min at room temperature;
[0099] ② Discard the supernatant, add 1 ml of DMEM high-glucose medium containing 1% double antibody + 10% fetal bovine serum to the cryopreservation tube, gently pipette to make a cell suspension, transfer the cell suspension to a 25T culture flask containing 4 ml of DMEM high-glucose medium containing 1% double antibody + 10% fetal bovine serum, observe the cell morphology under a microscope, and record the resuscitation date and cell type;
[0100] ③ Place the above-mentioned resuscitated lx-2 cells in an incubator at 37 °C and 5% CO2 for culture. When the cell density ratio is greater than 80%, they can be digested with 0.25% trypsin containing EDTA and passaged at a ratio of 1:2.
[0101] 2) Cell transfection
[0102] Use liposomes to transfect pX458-sgRNA1 plasmid and pX458-sgRNA2 plasmid into human hepatic stellate cells respectively.
[0103] 3) Genomic DNA extraction
[0104] After 48 hours of transfection, the cells showing green fluorescence under the microscope were the successfully transfected cells. Wash and digest the LX-2 cell line, and extract DNA using the omega tissue DNA extraction kit according to the instructions.
[0105] 4) Verification of the cleavage efficiency by T7e1 enzyme
[0106] ① Design primers according to the cleavage sites of the F8 gene by F8-sgRNA1 / F8-sgRNA2. The upstream and downstream primers are shown in Table 1-7.
[0107] Table 7 Primers for T7e1 enzyme digestion verification
[0108]
[0109] ② PCR amplify the DNA fragment containing the cleavage site of the F8 gene. The PCR reaction conditions are: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing at 56°C for 20 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min. The PCR reaction system is shown in Table 8.
[0110] Table 8 PCR reaction system
[0111]
[0112] ③ Recover and purify the PCR product by gel extraction. Use the Sangon EZ-10 Gel Extraction Kit for gel extraction, and operate according to the instructions.
[0113] ④ Perform an annealing reaction on the gel-extracted and purified fragment. The annealing reaction conditions are: 95°C for 5 min, temperature decreasing by 0.1 every 8 s until 25°C (or wrap it for 20 min to cool to room temperature after taking it out of the PCR instrument), and store at 4°C for later use. The annealing reaction system is shown in Table 9.
[0114] Table 9 Annealing reaction system
[0115]
[0116] ⑤ Add 1 μL of T7e1 enzyme to the above 19 μL of annealing product and react at 37°C for 15 min.
[0117] ⑥ Separate the enzyme digestion product in 1% agarose gel and 1×TBE electrophoresis buffer, with a voltage of 110 V and electrophoresis for 30 min, and observe whether the cleavage band is correct.
[0118] It should be noted that the Cas9 protein combined with sgRNA cuts the gene at the cleavage site. Verify whether the target gene is successfully cut by T7e1 enzyme digestion. If the PCR product can be successfully cut into two fragments, it means passing the cleavage verification. The designed PCR product in this application is 752 bp, consisting of Figure 5It can be clearly seen that the PCR products of the pX458-sgRNA1 plasmid / pX458-sgRNA2 plasmid were successfully cut from 752bp into two fragments of 437bp and 315bp, indicating that the pX458-sgRNA1 plasmid and the pX458-sgRNA2 plasmid passed the cleavage verification. In the experiment, either sgRNA1 or sgRNA2 can be selected as the guide RNA, and in this experiment, sgRNA2 was selected as the guide RNA.
[0119] Example 3: Construction of the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid
[0120] 1. Design the left and right homologous arms, primers for the left and right homologous arms, and PCR amplify the left and right homologous arms
[0121] 1) Design the left and right homologous arms (RA, LA) according to the position of the selected sgRNA2 sequence
[0122] It should be noted that in this application, since the positions of F8-sgRNA1 and F8-sgRNA2 are very close, only one pair of left and right homologous arms was designed in this application, and both F8-sgRNA1 and F8-sgRNA2 use this pair of left and right homologous arms.
