SNPs used to identify the original species of Fritillaria cirrhosa and their applications
By applying SNP sites and pyrosequencing technology to Fritillaria cirrhosa, the problem of identifying the original species of Fritillaria cirrhosa was solved, enabling rapid and accurate identification and ensuring the authenticity and quality of the medicinal material.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify the original species of Fritillaria cirrhosa, leading to the emergence of counterfeit and substandard medicinal materials on the market, which affects clinical efficacy and industrialization.
Molecular markers were used at SNP sites (SNP1, SNP2, SNP3, SNP4, and SNP5), and quantitative detection methods were developed in conjunction with pyrosequencing technology. The original species of Fritillaria cirrhosa were identified by PCR amplification and pyrosequencing.
This method enables rapid and accurate identification of the original species of Fritillaria cirrhosa, improving the sensitivity and specificity of identification and ensuring the authenticity and quality of the medicinal material.
Smart Images

Figure CN120350159B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of methods for the determination or inspection of nucleic acids in biochemistry, and particularly relates to SNPs for identifying the original species of Fritillaria cirrhosa D. Don and their applications.
[0002] Cross - reference to related applications
[0003] This application claims the priority of a Chinese patent application (application number: 202410631567.2) with an application date of May 21, 2024, and the entire content of this patent application is incorporated herein by reference. Background Art
[0004] Fritillaria cirrhosa D. Don is the dried bulb of the genus Fritillaria in the family Liliaceae and is one of the precious traditional Chinese medicines in China. The dried bulbs of Fritillaria cirrhosa D. Don var. cirrhosa, Fritillaria unibracteata Hsiao et K. C. Hsia, Fritillaria przewalskii Maxim., Fritillaria delavayi Franch., Fritillaria taipaiensis P. Y. Li or Fritillaria wabuensis S. Y. Tang et S. C. Yueh are its sources. According to the differences in the medicinal properties, they are divided into "Songbei", "Qingbei", "Lubei" and "cultivated products". Fritillaria unibracteata Hsiao et K. C. Hsia is the main original plant of "Songbei"; "Qingbei" mainly comes from Fritillaria cirrhosa D. Don var. cirrhosa, Fritillaria przewalskii Maxim. and Fritillaria taipaiensis P. Y. Li; the main original plant of "Lubei" is Fritillaria delavayi Franch.; Fritillaria wabuensis S. Y. Tang et S. C. Yueh is the main source of "cultivated products". Fritillaria cirrhosa D. Don has significant medicinal effects but is very expensive. Therefore, at present, the phenomenon of using adulterated products similar to Fritillaria cirrhosa D. Don in appearance but with lower prices and medicinal effects to冒充 Fritillaria cirrhosa D. Don is endless. Also, because the quality of "Songbei" is better than that of "Qingbei", "Lubei" and "cultivated products", the phenomenon of using lower - quality Fritillaria cirrhosa D. Don such as "Qingbei" to冒充 "Songbei" in the market is also common. And research shows that there are also significant differences in the content of active ingredients and the pharmacological effects of different original species of Fritillaria cirrhosa D. Don. These phenomena will seriously affect the clinical efficacy of Fritillaria cirrhosa D. Don and the reliability of scientific research, and will also seriously hinder the industrialization process of Fritillaria cirrhosa D. Don as a precious traditional Chinese medicine. Therefore, there is an urgent need to develop a method for quickly and accurately identifying the original species of Fritillaria cirrhosa D. Don.
[0005] At present, there are studies on the identification of the original plants, cut - pieces and Chinese patent medicines of traditional Chinese medicine Fritillaria cirrhosa D. Don, including microscopic, physical and chemical, molecular and other methods. However, these studies mainly focus on the adulterated species of Fritillaria cirrhosa D. Don, and there are few relevant reports on the identification of its original species. There is a study that screened out a 100 - bp short sequence by comparing the 12S rRNA of humans and 12 animals, and successfully completed the identification of human and various animal hairs using the pyrosequencing method. This method has also been successfully used in the detection of rice mutants and the adulteration detection of Lonicera japonica Thunb., Alisma orientale (Sam.) Juz. etc. Therefore, developing a method for quantitatively detecting SNP locus variations based on the pyrosequencing technology can be used for the effective identification of different original species of Fritillaria cirrhosa D. Don. Summary of the Invention
[0006] The technical problem to be solved by the present invention is how to use molecular markers for the identification and quantitative detection of different original species of Fritillaria cirrhosa D. Don and their products.
[0007] To address the aforementioned technical problems, this invention first provides the application of SNP sites in identifying or assisting in the identification of the original species of Fritillaria cirrhosa, wherein the SNP sites are SNP1, SNP2, SNP3, and SNP4, or any three SNPs, any two SNPs, or any one SNP:
[0008] The SNP1 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing. It is either A or G. The letter R in SEQ ID No:1 represents either A or G.
[0009] The SNP2 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing. It is either A or G. The letter R in SEQ ID No:5 represents either A or G nucleotide.
