A KASP molecular marker, primer set, kit and application related to corn kernel protein content

Abstract

The present invention relates to the field of molecular genetics technology, and in particular to a KASP molecular marker, a primer set, a kit and applications related to corn kernel protein content. The KASP molecular marker of the present invention is located on chromosome 7 SYN21579_Chr7_5211731 of the corn B73RefGen_v4 reference genome. The present invention uses corn DNA to be detected as a template, utilizes a primer set or a kit to perform fluorescent quantitative PCR amplification, and determines the genotype and protein content of the corn kernels based on the fluorescence detection results after amplification, thereby evaluating the protein content of the corn kernels. This provides a new method for predicting, identifying or assisting in the identification of kernel protein content or breeding new corn varieties with high kernel protein content.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and in particular to a KASP molecular marker related to corn kernel protein content, a primer set, a kit and applications. Background Art

[0002] Corn is primarily used as feed (as an ingredient for pigs, chickens, cattle, and sheep) to produce meat, eggs, and milk. However, corn kernels contain only about 8% protein, necessitating the addition of soybean meal to feed. Therefore, increasing corn protein content could alleviate protein shortages and reduce feed costs. However, few molecular markers are available for increasing corn protein content.

[0003] Maize protein content is a complex trait controlled by multiple genes. Protein content is negatively correlated with grain yield, and in modern breeding processes where yield is the primary goal, protein content is not targeted for selection. By measuring the protein content of maize germplasm resources and combining them with genotype data for genome-wide association analysis, molecular markers for maize kernel protein can be discovered and identified. This allows for the rapid identification of materials with high kernel protein content, facilitating the screening of high-protein maize materials and the breeding of new varieties. KASP (Kompetitive Allele Specific PCR) genotyping is a fluorescence-based marker used to identify single nucleotide polymorphism (SNP) variant sites. It is a new generation of SNP typing markers that has been applied in a variety of crops.

[0004] Compared to the rice genome, which only comprises approximately 30.68% repetitive sequences, the maize genome comprises approximately 85% of complex and highly repetitive sequences. This poses significant challenges to the identification of protein content-related SNP markers and the development of KASP markers. Firstly, due to the presence of repetitive sequences, SNPs may have multiple homologous copies, which can easily lead to false-positive association signals and complicate the identification of SNP markers truly associated with grain protein content. Secondly, KASP markers rely on the design of specific primers upstream and downstream of the SNP. However, within repetitive sequence regions, primer binding sites can be widely present at multiple locations across the genome, leading to nonspecific amplification. Therefore, SNPs with repetitive flanking sequences must be strictly excluded. However, since the flanking sequences of most SNPs are not unique, primer design presents significant challenges. Furthermore, repetitive sequences increase the technical error rate during KASP detection, affecting the accuracy and stability of the results. Summary of the Invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a KASP molecular marker, primer set, kit and application related to corn kernel protein content, which can be used for rapid batch screening of high-protein corn materials and varieties in the field of corn molecular genetics technology.

[0006] In order to solve the above problems, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a KASP molecular marker related to corn grain protein content, wherein the KASP molecular marker is located at chromosome 7 SYN21579_Chr7_5211731 of the corn B73RefGen_v4 reference genome.

[0008] Furthermore, the base difference of the KASP molecular marker is A / G, and it is located on the 9th intron of gene Zm00001d018787.

[0009] Furthermore, when the KASP molecule is labeled A, the protein content of the corn grain is low, and when the KASP molecule is labeled G, the protein content of the corn grain is high.

[0010] In a second aspect, the present invention provides a primer set for detecting KASP molecular markers related to the corn grain protein content, the primer set comprising forward primers with nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 and a reverse primer with a nucleotide sequence shown in SEQ ID NO.3.

[0011] Furthermore, the forward primer includes a FAM fluorescent linker sequence universal tag and a HEX fluorescent linker sequence universal tag.

[0012] In a third aspect, the present invention provides a kit for detecting KASP molecular markers related to the corn kernel protein content, comprising the primer set.