[0123] In this application, the base sequence of the right homologous arm designed based on the position of the sgRNA sequence is as follows: gtgacaatttcctacaatgagattttttaaatagaagataaatgttctcacttctttttcaTggagtctggccaaggaaaagacacagaccttgcacaaatttatactactttttgctgtatttgatgaaggttagtgagtcttaatctgaattttggattcctgaaagaaatcctctgctactattaagaggaggtgattatagaaagatcataaattacattactgttcaggaatgaaggagatggggttaaaaatgaattccaagaaaacaaaacgtaacctcagttccactggcagctatgaggtaagaagatagaggagctggataacggactggcctcatccccctcattaagactgtcaacaaatactttgggctctactttctaaatactttctcttatcttcatctattattaagtgcacaacctttggcaagttatttaacctctctgtgtctcggtttcctaaa(SEQ ID NO:1).
[0124] In this application, the base sequence of the left homologous arm designed based on the position of the sgRNA sequence is as follows: gccacaagctcaacagttaaagcatgaaacaagctagtttgttccattaaaaacttcagctatcgatatacacggtatttatttaaaatgtgagtataattagaagcactgtgggctattgaaaaaaaatcatgagtatagatgtttaatatggacaattgctattttactcaaaacttttaatttacaattgcagaagtataaaaagttacaagagtaacagaaattatctataatttcactattatcacacagtgtgtgagggcttgtattttgtaagtgtttttaatttttttctttagtaattcatttttatcatattttacacaagtagtggtcttcatcaaagttgaaataaaaaaattctttgctccagatagttttagaaacactgctataggagacctgacatcaaagccaagttatcaagagacagaagactacatttgttcttactgtcaagtaactgatgaagaactgtctcctccta (SEQ ID NO:2).
[0125] 2) Design the left and right homologous arm primers according to the position of the selected sgRNA2 sequence and the position of the point mutation. The upstream and downstream primer sequences of the left and right homologous arms are shown in Table 10.
[0126] Table 10 Primer sequences of the left and right homologous arms
[0127]
[0128] In the right homologous arm primer RA, GGATCC is the cleavage site of the restriction enzyme BamHI, and gcg is the protection base (to prevent the cleavage site from being lost during PCR); GGTACC is the cleavage site of the restriction enzyme KpnI, and agc is the protection base.
[0129] In the left homologous arm primer LA, GTCGAC is the cleavage site of the restriction enzyme SalI, and gcg is the protection base; GCGGCCGC is the cleavage site of the restriction enzyme NotI, and ata is the protection base.
[0130] 3) Use the DNA of the patient with splicing mutation as the template to PCR amplify the left and right homologous arms.
[0131] 4) Gel extraction of the PCR products of the left and right homologous arms, where the PCR product of the right homologous arm is F8-RA and the PCR product of the left homologous arm is F8-LA.
[0132] 2. Ligation of pMD-18T-pGK-puro-mcherry plasmid and F8-RA
[0133] 1) Double digest the pMD-18T-pGK-puro-mcherry plasmid and the F8-RA fragment with BamHI and KpnI respectively. The reaction conditions are: 37°C for 3 h. The double digestion reaction system of the pMD-18T-pGK-puro-mcherry plasmid is shown in Table 11, and the double digestion reaction system of F8-RA is shown in Table 12.
[0134] Table 11 Double digestion reaction system of pMD-18T-pGK-puro-mcherry plasmid
[0135]
[0136]
[0137] Table 12 Double digestion reaction system of F8-RA
[0138]
[0139] As Figure 6 shown, for the pMD-18T-pGK-puro-mcherry plasmid used in the present invention, while ligating the pGK-puro-mcherry fragment onto the pMD-18T vector, loxP sites and SV40 polyA sequences are also added to obtain the recombinant vector pMD-18T-pGK-puro-mcherry. The recombinant vector used in this application needs to be in the forward ligation. Two restriction enzyme sites, NotI and NcoI, are added upstream and downstream of pGK-puro-mcherry in the new recombinant plasmid.
[0140] It should be noted that the pMD-18T vector is a vector for cloning PCR products. SV40 polyA can help improve the expression level of the target gene. The loxP (locus of X-over P1) site, 34 bp in length, can be recognized by Cre recombinase.