[0010] The SNP3 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 85th nucleotide in SEQ ID No:9 in the sequence listing. It is either T or C. The letter Y in SEQ ID No:9 represents either T or C.
[0011] The SNP4 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, and is the 183rd nucleotide in SEQ ID No:13 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:13 represents either T or C.
[0012] In the above applications, the SNP site may also include SNP5; SNP5 is an SNP in the genome of a species of the genus Fritillaria in the family Liliaceae, and is the 41st nucleotide of SEQ ID No:17 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:17 represents either T or C.
[0013] This invention also provides the application of SNP sites in the identification or auxiliary identification of Fritillaria cirrhosa in Fritillaria tangutorum, wherein the SNP site is SNP1;
[0014] The SNP1 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, and is the 66th nucleotide in SEQ ID No:1 in the sequence listing. It is either A or G, and the letter R in SEQ ID No:1 represents either A or G.
[0015] In the above applications, the SNP site may also include SNP5; SNP5 is an SNP in the genome of a species of the genus Fritillaria in the family Liliaceae, and is the 41st nucleotide of SEQ ID No:17 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:17 represents either T or C.
[0016] This invention also provides the application of SNP sites in the identification or auxiliary identification of Fritillaria cirrhosa basidiosus and / or Fritillaria cirrhosa, wherein the SNP site is SNP2;
[0017] The SNP2 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, and is the 58th nucleotide in SEQ ID No:5 in the sequence listing. It is either A or G, and the letter R in SEQ ID No:5 represents either A or G.
[0018] In the above applications, the SNP site may also include SNP5; SNP5 is an SNP in the genome of a species of the genus Fritillaria in the family Liliaceae, and is the 41st nucleotide of SEQ ID No:17 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:17 represents either T or C.
[0019] This invention also provides the application of SNP sites in the identification or auxiliary identification of Fritillaria cirrhosa basilicum and / or Fritillaria wabu, wherein the SNP site is SNP3;
[0020] The SNP3 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, and is the 85th nucleotide in SEQ ID No:9 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:9 represents either T or C.
[0021] In the above applications, the SNP site may also include SNP5; SNP5 is an SNP in the genome of a species of the genus Fritillaria in the family Liliaceae, and is the 41st nucleotide of SEQ ID No:17 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:17 represents either T or C.
[0022] This invention also provides the application of SNP sites in the identification or auxiliary identification of Fritillaria cirrhosa primordial species Fritillaria taibai, wherein the SNP site is SNP4;
[0023] The SNP4 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, and is the 183rd nucleotide in SEQ ID No:13 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:13 represents either T or C.
[0024] In the above applications, the SNP site may also include SNP5; SNP5 is an SNP in the genome of a species of the genus Fritillaria in the family Liliaceae, and is the 41st nucleotide of SEQ ID No:17 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:17 represents either T or C.
[0025] The present invention also provides the application of substances for detecting polymorphism in the identification or auxiliary identification of the original species of Fritillaria cirrhosa: the polymorphism is a combination of one or more SNPs among SNP1, SNP2, SNP3, and SNP4 in the chloroplast genome of the bulb chloroplast of the original species of Fritillaria cirrhosa.
[0026] The SNP1 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing. It is either A or G. The letter R in SEQ ID No:1 represents either A or G.
[0027] The SNP2 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing. It is either A or G. The letter R in SEQ ID No:5 represents either A or G nucleotide.
[0028] The SNP3 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 85th nucleotide in SEQ ID No:9 in the sequence listing. It is either T or C. The letter Y in SEQ ID No:9 represents either T or C.
[0029] The SNP4 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, and is the 183rd nucleotide in SEQ ID No:13 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:13 represents either T or C.
[0030] In the above applications, the SNP site may also include SNP5; SNP5 is an SNP in the genome of a species of the genus Fritillaria in the family Liliaceae, and is the 41st nucleotide of SEQ ID No:17 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:17 represents either T or C.
[0031] To solve the above-mentioned technical problems, the present invention also provides a product, which may be any one of the following G1)-G5):
[0032] G1) The product contains a substance for detecting one or more SNP polymorphisms among SNP1, SNP2, SNP3, and SNP4, and the product is used to identify or assist in the identification of the original species of Fritillaria cirrhosa.
[0033] G2) The product contains a substance for detecting SNP1 polymorphism, and the product is used to identify or assist in the identification of the original species, *Fritillaria cirrhosa*.
[0034] G3) The product contains a substance for detecting SNP2 polymorphism, and the product is used to identify or assist in the identification of the original species Fritillaria cirrhosa and / or Fritillaria cirrhosa.
[0035] G4) The product contains a substance for detecting SNP3 polymorphism, and the product is used to identify or assist in the identification of the original species Fritillaria purpurea and / or Fritillaria wabue.
[0036] G5) The product contains a substance for detecting SNP4 polymorphism, and the product is used to identify or assist in the identification of the original species Fritillaria thunbergii.
[0037] The SNP1 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing. It is either A or G. The letter R in SEQ ID No:1 represents either A or G.