[0013] In a fourth aspect, the present invention provides a method for detecting the KASP molecular marker related to the protein content of corn kernels, comprising: using the corn DNA to be detected as a template, performing fluorescent quantitative PCR amplification using the primer set or the kit, and judging the genotype and protein content of the corn kernels based on the fluorescence detection results after amplification.

[0014] Furthermore, the amplification program of the fluorescent quantitative PCR amplification is as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each time; denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, 30 cycles; fluorescent quantitative PCR at 37°C for 60 s, and collecting fluorescence signals.

[0015] Furthermore, the method of judging the genotype and protein content of corn kernels based on the fluorescence detection results after amplification includes: if the universal tag FAM fluorescent linker sequence is detected, the genotype is AA, and the corresponding corn material has a low protein content in the kernel; if the universal tag HEX fluorescent linker sequence is detected, the genotype is GG, and the corresponding corn material has a high protein content in the kernel; if the universal tag FAM and HEX fluorescent linker sequences are detected at the same time, the genotype is AG, and the corresponding corn kernel protein content is at an intermediate level.

[0016] In a fifth aspect, the present invention provides applications of the KASP molecular marker, the primer set, or the kit, including any one of the following applications:

[0017] Application in identifying or screening corn varieties with high protein content;

[0018] Application in molecular marker-assisted breeding of maize;

[0019] Application in improving maize germplasm resources;

[0020] Application in detecting and predicting protein content in corn kernels.

[0021] The beneficial effects of the present invention are:

[0022] The present invention obtains a polymorphic SNP marker site associated with the maize grain protein content trait through whole genome association analysis. The SNP marker site is located at position 5211731 of chromosome 7 of the reference maize B73 Ref_Gen_V4 genome, and has a nucleotide polymorphism A / G, where G is a dominant trait.

[0023] The present invention develops a new molecular marker for corn kernel protein content. The KASP typing technology can be used to quickly perform genotyping, with accurate and efficient detection and convenient and stable amplification. It can be used for molecular marker-assisted selection and plays a very important role in predicting, identifying or assisting in the identification of kernel protein content or breeding new corn varieties with high kernel protein content. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The results of genome-wide association analysis of maize grain protein content, Manhattan plot and QQ plot based on BLINK model analysis.

[0025] Figure 2 This is a box plot of the analysis of corn kernel protein content corresponding to different genotypes at the SYN21579_Chr7_5211731 locus of 273 corn inbred lines.

[0026] Figure 3The results of KASP genotyping of protein content in 93 maize materials are shown in Figure 2. The horizontal axis FAM fluorescence represents the genotype AA; the vertical axis HEX fluorescence represents the genotype GG, and NTC is represented by gray squares. DETAILED DESCRIPTION

[0027] The present invention will be further described in detail below with reference to specific embodiments.

[0028] It should be noted that these embodiments are only used to illustrate the present invention, rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention fall within the scope of protection claimed by the present invention.

[0029] Unless otherwise specified, the techniques used in the examples are all conventional methods. The reagents used in the examples, unless otherwise specified, can be obtained from commercial sources.

[0030] Example 1 GWAS analysis and haplotype analysis of corn kernel protein content

[0031] 1.1 Field experiment design

[0032] The 273 inbred lines used in this study were introduced from the Crop Science Institute of the Chinese Academy of Agricultural Sciences and have a rich genetic background and a wide range of sources. Plantings were conducted in 2015 at the Sanya Nanfan Base of the Jiangsu Academy of Agricultural Sciences. Each material was planted in one row, with a 3-meter row length, 0.6-meter row spacing, and 0.25-meter plant spacing, with two replicates. Field management followed the same principles as for field management.

[0033] 1.2 Phenotypic data

[0034] The protein content of corn kernels selected by the present invention is obtained by continuously selecting 5 ears from the middle of each plot for harvesting, measuring the kernel protein content after each ear is threshed individually, and taking the average protein content of the 5 ears as the protein content of the material in this repetition, and taking the protein content of two repetitions as the protein content of the material.