[0141] 2) After agarose gel electrophoresis of the above-mentioned digested products, gel extraction and purification are carried out.
[0142] 3) T4 DNA ligase is used to ligate the purified products after digestion. The reaction conditions are: 37°C for 2 h. The ligation reaction system is shown in Table 13.
[0143] Table 13 Ligation reaction system
[0144]
[0145] 4) Transform the ligation product into competent cells. Take 100 μl of the overnight cultured bacterial solution and send it to BGI for sequencing. The bacterial solution containing the correct point mutation is shaken and the pMD-18T-pGK-puro-mcherry-RA plasmid is extracted.
[0146] In the present invention, using the pMD-18T-pGK-puro-mcherry plasmid as the vector, the ligation product plasmid (pMD-18T-pGK-puro-mcherry-RA) after double digestion of the F8-RA fragment with BamHI and KpnI enzymes is transformed, shaken, and then sent to BGI for sequencing. The sequencing results are compared in snapgene, and the results are as Figure 7 shown. Figure 7 The red bases in it are the right homologous arm ligated after the BamHI restriction site, and there is a c.602-1G>T mutation site on the right homologous arm.
[0147] 5) Ligate and transform the correctly sequenced pMD-18T-pGK-puro-mcherry-RA plasmid with F8-LA. The restriction endonucleases SalI and NotI are used for ligation to obtain the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid. The specific operation steps are the same as above.
[0148] In the present invention, using the successfully constructed pMD-18T-pGK-puro-mcherry-RA plasmid as the vector, the ligation product plasmid (LA-pMD-18T-pGK-puro-mcherry-RA) after double digestion of the F8-LA fragment with NotI and SalI enzymes is transformed, shaken, and then sent to BGI for sequencing. The sequencing results are compared in snapgene, and the results are as Figure 8 . Figure 8 The red bases in it are the left homologous arm ligated after the SalI restriction site.
[0149] In the present invention, the structure of the successfully constructed LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid is as Figure 9 shown. At the same time, the present invention also transforms the successfully constructed LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid, shakes it, and then sends it to BGI for sequencing, which verifies again that there is a mutation site c.602-1G>T on the right homologous arm.
[0150] Example 4: Transfect cells and obtain stable cell lines after drug screening
[0151] In this invention, the LA-18T-pGK-puro-mcherry-RA plasmid and the pX458-sgRNA plasmid were transfected into human hepatic stellate cells (LX-2 cell line) by using liposomes, and stable cell lines were obtained after drug screening.
[0152] 1) Cell resuscitation and culture
[0153] ① Take out one tube of LX-2 cells from the liquid nitrogen tank, put it into a 37 °C water bath, shake quickly until the cell liquid in the cryopreservation tube is completely melted, and centrifuge at 800 r / min for 5 min at room temperature;
[0154] ② Discard the supernatant, add 1 ml of DMEM high-glucose medium containing 1% double antibodies + 10% fetal bovine serum to the cryopreservation tube, gently pipette to make a cell suspension, transfer the cell suspension to a 25T culture flask containing 4 ml of DMEM high-glucose medium containing 1% double antibodies + 10% fetal bovine serum, observe the cell morphology under a microscope, and record the resuscitation date and cell type;
[0155] ③ Place the above-mentioned resuscitated LX-2 cells in an incubator at 37 °C and 5% CO2 for culture. When the cell density ratio is greater than 80%, they can be digested with 0.25% trypsin containing EDTA and passaged at a ratio of 1:2.
[0156] In the embodiment of this application, the LX-2 cell line used was purchased from Sevier Company.
[0157] 2) Determine the drug screening concentration of the LX-2 cell line
[0158] When subculturing a part of the cells, spread the LX-2 cell line evenly in a 24-well plate, add 0.1×10 6 cells to each well to make the cell density 60%-80%; after 24 h, change the medium of the cells in the 24-well plate to a medium containing different concentrations of puromycin. Add different volumes of puromycin with a concentration of 5 μg / μl to a final concentration of 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6 μg / ml in the complete medium. Observe the cells, and the drug screening concentration for this experiment is the one that makes the cell mortality rate 90% after 48 h.