[0038] The SNP2 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing. It is either A or G. The letter R in SEQ ID No:5 represents either A or G nucleotide.
[0039] The SNP3 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, which is the 85th nucleotide in SEQ ID No:9 in the sequence listing. It is either T or C. The letter Y in SEQ ID No:9 represents either T or C.
[0040] The SNP4 is an SNP in the chloroplast genome of the bulb of Fritillaria cirrhosa, and is the 183rd nucleotide in SEQ ID No:13 in the sequence listing. It is either T or C, and the letter Y in SEQ ID No:13 represents either T or C.
[0041] The aforementioned products may also contain substances for detecting SNP5 polymorphisms;
[0042] The SNP5 is a SNP in the genome of a species of the genus Fritillaria in the family Liliaceae. It is the 41st nucleotide in SEQ ID No:17 in the sequence listing and is either T or C. The letter Y in SEQ ID No:17 represents either T or C.
[0043] In the above applications or products, the polymorphism can be determined by at least one of the following methods to identify the nucleotide types of SNP1, SNP2, SNP3, SNP4, or SNP5 in the genome of the original Fritillaria cirrhosa species: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP microarrays. The SNP microarrays include microarrays based on nucleic acid hybridization reactions, microarrays based on single-base extension reactions, microarrays based on allele-specific primer extension reactions, microarrays based on one-step reactions, microarrays based on primer ligation reactions, microarrays based on restriction endonuclease reactions, microarrays based on protein-DNA binding reactions, and microarrays based on fluorescent molecule-DNA binding reactions.
[0044] In the above applications or products, the substance may be D1), D2), or D3).
[0045] D1) Contains PCR primer pairs that amplify genomic DNA fragments of Fritillaria cirrhosa, including the SNP sites mentioned above;
[0046] D2) PCR reagents containing the PCR primer pairs described in D1);
[0047] D3) A kit containing the PCR primer pair described in D1) or the PCR reagent described in D2).
[0048] The PCR primer pairs mentioned above are any one or more combinations of primer pairs composed of GSF1 and GSR1, primer pairs composed of JSF1 and JSR1, primer pairs composed of AHF1 and AHR1, and primer pairs composed of TBF1 and TBR1.
[0049] The GSF1 is a single-stranded DNA as shown in SEQ ID No. 2 in the sequence listing;
[0050] The GSR1 is a single-stranded DNA as shown in SEQ ID No. 3 in the sequence listing;
[0051] The JSF1 is a single-stranded DNA as shown in SEQ ID No. 6 of the sequence listing;
[0052] The JSR1 is a single-stranded DNA as shown in SEQ ID No. 7 of the sequence listing;
[0053] The AHF1 is a single-stranded DNA as shown in SEQ ID No:10 in the sequence listing;
[0054] The AHR1 is a single-stranded DNA sequence shown in SEQ ID No:11 in the sequence listing;
[0055] The TBF1 is a single-stranded DNA as shown in SEQ ID No:14 in the sequence listing;
[0056] The TBR1 is a single-stranded DNA as shown in SEQ ID No:15 in the sequence listing.
[0057] The above PCR primers may also contain primer pairs consisting of SF1 and SR1:
[0058] The SF1 is a single-stranded DNA as shown in SEQ ID No:18 in the sequence listing;
[0059] The SR1 is a single-stranded DNA as shown in SEQ ID No:19 in the sequence listing.
[0060] In the above applications or products, the PCR primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can provide detectable results and can be linked to nucleic acids. Markers include, but are not limited to, dyes; radioactive markers, such as... 32 P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moieties (positive or negative) or, optionally, charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).
[0061] In the above applications or products, the product may be a reagent, kit, or system. The system may include a combination of reagents or kits, instruments, and analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, an ELISA reader, and online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), or a combination of PCR primers, PARMS master mix reagents, online software SNP decoder, and a real-time PCR instrument.
[0062] In the above applications or products, the substance may also contain sequencing primers that cooperate with the PCR primers;
[0063] The sequencing primer that works with the primer pair consisting of GSF1 and GSR1 is GSS1; GSS1 is the single-stranded DNA shown in SEQ ID No. 4 of the sequence listing;
[0064] The sequencing primer that works with the primer pair consisting of JSF1 and JSR1 is JSS1; JSS1 is a single-stranded DNA as shown in SEQ ID No. 8 in the sequence listing;
[0065] The sequencing primer that works with the primer pair consisting of AHF1 and AHR1 is AHS1; AHS1 is the single-stranded DNA shown in SEQ ID No:12 in the sequence listing;
[0066] The sequencing primer that works with the primer pair consisting of TBF1 and TBR1 is TBS1; TBS1 is the single-stranded DNA shown in SEQ ID No:16 in the sequence listing;
[0067] The sequencing primer that works with the primer pair consisting of SF1 and SR1 is SS1; SS1 is the single-stranded DNA shown in SEQ ID No. 20 of the sequence listing.