[0035] 1.3 GWAS analysis and identification of SNP sites

[0036] GWAS analysis was performed using the Illumina MaizeSNP50 BeadChip genotype data from 273 inbred lines, combined with the phenotypic values ​​of maize kernel protein content determined above, using the BLINK model in the R package GAPIT3. A Bonfereoni correction was used, with a threshold of -LOG10 (P-value) = 6 to identify significantly associated SNPs. A significant locus was identified on chromosome 7, SYN21579_Chr7_5211731 (see for details). Figure 1This SNP was significantly associated with kernel protein content in maize. Its nucleotide sequence was A / G, with a -LOG10 (P-value) of 8.3, explaining 16.65% of the phenotypic variation, and a minimum allele frequency of 0.4396. Information on this SNP is shown in Table 1.

[0037] Table 1 Information on SNPs significantly associated with maize kernel protein content

[0038]

[0039] 1.4 Haplotype analysis

[0040] Combining SNP variant sites with haplotype analysis of grain protein content in 273 tested maize materials ( Figure 2 Among them, SNP site variation typing was divided into two categories, specifically based on the A / G base difference. 153 materials with the GG genotype had an average grain protein content of 12.54%, and 120 materials with the AA genotype had an average grain protein content of 11.95%. The difference in protein content between the two haplotypes and corn kernels was 2.45E-5, reaching an extremely significant difference (P < 0.01). The protein content of corn materials with the GG genotype was extremely significantly higher than that of the AA genotype.

[0041] Example 2 Development and application of KASP molecular markers related to corn kernel protein content

[0042] 2.1 Test materials

[0043] 93 samples with differences in grain protein content were screened and the developed KASP molecular marker was used to verify its accuracy. Sequencing was also performed on two samples of each of the AA and GG genotypes. The sequencing results of the SNP sites were consistent with the KASP test results, showing highly significant differences in protein content between the AA and GG genotypes at the SNP sites.

[0044] 2.2 Development of KASP Markers

[0045] Based on the aforementioned SNP site information, a SNP variant exists at position 5211731 on chromosome 7 of the reference genome B73 Ref_Gen_v4, with an A / G polymorphism. 100 bp of flanking sequence were extracted from this site and primers were designed. The KASP marker consists of three primers: two specific forward primers (SEQ ID NO. 1 and SEQ ID NO. 2) and one universal reverse primer (SEQ ID NO. 3). The primers were synthesized by Shanghai Bioengineering. The primer sequences are as follows:

[0046] SYN21579_Chr7_5211731_F(SEQ ID NO.1):

[0047] 5'-GAAGGTGACCAAGTTCATGCTACTCACACTGGATCCAAGAATTAGTA-3';

[0048] SYN21579_Chr7_5211731_H(SEQ ID NO.2):

[0049] 5'-GAAGGTCGGAGTCAACGGATTACTCACACTGGATCCAAGAATTAGTG-3';

[0050] SYN21579_Chr7_5211731_R(SEQ ID NO.3):

[0051] TCTGTTATTGCGTCCCCTTCAATA;

[0052] Among them, GAAGGTGACCAAGTTCATGCT is the universal tag of FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the universal tag of HEX fluorescent linker sequence.

[0053] 2.3 DNA extraction

[0054] 93 maize leaves were used as materials for DNA extraction using the CATB method. The detailed steps are as follows:

[0055] (1) Take about 5 g of leaves, place them in a 2 ml centrifuge tube, add two sterilized steel balls, freeze them in liquid nitrogen, and quickly place them in an automatic sample grinder and shake for 30 seconds;

[0056] (2) Add 800 μL of heated CTAB buffer (mercaptoethanol added), stir gently and shake well;

[0057] (3) Place in a 65°C water bath, invert the sample every 10 minutes to mix, and remove after 30 minutes;

[0058] (4) After the sample is taken out and cooled to room temperature, add 800 μL of chloroform:isoamyl alcohol (24:1), shake well, and centrifuge at 12000 rpm for 15 min;

[0059] (5) Pipette the supernatant into a 2 ml centrifuge tube, add 600 μl of isopropanol, shake well, place at -20°C for 20 min, and centrifuge at 12,000 rpm for 15 min at 4°C;

[0060] (6) Add 800 μl of 70% ethanol and suspend the precipitate; centrifuge at 12,000 rpm for 10 min at room temperature;

[0061] (7) Discard the supernatant and add 1 ml of anhydrous ethanol to suspend the precipitate; centrifuge at 12000 rpm for 10 min, open the lid and return to room temperature. After the residual ethanol evaporates, add 50 μL of ddH2O to dissolve the DNA;

[0062] (8) Agarose power test: 1% agarose gel (60V power supply for 35 minutes) was used to detect DNA integrity. NanoDrop was used to measure the concentration of all DNA samples and the OD value 260 / 280 ratio was evaluated to be between 1.8 and 2.0.

