Primer combination for HIV-1 integrase drug resistance detection based on next-generation sequencing technology and application and kit thereof
Through the combination of primers based on second-generation sequencing technology and the optimization detection process, the shortcomings of HIV-1 integrase resistance detection are solved, low-cost and efficient drug resistance detection are achieved, and a large amount of data is provided for analyzing drug-resistant strains and guiding AIDS prevention and control.
Patent Information
- Application Number
- CN202510646754.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-07-22
AI Technical Summary
The prior art lacks efficient and accurate HIV-1 integrase resistance detection methods, especially inadequate monitoring of integrase inhibitor resistance, which affects the effectiveness of antiviral treatment and AIDS prevention and control.
The primer combination based on second-generation sequencing technology, including IN-Mix-PLA and deep sequencing primer combination, optimized the detection process, so that CDNA synthesis and nested PCR are completed in the same reaction system, sequence determination is performed in combination with the Illumina HiSeq PE300 platform, and drug-resistant mutations are analyzed using SnpEff software.
A low-cost and efficient HIV-1 integrase resistance detection has been achieved. A single sample can produce more than 1,500 sequences, providing sufficient data resources for analyzing advantageous and disadvantageous drug-resistant strains and guiding antiviral treatment.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly to a primer combination for detecting HIV-1 integrase drug resistance based on next-generation sequencing technology, its application and kit. The core content is the establishment and sequencing of a method for detecting small fragments of the HIV-1 integrase gene amplicon, and then using the freely available and open HIV-1 drug resistance database to analyze the degree of variation of the integrase gene in the obtained sequence, so as to obtain the proportion of mutation sites resistant to HIV-1 integrase inhibitors (Integrase inhibitors, INSTIs). The greatest advantage of the primer combination provided by the present invention is that it can detect disadvantageous drug-resistant mutations with a proportion ≤ 20%, so as to better guide antiviral treatment. Background Art
[0002] In order to respond to the three 90% prevention and control goals proposed by the WHO and reach the three 95% goals by 2030, antiretroviral therapy (ART) has been widely promoted and applied globally as a prevention and control means, which effectively delays the disease progression of HIV-1 infected individuals and controls the rapid spread of AIDS. As of the end of 2022, more than 29.8 million HIV-infected individuals globally have received ART, which has played a positive role in virus suppression and immune reconstruction in infected individuals. It has made indelible contributions to improving the quality of life of AIDS patients, extending the life cycle, and reducing the spread of AIDS.
[0003] With the wide application of ART, the problem of HIV-1 drug resistance has become increasingly prominent, especially pretreatment HIV drug resistance (PDR), which has become a key issue in the field of AIDS prevention, control and treatment. The authoritative journal "The Lancet - HIV" reported that a census of drug resistance in newly diagnosed HIV-1 infected individuals carried out in Mexico in 2015 showed that approximately 10% of newly diagnosed infected individuals had PDR, and the drug resistance was mainly concentrated in non-nucleoside reverse transcriptase inhibitors (Non-Nucleoside Reverse Transcriptase Inhibitors, NNRTIs); the HIV-1 drug resistance reports of 18 countries published by the WHO pointed out that the NNRTI PDR in 12 countries exceeded 10%; among 14 countries, the NNRTIs PDR in both male and female populations exceeded 10%. After the HIV virus develops drug resistance, although the virus replication ability changes, the drug-resistant strains still maintain strong vitality under the drug selection pressure, and the damage to the body's immune system continues to intensify. In addition, the spread and prevalence of drug-resistant strains will also bring unprecedented difficulties to the prevention and control of AIDS.
[0004] Compared with other antiviral drugs, integrase inhibitors (INSTIs) have obvious advantages such as good safety and tolerance, rapid inhibition of virus replication, and strong inhibitory activity. In 2018, the treatment regimen containing dolutegravir (DTG) was recommended by the World Health Organization (WHO) as the preferred regimen for the initial antiviral treatment of adults and children infected with HIV. The updated guidelines in 2019 recommended further expanding the application of DTG and using it for the treatment of pregnant women and patients co-infected with tuberculosis. TDF + 3TC (or FTC) + DTG was recommended as the preferred regimen for the initial antiviral treatment of adults and adolescents infected with HIV, ABC + 3TC + DTG was recommended as the preferred regimen for the initial antiviral treatment of children infected with HIV, and AZT + 3TC + RAL was the preferred treatment regimen for neonates infected with HIV. In China, RAL and DTG have also been approved for clinical use. The 2018 edition of the Chinese Guidelines for the Diagnosis and Treatment of AIDS first recommended 2 NRTIs combined with NNRTIs, or enhanced PIs, or INSTIs as the first-line treatment regimen for naïve patients. With the widespread application of INSTIs in the fields of treatment and prevention, there is a potential risk of drug resistance. At present, more than 20 drug resistance-related gene mutations in the HIV-1 integrase gene region have been identified, which have different degrees of impact on the drug sensitivity and replication fitness of the virus, and it is necessary to strengthen monitoring and detection. In British Columbia, Canada, continuous monitoring was carried out on patients with antiviral treatment failure (HIV RNA load > 250 cp / ml) from 2009 to 2016. The prevalence of INSTI-resistant strains increased from 1 / 1000 in 2009 to 7 / 1000 in 2016. A study evaluated the HIV drug resistance in the MSM population in the HPTN078 project. Blood specimens of HIV-infected individuals in 1305 MSM populations with incomplete virus suppression were collected in 4 cities in the United States. Specimens with a virus load > 1000 copies / ml were amplified and sequenced for HIV protease, reverse transcriptase (RT, amino acids 1 - 335), and integrase gene, and the Stanford v8.7 algorithm was used to interpret the results. Among 138 people, 11 (8.0%) were detected to be INSTI-resistant. It is suggested that highly prevalent HIV-resistant strains, including INSTI resistance and even resistance to second-generation INSTIs, exist in the MSM population in different regions of the United States. In the HIV drug-resistant strain prevalence monitoring report carried out in China in 2014, drug resistance was mainly against NRTIs, NNRTIs, and PIs, and there was little research on INSTI resistance.Subsequent molecular epidemiological investigation results of 531 HIV-1 infected individuals in 14 prefectures (cities) of Yunnan Province from 2015 to 2016 showed that among the infected individuals who had not received antiviral treatment with INSTI-containing regimens, 29 cases with IN region gene mutations were detected, among which 9 cases showed INSTIs resistance, and the resistance rate reached 1.7%; Song Chang et al. reported that in 2018, a molecular epidemiological investigation was conducted on 755 HIV-infected individuals before antiviral treatment in 6 provinces of China, and integrase inhibitor-related drug resistance gene mutations were detected in 6 of them, and the resistance rate reached 0.8%; Liu Jianfeng et al. also detected polymorphic mutation sites of INSTIs in plasma and PBMC samples of HIV-infected individuals without antiviral treatment, and Wang Xin et al. reported the detection of transmissible drug-resistant strains related to INSTIs.