[0159] In this application, the determined drug screening concentration of the LX-2 cell line is 1 μg / ml.
[0160] 3) Cell transfection
[0161] ① Inoculate the LX-2 cell line into a 6-well plate at a cell seeding density of 0.4×10 6 / L, culture at 37 °C and 5% CO2 for 24 h, and perform cell transfection when the cell density reaches 60%-80%.
[0162] ②Replace the cell culture medium with high-glucose DMEM medium without antibiotics, and culture at 37°C and 5% CO2 for 30 min.
[0163] ③Take 4 sterile 1.5 ml centrifuge tubes, add 100 μl of serum-free and antibiotic-free medium to each tube, and divide them into two tubes for each of tube A and tube B. Add 10 μl of Lipofectamine 2000 transfection reagent to tube A, and add LA-18T-pGK-puro-mcherry-RA plasmid (2500 ng), pX458-sgRNA plasmid + LA-18T-pGK-puro-mcherry-RA plasmid (total 2500 ng, the ratio of pX458-sgRNA plasmid to LA-18T-pGK-puro-mcherry-RA plasmid is 2:1) to tube B respectively, and pipette and mix well. Add the contents of tube A to tube B respectively, shake for 5 s and centrifuge briefly, then let stand for 5 min.
[0164] ④Slowly drip the above mixture into a six-well plate, mix well and place it in an incubator at 37°C and 5% CO2 for culture, and leave one well as a blank control.
[0165] 4) Screening of stable cell lines
[0166] ①After 48 h of transfection, red fluorescence and green fluorescence can be seen under the microscope. The red fluorescence indicates the cells successfully transfected with LA-18T-pGK-puro-mcherry-RA plasmid and carrying puromycin resistance; the green fluorescence indicates the cells successfully transfected with pX458-sgRNA plasmid. Digest the cells and dilute them at a ratio of 1:10. After the cells in the six-well plate adhere, replace the medium with complete medium containing puromycin at a screening concentration of 1.0 μg / ml. Change the medium every day for the first 3 days, and then change the medium every 3 - 5 days.
[0167] ②About 2 - 3 weeks later, in the six-well plate transfected with the dual plasmids (pX458-sgRNA plasmid and LA-18T-pGK-puro-mcherry-RA plasmid), monoclonal cell clusters can be seen under the microscope. Pick them under the microscope and transfer them to a 24-well plate for continued drug screening culture. When the cell density > 80%, digest the cells and passage them at a ratio of 1:2, then inoculate them into a six-well plate for continued culture. Extract DNA from one well of the cells in two six-well plates and use PCR to verify whether the construction is successful.
[0168] As Figure 10 shown, LX-2 cells transfected with pX458-sgRNA plasmid and LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid and screened by puromycin resistance showed monoclonal cell clusters under the microscope about 3 weeks later, and green fluorescence could be observed under an inverted microscope.
[0169] ③Design upstream and downstream primers according to the mcherry fluorescence sequence and the position of the point mutation, and then verify them through Primer-Blast. The PCR fragment is 752 bp. The PCR reaction system and procedure are shown in Table 14. The upstream and downstream primers for stable verification of cell lines are shown in Table 15.
[0170] Table 14 PCR reaction system and procedure
[0171]
[0172] Table 15 Upstream and downstream primers for stable verification of cell lines
[0173]
[0174] ④Send the PCR product to BGI for sequencing verification to check whether there is a point mutation.
[0175] ⑤Monoclonalization of the cells with successful sequencing verification by the limited dilution method. When the cell confluence reaches 80%, passage them again at a ratio of 1:2. After extracting DNA and sequencing to identify the correct mutation, expand the culture to obtain a stable positive clone with successful point mutation.
[0176] As Figure 11-12 shown, in the present invention, monoclonal cell clusters are picked for expansion culture, genomic DNA is extracted, and after PCR amplification and agarose gel electrophoresis, the results are as Figure 11 shown. It can be clearly seen from the figure that the selected monoclonal cell line is a stable positive monoclonal cell line with successful point mutation. Subsequently, a fragment with the correct size (752 bp) is selected for Sanger sequencing, and the sequencing result is compared with the snapgene sequence. A homozygous cell line with the F8 c.602-1G>T point mutation as Figure 12 shown is successfully screened out.