[0068] The beneficial effects of this invention are as follows:
[0069] This invention provides four specific SNPs for identifying the original species of Fritillaria cirrhosa and their applications. These SNP molecular markers exhibit high sensitivity and specificity. Using these specific SNP sites, six original species of Fritillaria cirrhosa can be successfully identified. Attached Figure Description
[0070] Figure 1 The image shows the PCR results of six original species of Fritillaria cirrhosa. Where M represents the marker, CK represents the blank control, 1 represents the PCR product of *Fritillaria gansuensis* at position 273 of the NC_044636.1CP sequence, i.e., position 66 of SEQ ID No:1; 2 represents the PCR product of *Fritillaria cirrhosa* at position 2511 of the MN480806.1CP sequence, i.e., position 58 of SEQ ID No:5; 3 represents the PCR product of *Fritillaria sibirica* at position 2511 of the MN480806.1CP sequence, i.e., position 58 of SEQ ID No:5; 4 represents the PCR product of *Fritillaria purpurea* at position 2590 of the NC_044629.1CP sequence, i.e., position 85 of SEQ ID No:9; 5 represents the PCR product of *Fritillaria wabuensis* at position 2590 of the NC_044629.1CP sequence, i.e., position 85 of SEQ ID No:9; 6 represents the PCR product of *Fritillaria taibaiensis* at position 2905 of the NC_023247.1CP sequence, i.e., position 273 of SEQ ID No:1; 2 represents the PCR product of *Fritillaria taibaiensis* at position 2905 of the NC_023247.1CP sequence, i.e., position 66 of SEQ ID No:1; 3 represents the PCR product of *Fritillaria cirrhosa* at position 2511 of the MN480806.1CP sequence, i.e., position 58 of SEQ ID No:5; 4 represents the PCR product of *Fritillaria purea* at position 2590 of the NC_044 The PCR product at position 183 of IDNo:13.
[0071] Figure 2 The results are pyrosequencing of each sample in Example 2 at different SNP sites; where, Figure 2 A1, A2, and A3 are the sequencing results for the SNP1 site. Figure 2 B1, B2, and B3 are the sequencing results for the SNP2 site. Figure 2 C1, C2, and C3 are the sequencing results for the SNP3 site. Figure 2 D1, D2, and D3 are the sequencing results of SNP4 sites.
[0072] Figure 3 The result is the pyrosequencing of the amplification product of the sample to be tested at position 152 of the KT008138.1CP sequence, which is position 41 of SEQ ID No:17. Detailed Implementation
[0073] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0074] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0075] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0076] Example 1: SNP site screening of the basal bulb of Fritillaria cirrhosa for identification
[0077] First, in the GenBank database of NCBI ( https: / / www.ncbi.nlm.nih.gov / As of January 20, 2023, ITS, psbA-trnH, and matK sequences of all species in the genus Fritillaria were downloaded. A total of 734 ITS sequences from 103 species, 232 psbA-trnH sequences from 57 species, and 382 matK sequences from 116 species were downloaded.
[0078] Four SNP loci were selected from these loci that can distinguish the six original species of Fritillaria cirrhosa (Fritillaria gansuensis, Fritillaria cirrhosa, Fritillaria cirrhosa, Fritillaria purpurea, Fritillaria wabui, and Fritillaria taibai) from the other species of the Fritillaria genus. These loci are numbered SNP1, SNP2, SNP3, and SNP4.
[0079] In addition, the applicant also selected one SNP locus that distinguishes between Fritillaria cirrhosa and non-Fritillaria cirrhosa, designated SNP5.
[0080] The locations of the 5 SNPs and their primer information are detailed in Table 1:
[0081] Table 1. SNP1, SNP2, SNP3, and SNP4, and their specific PCR primers and sequencing primers.
[0082]
[0083]
[0084] Note: Biotin in the table indicates that the 5' end of the sequence is labeled with biotin.
[0085] SNP1 is a Gansu Fritillaria-specific SNP site, a single SNP in the Sichuan Fritillaria genome, located at nucleotide 273 of the NC_044636.1CP sequence. Its nucleotide value is either A or G, represented by the letter R, and corresponds to position 66 of SEQ ID No:1 in the sequence listing (SEQ ID No:1 is the nucleotide sequence of the PCR product obtained using primers GSF1 (SEQ ID No:2) and GSR1 (SEQ ID No:3)). The Gansu Fritillaria SNP1 has nucleotide A, while the Sichuan Fritillaria SNP1 from other species has nucleotide G.
[0086] When the sample of Fritillaria cirrhosa to be tested is amplified by PCR using GSF1 and GSR1 as primers and pyrosequencing is performed using GSS1 (SEQ ID No:4) as primer, the following criteria are used for judgment: when the sequencing result shows that SNP1 is only A, it can be determined that the sample contains only Fritillaria cirrhosa from Gansu; when it is only G, it can be determined that the sample does not contain Fritillaria cirrhosa from Gansu and is entirely Fritillaria cirrhosa from other species; when both A and G are present, it can be determined that the sample contains both Fritillaria cirrhosa from Gansu and Fritillaria cirrhosa from other species.