[0063] 2.4 KASP classification

[0064] Dilute all test sample DNA to 30 ng / μl for KASP analysis. KASP molecular marker PCR amplification reaction system: 5 μl of KASP 2X PCR mix, 0.5 μl of primer premix (10 μM primers SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 mixed in a 2:2:5 volume ratio), 4.5 μl of template DNA, for a total reaction volume of 10 μl.

[0065] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min; the first amplification reaction was denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, and cycled 10 times, with the annealing and extension temperature decreasing by 0.6°C each time; the second amplification reaction was denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, and cycled 30 times.

[0066] After the reaction, PCR products were obtained and fluorescence was collected at 37 degrees using a QuantStudio™ Design Analysis Software v1.5.2 real-time quantitative PCR instrument. The PCR products were then typed. The typing results were compared with the SYN21579_Chr7_5211731 sequencing results. It was found that the site variation detected by the KASP molecular marker was consistent with the sequencing results, indicating that the KASP marker for this SNP site was successfully developed ( Figure 3 ).

[0067] According to the color classification displayed by the fluorescence quantitative PCR instrument, the samples aggregated close to the X-axis are the genotype AA connected to the FAM fluorescent label sequence, displayed as a red circle; the samples aggregated close to the Y-axis are the GG genotype connected to the HEX fluorescent label sequence, displayed as a yellow circle, and the control NTX is represented by a gray square.

[0068] The actual situation is consistent with the expectation, so the KASP molecular marker of the present invention can effectively identify the kernel protein content of corn and can be used for the prediction and screening of the kernel protein content of corn.

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes can be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A method for detecting KASP molecular markers related to corn kernel protein content, characterized in that: include: Using the maize DNA to be tested as a template, a primer set or kit for detecting the KASP molecular marker related to the protein content of maize kernels is used for fluorescence quantitative PCR amplification. The genotype and protein content of the maize kernels are determined based on the fluorescence detection results after amplification. The KASP molecular marker is located at SYN21579_Chr7_5211731 on chromosome 7 of the maize B73RefGen_v4 reference genome. The base difference of the KASP molecular marker is A / G, located on the 9th intron of gene Zm00001d018787; The corn kernels with the KASP molecule labeled A have a lower protein content, while the corn kernels with the KASP molecule labeled G have a higher protein content.

2. The method according to claim 1, characterized in that The primer set includes forward primers with nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO.2 and a reverse primer with nucleotide sequence shown as SEQ ID NO.

3.

3. The method according to claim 2, characterized in that The forward primer includes a FAM fluorescent linker sequence universal tag and a HEX fluorescent linker sequence universal tag.

4. The method according to claim 1, wherein The kit includes the primer set.

5. The method according to claim 1, wherein The amplification program of the fluorescent quantitative PCR amplification is as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each time; denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, 30 cycles; fluorescent quantitative PCR at 37°C for 60 s, and collecting fluorescence signals.

6. The method according to claim 5, characterized in that The method of judging the genotype and protein content of corn kernels based on the fluorescence detection results after amplification includes: if the universal tag FAM fluorescent linker sequence is detected, the genotype is AA, and the corresponding corn kernel protein content is low; if the universal tag HEX fluorescent linker sequence is detected, the genotype is GG, and the corresponding corn kernel protein content is high; if the universal tag FAM and HEX fluorescent linker sequences are detected at the same time, the genotype is AG, and the corresponding corn kernel protein content is at an intermediate level.

7. Use of the primer set or the kit according to claim 1, characterized in that: This includes any of the following applications: Application in identifying or screening corn varieties with high protein content; Application in detecting and predicting protein content in corn kernels.

Images