[0177] The clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein (Cas) 9 (CRISPR / Cas9) system belongs to the acquired immune defense system, and bacteria use its DNA cleavage and destruction ability to fight against viruses and phages. The CRISPR / Cas system consists of three parts: crRNA (CRISPR-derived RNA), trans-activating crRNA (tracrRNA), and Cas proteins. CRISPR / Cas9 uses single-guide RNA (sgRNA) to recognize the protospacer adjacent motif (PAM) located downstream of the target site, guiding the Cas9 protein to a specific target DNA sequence complementary to the sgRNA. The Cas9 protein endonuclease then cleaves the DNA double strand, resulting in a double-strand break (DSB) at the target site. These breaks can be repaired by two mechanisms: non-homologous end joining (NHEJ) or homology-directed repair (HDR). Both of these mechanisms play crucial roles in mediating genome damage repair. Genome DSBs increase the gene editing efficiency of HDR by 1000-fold. Double-cut donor-mediated HDR editing is also known as homology-mediated end joining (HMEJ). The HMEJ gene editing strategy uses CRISPR / Cas9-mediated gene cleavage and the repair of about 800 bp homologous arms on the donor vector and the target genome after transfection to achieve gene integration. Existing studies have shown that in vivo gene editing can be achieved using double-cut donor-mediated HDR editing (HMEJ). Therefore, the CRISPR / Cas9 gene editing technology can be used to remove, replace, or correct harmful genes that cause genetic diseases. The emergence of CRISPR / Cas provides a simple, efficient, and versatile platform for gene editing.
[0178] Currently, the CRISPR / Cas9 gene editing technology has been successfully applied to the treatment of various diseases, such as the gene therapy of genetic diseases thalassemia and hemophilia B. There are also marketed products and multiple clinical trials underway, offering the possibility of cure for these patients.
[0179] Studies have shown that among the high-risk inhibitor mutations caused by HA, many are unique F8 splicing site variants. In particular, patients carrying substitutions at conserved nucleotide positions are considered high-risk. These mutations usually result in less correction and reconstruction of normal splicing, thus leading to the emergence of alternative F8 subtypes carrying premature termination codons. Although more than 100 unique splicing site variants have been reported in the HAMSTeRS database, only a few of them have been studied through the analysis of F8 mRNA to fully characterize the impact of the mutations at the transcript and protein levels.
[0180] The general method for verifying splicing mutations is to construct a mini-gene and transiently transfect it into cells that do not express the F8 protein. The research method of this application is different from previous experiments. In this application, a mutant cell stable line was gene-edited, and a novel splicing mutation c.602-1G>T point mutation model was constructed on the genome of human hepatic stellate cells expressing the F8 protein by using the gene editing technology of CRISPR / Cas9 and homology-directed repair (HDR). This not only provides a model for the pathogenic mechanism of splicing mutations, the research on the formation of inhibitors, and gene therapy mediated by the CRISPR / Cas9 gene editing technology, but also provides guidance for the precise treatment of this patient.
[0181] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A cell line that causes a pathogenic splicing mutation in female HA patients, characterized in that, It is the F8 c.602-1G>T point mutation cell line.
2. Method for constructing a cell line with a pathogenic splicing mutation causing HA in females, characterized in that, The construction method of the F8 c.602-1G>T point mutation cell line is specifically as follows: S1. Design several sgRNA sequences based on the mutation site of the target gene F8; S2. Based on several sgRNA sequences and the CRISPR / Cas9 gene editing technology, construct several pX458-sgRNA plasmids respectively using the pX458 plasmid as the vector; S3. Based on the selected sgRNA sequence and the pX458-sgRNA plasmid, construct the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid using the pMD-18T-pGK-puro-mcherry plasmid as the vector; S4. Transfect the pX458-sgRNA plasmid and the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid in step S3 into cells at the same time, and obtain a stable cell line through drug screening.