[0087] SEQ ID No:1
[0088] AGGTCTAGAGGGAAATTGTGAGCATTACGTTCATGCATTACTTCCATACCAAGGTTAGCACGATTRATGA TATCAGCCCAAGTGTTAATAACACGACCCTGACTGTCAA
[0089] SNP2 is a specific SNP site for Fritillaria cirrhosa and Fritillaria thunbergii, located in the genome of Fritillaria cirrhosa. It is nucleotide 2511 of the MN480806.1CP sequence, with nucleotide A or G, represented by the letter R. It corresponds to position 58 of SEQ ID No:5 in the sequence listing (SEQ ID No:5 is the nucleotide sequence of the PCR product obtained using primers JSF1 (SEQ ID No:6) and JSR1 (SEQ ID No:7)). The nucleotides for SNP2 in Fritillaria cirrhosa and Fritillaria thunbergii are both A, while the nucleotide for SNP2 in Fritillaria cirrhosa (other than Fritillaria cirrhosa) is G.
[0090] When the sample of Fritillaria cirrhosa to be tested is amplified by PCR using JSF1 and JSR1 as primers and pyrosequencing is performed using JSS1 (SEQ ID No:8) as primer, the following criteria are used for judgment: when the sequencing result shows that SNP2 is only A, it can be determined that the sample contains only Fritillaria cirrhosa and / or Fritillaria thunbergii; when it is only G, it can be determined that the sample does not contain Fritillaria cirrhosa and Fritillaria thunbergii, and is entirely Fritillaria cirrhosa other than Fritillaria cirrhosa and Fritillaria thunbergii; when both A and G are present, it can be determined that the sample contains both Fritillaria cirrhosa and / or Fritillaria thunbergii, as well as Fritillaria cirrhosa other than Fritillaria cirrhosa and Fritillaria thunbergii.
[0091] SEQ ID No:5
[0092] TGAAGCCAGAATTGCTTTTTCCTTGATATCGAACATAATGTATCAAAGGATCCTTGACRGGCCACAGGGTCTTCTGAAAATTATTACAACACACTATTATAATATGTTCCATTTTTCCATAGAAATGTGAACGTTCAAGAAAGGCTCCA
[0093] SNP3 is a specific SNP site for *Fritillaria thunbergii* and *Fritillaria wabu*, and is an SNP in the *Fritillaria cirrhosa* genome. It is nucleotide 2590 of the NC_044629.1CP sequence, with nucleotides T or C, represented by the letter Y. It corresponds to position 85 of SEQ ID No:9 in the sequence listing (SEQ ID No:9 is the nucleotide sequence of the PCR product obtained by amplification using primers AHF1 (SEQ ID No:10) and AHR1 (SEQ ID No:11)). The nucleotides of SNP3 in *Fritillaria thunbergii* and *Fritillaria wabu* are both T, while the nucleotide of SNP3 in *Fritillaria cirrhosa* other than *Fritillaria thunbergii* is C.
[0094] When the sample of Fritillaria cirrhosa to be tested is amplified by PCR using AHF1 and AHR1 as primers and pyrosequencing is performed using AHS1 (SEQ ID No: 12) as primer, the following criteria are used for judgment: when the sequencing result shows that SNP3 is only T, it can be determined that only Fritillaria cirrhosa and / or Fritillaria wabui exist in the sample; when it is only C, it can be determined that Fritillaria cirrhosa and Fritillaria wabui do not exist in the sample, and all Fritillaria cirrhosa are other than Fritillaria cirrhosa and Fritillaria wabui; when both T and C are present, it can be determined that Fritillaria cirrhosa and / or Fritillaria wabui exist in the sample, as well as Fritillaria cirrhosa other than Fritillaria cirrhosa and Fritillaria wabui exist.
[0095] SEQ ID No:9
[0096] TCCAGAAGATGTTGATCGTAAATAACAGGATTGTTTATGAAAAAAAACTAATAAAAATTCGCATTCAGATACATAAGAATTGTAYAGGAACCAAAATAGTCTTTTATTTTCTTTTGAAAAAACATAAATAGTTTTATTACTCTGAATAGTTTTATTCAGATTCTGATATTTATGTAGAAAGAATCGCAATAAATGTA
[0097] SNP4 is a specific SNP site of Fritillaria taibaiensis, a SNP in the Fritillaria chuanxiong genome, and is nucleotide 2905 of the NC_023247.1CP sequence. Its nucleotide value is either T or C, represented by the letter Y, and corresponds to position 183 of SEQ ID No:13 in the sequence listing (SEQ ID No:13 is the nucleotide sequence of the PCR product obtained by amplification using TBF1 (SEQ ID No:14) and TBR1 (SEQ ID No:15) as primers). The nucleotide value of SNP4 in Fritillaria taibaiensis is always T, while the nucleotide value of SNP4 in Fritillaria chuanxiong is C.
[0098] When the sample of Fritillaria cirrhosa to be tested is amplified by PCR using TBF1 and TBR1 primers and pyrosequencing is performed using TBS1 (SEQ ID No:16) primers, the following criteria are used for judgment: when the sequencing result shows that SNP4 is only T, it can be determined that only Fritillaria taibai is present in the sample; when it is only C, it can be determined that there is no Fritillaria taibai in the sample, and all Fritillaria cirrhosa are other than Fritillaria taibai; when there are both T and C bases, it can be determined that the sample contains both Fritillaria taibai and other Fritillaria cirrhosa.
[0099] SEQ ID No:13
[0100] ATATCTTGAATCCAGCATTGAAGGATTTGAACCAAAATTTCAAAATGGATAGGATGGGGTATTAGTATATCTGAAACATTATTTAAATGAGATAATTTGTCCTCTAAAAAAGGAAATATTGAATGAATAGATCCTAAATTCTGAGATTTTGGTATTTCTTTTCTTCGGAGGAAGATACTAATYGTAGCGAGAATGGAATTTCCACAATGACTGAAAAACCCTTTG
[0101] SNP5 is a specific SNP site of Fritillaria cirrhosa, a SNP in the genome of species in the genus Fritillaria in the family Liliaceae. It is nucleotide 152 of the KT008138.1CP sequence, with nucleotides T or C, represented by the letter Y. It corresponds to position 41 of SEQ ID No:17 in the sequence listing (SEQ ID No:17 is the nucleotide sequence of the PCR product obtained by amplification using SF1 (SEQ ID No:18) and SR1 (SEQ ID No:19) as primers). The nucleotide of SNP5 in Fritillaria cirrhosa is always T, while the nucleotide of SNP5 in other species of the genus Fritillaria in the family Liliaceae is C.
[0102] When the sample to be tested is amplified by PCR using SF1 and SR1 as primers and pyrosequencing is performed using SS1 (SEQ ID No:20) as primer, the following criteria are used for judgment: when the sequencing result shows that SNP5 is only T, it can be determined that only Fritillaria cirrhosa is present in the sample; when it is only C, it can be determined that Fritillaria cirrhosa is not present in the sample, and all species of Fritillaria cirrhosa in the Liliaceae family are present; when both T and C are present, it can be determined that Fritillaria cirrhosa and other species of Fritillaria cirrhosa in the Liliaceae family are present in the sample.
[0103] SEQ ID No:17
[0104] ATGGGCACGACGAGTGGTGGACGGAGCACCAGCAGGATGTYGTGGCCCCCTGTCGCCTTAAGGGGCTCAA GAGACCCGGACC
[0105] Example 2: Identification of Fritillaria cirrhosa bulbs based on SNP site variations
[0106] The method for rapid identification of the original bulb of Fritillaria cirrhosa in this embodiment includes the following steps:
[0107] (1) Three bulbs of each of the following species were collected from Haidong in Qinghai, Ganzi and Aba in Sichuan, Tianshui in Gansu, Shangri-La in Yunnan, and Baoji in Shaanxi: Fritillaria cirrhosa, Fritillaria thunbergii, Fritillaria purpurea, Fritillaria wabui, and Fritillaria taibai, for a total of 108 samples to be tested. The samples were sliced, dried, pulverized, and passed through a 100-mesh sieve. The powder was then sealed in a self-sealing bag for later use.
[0108] (2) Take 200 mg of each original species bulb powder sample, extract total DNA using the (Tiangen) high-efficiency plant genomic DNA extraction kit, detect DNA concentration and purity using NanoDrop 2000 micro spectrophotometer, and store at 4℃.
[0109] (3) Using the genomic DNA of the sample to be tested as a template, PCR amplification products were generated using the corresponding PCR amplification primers. First, SNP5 was detected to determine whether the sample to be tested was Fritillaria cirrhosa. Then, SNP1, SNP2, SNP3 and SNP4 were detected in the Fritillaria cirrhosa sample to determine the specific original species.
[0110] PCR reaction system (25 μL): 12.5 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers (10 μmol / L), 100 ng of DNA template, and the remainder is made up with sterile deionized water.
[0111] The PCR reaction procedures for each SNP site are shown in Table 2. The quality of the amplified PCR products was assessed using 1% agarose gel electrophoresis to verify the clarity and uniformity of the target band. A blank sample was added as a control during the experiment (see Table 2). Figure 1 ).
[0112] Table 2. PCR reaction procedures for each SNP site.
[0113]
[0114]
[0115] The amplification products of the above-mentioned test samples were subjected to pyrosequencing using the five sets of primers for the five SNPs listed in Table 1, and the polymorphisms of SNP5, SNP1, SNP2, SNP3, and SNP4 were detected respectively.
[0116] The results are as follows Figure 2 As shown:
[0117] Various test samples were amplified using PCR products amplified with primer pairs (SF1 / SR1) targeting the sequence including SNP5 (position 152 of the KT008138.1CP sequence, i.e., position 41 of SEQ ID No: 17). Pyrosequencing was performed using sequencing primer SS1. The test sample showing only a T base at the SNP5 (position 152 of the KT008138.1CP sequence, i.e., position 41 of SEQ ID No: 17) site was identified as Fritillaria cirrhosa (see...). Figure 3 ).