3. The method for constructing a cell line that causes a pathogenic splicing mutation in female HA patients according to claim 2, characterized in that, In step S2, the pX458-sgRNA plasmid is transfected into human hepatic stellate cells using liposomes, and whether the target gene is successfully cleaved is verified by T7e1 enzyme. The condition for successful cleavage is that the PCR product can be cut into two fragments; In addition, the selected pX458-sgRNA plasmid in step S3 must be successfully cleaved.
4. The method for constructing a cell line that causes a pathogenic splicing mutation in female HA patients according to claim 2, characterized in that, In step S1, 2 sgRNA sequences were designed, namely F8-sgRNA1 and F8-sgRNA2. The forward and reverse sequences of the 2 sgRNA sequences are respectively: The forward sequence of F8-sgRNA1 is: 5’-CACCGtgtaggaaattgtcactagg-3’, and the reverse sequence is: 5’-AAACcctagtgacaatttcctacaC-3’; The forward sequence of F8-sgRNA2 is: 5’-CACCGcattgtaggaaattgtcact-3’, and the reverse sequence is: 5’-AAACagtgacaatttcctacaatgC-3’.
5. The method for constructing a cell line that causes a pathogenic splicing mutation in female HA patients according to claim 2, characterized in that, Step S3 is specifically as follows: S31. Design the left and right homologous arms according to the position of the selected sgRNA sequence; S32. Design the left and right homologous arm primers according to the position of the selected sgRNA sequence and the position of the point mutation; S33. Using the DNA of the patient with splicing mutation as the template, PCR amplify the left and right homologous arms; S34. Gel recover the PCR products of the left and right homologous arms. Among them, the PCR product of the right homologous arm is F8-RA, and the PCR product of the left homologous arm is F8-LA; S35. Connect and transform the pMD-18T-pGK-puro-mcherry plasmid with F8-RA, and obtain the pMD-18T-pGK-puro-mcherry-RA plasmid after sequencing by BGI; S36. Connect and transform the pMD-18T-pGK-puro-mcherry-RA plasmid with F8-LA, and obtain the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid after sequencing by BGI.
6. The method for constructing a cell line that causes a pathogenic splicing mutation in female HA patients according to claim 5, characterized in that, The base sequence of the right homologous arm designed based on the position of the selected sgRNA sequence is shown in SEQ ID NO: 1, and the base sequence of the left homologous arm designed based on the position of the selected sgRNA sequence is shown in SEQ ID NO:
2.
7. The method for constructing a cell line that causes a pathogenic splicing mutation in female HA patients according to claim 5, characterized in that, The upstream primer of the right homologous arm designed based on the position of the selected sgRNA sequence and the position of the point mutation is: 5’-gcgGGATCCgtgacaatttcctacaatgag-3’, and the downstream primer is: 5’-agcGGTACCtttaggaaaccgagacaca-3’; the upstream primer of the left homologous arm designed based on the position of the selected sgRNA sequence and the position of the point mutation is: 5’-gcgGTCGACgccaacaagctcaacagtt-3’, and the downstream primer is: 5’-ataGCGGCCGCtaggaggagacagttcttcat-3’.
8. The method for constructing a cell line that causes a pathogenic splicing mutation in female HA patients according to claim 2, characterized in that, In step S4, the pX458-sgRNA plasmid and the LA-pMD-18T-pGK-puro-mcherry-RA donor plasmid are co-transfected into human hepatic stellate cells by liposome transfection; in addition, the drug screening is antibiotic screening, and the resistance drug is puromycin.
9. The method for constructing a cell line that causes a pathogenic splicing mutation in female HA patients according to claim 2, characterized in that Before transfection in step S4, human hepatic stellate cells need to be resuscitated, cultured, and the drug screening concentration determined. The drug screening concentration determined for the LX-2 cell line is 1 μg / ml.
10. Use of a cell line with a pathogenic splicing mutation obtained according to the cell line with a pathogenic splicing mutation causing female HA described in claim 1 or the construction method of the cell line with a pathogenic splicing mutation causing female HA described in any one of claims 2-9 in the prevention, early diagnosis, or treatment of hemophilia in women.