[0118] Various Fritillaria cirrhosa samples were tested using PCR products amplified with primers (GSF1 / GSR1) targeting the sequence including SNP1 (position 273 of the NC_044636.1CP sequence, i.e., position 66 of SEQ ID No:1). Pyrosequencing was performed using sequencing primer GSS1. Results at the expected SNP1 (position 273 of the NC_044636.1CP sequence, i.e., position 66 of SEQ ID No:1) site showed only base A, indicating the original species as Fritillaria cirrhosa from Gansu. Figure 2 A1 and Figure 2 (A2).
[0119] Various Fritillaria cirrhosa samples were tested using PCR products amplified with primers (JSF1 / JSR1) targeting the sequence including SNP2 (position 2511 of MN480806.1CP, i.e., position 58 of SEQ ID No:5). Pyrosequencing was then performed using sequencing primer JSS1. Results showing only base A at the SNP2 (position 2511 of MN480806.1CP, i.e., position 58 of SEQ ID No:5) site indicated that the original species were Fritillaria cirrhosa, Fritillaria thunbergii, or both. Figure 2 B1 and Figure 2 B2)
[0120] Various Fritillaria cirrhosa samples were tested using PCR products amplified with primers (AHF1 / AHR1) targeting the sequence including SNP3 (position 2590 of the NC_044629.1CP sequence, i.e., position 85 of SEQ ID No:9). Pyrosequencing was then performed using sequencing primer AHS1. The expected result at the SNP3 (position 2590 of the NC_044629.1CP sequence, i.e., position 85 of SEQ ID No:9) site indicated that the primary species showing only a base T were Fritillaria cirrhosa, Fritillaria baicalensis, or both. Figure 2 C1 and Figure 2 (C2).
[0121] Various Fritillaria cirrhosa samples were tested using PCR products amplified with primers (TBF1 / TBR1) targeting the sequence including SNP4 (position 2905 of the NC_023247.1CP sequence, i.e., position 183 of SEQ ID No: 13). Pyrosequencing was then performed using sequencing primer TBS1. The expected result at the SNP4 (position 2905 of the NC_023247.1CP sequence, i.e., position 183 of SEQ ID No: 13) site showed only a T base in the original species *Fritillaria taibaiense*. Figure 2 D1 and Figure 2 (D2).
[0122] After testing, it was found that all the tested samples had the SNP5 genotype A, indicating that all the tested samples were Fritillaria cirrhosa samples; the Fritillaria cirrhosa samples also had the SNP1 genotype A (position 273 of the NC_044636.1CP sequence, i.e., position 66 of SEQ ID No:1), indicating that the tested samples were the corresponding primordial species Fritillaria gansuensis (Fritillaria cirrhosa). Figure 2 The A3 of the tested Fritillaria cirrhosa samples all have genotype A at SNP2 (position 2511 of the MN480806.1CP sequence, i.e., position 58 of SEQ ID No:5), indicating that the tested samples are the corresponding original species Fritillaria cirrhosa, Fritillaria thunbergii, or both. Figure 2 The B3 of the tested Fritillaria cirrhosa sample showed a genotype of T at SNP3 (position 2590 of the NC_044629.1CP sequence, i.e., position 85 of SEQ ID No:9), indicating that the sample was the corresponding primordial species, Fritillaria cirrhosa or Fritillaria wabui, or both. Figure 2 The C3 of the tested Fritillaria cirrhosa sample showed a genotype of T at SNP4 (position 2905 of the NC_023247.1CP sequence, i.e., position 183 of SEQ ID No: 13), indicating that the tested sample was the corresponding primordial species, Fritillaria taibai (C3). Figure 2 D3).
[0123] As can be seen, the results of the identification of specific SNP sites in each sample by pyrosequencing are consistent with the actual results, indicating that the method described in this invention is effective and accurate.
[0124] Example 3: Identification of the original strain of Fritillaria cirrhosa (Chuan Bei Mu) in processed medicinal slices
[0125] Five samples of each of the following fritillaria, fritillaria cirrhosa, fritillaria thunbergii, fritillaria thunbergii, fritillaria purpurea, fritillaria wabu, and fritillaria taibai were collected from Bozhou, Anhui; Aba, Sichuan; Chengdu, Sichuan; Shijiazhuang, Hebei; and Baoding, Hebei, for a total of 30 samples to be tested.
[0126] The identification was performed using the same method as in Example 2, except that the above-mentioned 30 pieces of Fritillaria cirrhosa original seed were used as the test samples.
[0127] After DNA extraction, PCR amplification, and pyrosequencing, the results showed that, using the same method as in Example 2, the 30 samples collected were first confirmed by SNP5 to be fritillaria cirrhosa slices. Then, SNP1 (position 273 of NC_044636.1CP sequence, i.e. position 66 of SEQ ID No:1), SNP2 (position 2511 of MN480806.1CP sequence, i.e. position 58 of SEQ ID No:5), SNP3 (position 2590 of NC_044629.1CP sequence, i.e. position 85 of SEQ ID No:9) and SNP4 (position 2905 of NC_023247.1CP sequence, i.e. position 183 of SEQ ID No:13) were successfully used to identify the original species of fritillaria cirrhosa slices.
[0128] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein, and can apply some basic features.
Claims
1. Application of SNP loci in identifying or assisting in identifying Fritillaria cirrhosa base stock, characterized in that: The SNP site is SNP1, SNP2, SNP3 and SNP4, which are four SNPs: The SNP1 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 66th nucleotide in SEQ ID No: 1 in the sequence listing, which is A or G, and the letter R in SEQ ID No: 1 represents any one of the nucleotides A or G; The SNP2 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 58th nucleotide in SEQ ID No: 5 in the sequence listing, which is A or G, and the letter R in SEQ ID No. 5 represents any one of the nucleotides A or G; The SNP3 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 85th nucleotide in SEQ ID No: 9 in the sequence listing, which is T or C, and the letter Y in SEQ ID No. 9 represents any one of the nucleotides T or C; The SNP4 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 183rd nucleotide in SEQ ID No: 13 in the sequence listing, which is T or C, and the letter Y in SEQ ID No: 13 represents any one of the nucleotides T or C.
2. Application of the SNP site in identifying or assisting in identifying the Fritillaria cirrhosa D. Don original species of Fritillaria delavayi Franch, characterized in that: The SNP site is SNP1; The SNP1 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 66th nucleotide in SEQ ID No: 1 in the sequence listing, which is A or G, and the letter R in SEQ ID No: 1 represents any one of the nucleotides A or G.
3. Application of the SNP site in identifying or assisting in identifying the original species of Fritillaria cirrhosa D. Don and / or Fritillaria delavayi Franch, characterized in that: The SNP site is SNP2; The SNP2 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 58th nucleotide in SEQ ID No: 5 in the sequence listing, which is A or G, and the letter R in SEQ ID No: 5 represents any one of the nucleotides A or G.
4. Application of the SNP site in identifying or assisting in identifying the original species of Fritillaria cirrhosa D. Don, F. wallichii and / or F. delavayi, characterized in that: The SNP site is SNP3; The SNP3 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 85th nucleotide in SEQ ID No: 9 in the sequence listing, which is T or C, and the letter Y in SEQ ID No: 9 represents any one of the nucleotides T or C.
5. Application of the SNP site in identifying or assisting in identifying the radix of Fritillaria of Taibei Fritillaria, characterized in that: The SNP site is SNP4; The SNP4 is a SNP of the chloroplast genome of the original species bulb of Fritillaria cirrhosa, which is the 183rd nucleotide in SEQ ID No: 13 in the sequence listing, which is T or C, and the letter Y in SEQ ID No: 13 represents any one of the nucleotides T or C.
6. Use according to any one of claims 1 to 5, characterized in that: The SNP site also includes SNP5; the SNP5 is a SNP of the genome of the species of Fritillaria in the Lily family, which is the 41st nucleotide in SEQ ID No: 17 in the sequence listing, which is T or C, and the letter Y in SEQ ID No: 17 represents any one of the nucleotides T or C.
7. Use of a substance for detecting polymorphism for identifying or aiding in the identification of Fritillaria cirrhosa base stock, characterized in that: The polymorphism is a combination of the four SNPs SNP1, SNP2, SNP3 and SNP4 in the chloroplast genome of the original species bulb of Fritillaria cirrhosa; The SNP1 is a SNP of the chloroplast genome of the base species bulb of Fritillaria cirrhosa, which is the 66th nucleotide in SEQ ID No:1 in the sequence listing, and is A or G, and the letter R in SEQ ID No:1 represents any one of the nucleotides A or G; The SNP2 is a SNP of the chloroplast genome of the base species bulb of Fritillaria cirrhosa, which is the 58th nucleotide in SEQ ID No:5 in the sequence listing, and is A or G, and the letter R in SEQ ID No:5 represents any one of the nucleotides A or G; The SNP3 is a SNP of the chloroplast genome of the base species bulb of Fritillaria cirrhosa, which is the 85th nucleotide in SEQ ID No:9 in the sequence listing, and is T or C, and the letter Y in SEQ ID No:9 represents any one of the nucleotides T or C; The SNP4 is a SNP of the chloroplast genome of the base species bulb of Fritillaria cirrhosa, which is the 183th nucleotide in SEQ ID No:13 in the sequence listing, and is T or C, and the letter Y in SEQ ID No:13 represents any one of the nucleotides T or C.
8. Use according to any one of claim 7, characterized in that: The polymorphism also includes the polymorphism of SNP5; the SNP5 is a SNP of the genome of the species of the genus Fritillaria in the Liliaceae family, which is the 41th nucleotide in SEQ ID No:17 in the sequence listing, and is T or C, and the letter Y in SEQ ID No:17 represents any one of the nucleotides T or C.