[0005] The use scope of integrase inhibitors in China is expanding day by day, mainly used for antiviral treatment and pre- and post-exposure prophylaxis of HIV. However, the research on drug resistance of integrase inhibitors is almost blank, the mutations leading to drug resistance have not been fully understood, especially there is no mature and available detection method. An efficient and accurate detection method and analysis results can provide a basis for formulating effective antiviral treatment regimens in clinical treatment, and can also be used for epidemiological monitoring of drug-resistant strains, including the monitoring of the occurrence and prevalence of drug-resistant strains. Summary of the Invention
[0006] To solve the above problems, the present invention provides a primer combination for detecting HIV-1 integrase drug resistance based on next-generation sequencing technology, and its applications and kits. By improving the previous HIV-1 integrase drug resistance detection method and optimizing the combination of previous detection primers, a new HIV-1 IN drug resistance detection primer system is re-formed, which can achieve the detection of drug resistance-related mutation sites in the full-length gene of HIV-1 integrase (Integrase, IN). The main strategy is to optimize the existing detection method so that the cDNA synthesis of IN and the first-round amplification of nested PCR are completed in the same reaction system, which can avoid nucleic acid contamination that may be caused by repeated nucleic acid aspiration in the traditional method; the second-round amplification of nested PCR uses the first-round amplification product as the template DNA, and in this round of detection, Barcode sequences for subsequent analysis are added to the head and tail of the commonly used detection primers for the second-round amplification reaction. The amplified target gene products are purified and quantified, and multiple samples are mixed (the standard mixed sample is 96 samples), and then the mixed samples are sent to Novogene for sequence determination. The platform used is Illumina HiSeq PE300, which can achieve paired-end sequencing, and at least 500 bp can be measured at both the head and the tail. The complete IN gene sequence can be formed by connecting the head and tail sequences, and the final number of sequences obtained can reach 2500 - 35000 reads / sample. Then, through the SnpEff biological analysis software, the frequency of drug resistance mutations at the key sites of IN is statistically analyzed, so as to obtain the occurrence of drug resistance in the integrase gene.
[0007] The above-mentioned detection primers can be retrieved from publicly published literature and are not within the protection scope of the present invention; subsequent sequence determination and sequence analysis using bioinformatics software belong to commercial companies and software developers and are not within the protection scope of the present invention; however, the connection of detection primers with the Barcode for deep sequencing and the detection reaction system have not been publicly reported in all current literatures and are the key protection scope of the present invention.
[0008] To achieve the above object, the present invention provides the following technical solutions:
[0009] The present invention provides a primer combination for detecting HIV-1 integrase drug resistance based on next-generation sequencing technology, and the primer combination includes any one of IN-Mix-PLA primers and deep sequencing primer combinations;
[0010] The nucleotide sequences of the primers in the IN-Mix-PLA primers are as shown in SEQ ID No.1 - 4;
[0011] The deep sequencing primer combination includes IN1-DP-PLA primer combination, IN2-DP-PLA primer combination, and IN1-DP-PLA primer combination;
[0012] The nucleotide sequences of the primers in the IN1-DP-PLA primer combination are shown in SEQ ID No. 5-6;
[0013] The nucleotide sequences of the primers in the IN2-DP-PLA primer combination are shown in SEQ ID No. 7-8;
[0014] The nucleotide sequences of the primers in the IN3-DP-PLA primer combination are shown in SEQ ID No. 9-10.
[0015] The present invention also provides the application of the primer combination described in the above technical solution in the preparation of an HIV-1 integrase drug resistance detection reagent.
[0016] Preferably, when the primer combination is used for HIV-1 integrase drug resistance detection, the IN-Mix-PLA primer is used for the first round of RT-PCR amplification to obtain the first-round amplification product.
[0017] Preferably, the reaction system for the first-round amplification is: PrimeScript 1Step Enzyme Mix 1 μL, 2×1Step Buffer 12.5 μL, IN1-DP-PLA primer combination with a concentration of 20 μΜ for each primer 1 μL, RNA template 10 μL, RNAFree H2O 0.5 μL.
[0018] Preferably, the program for the first-round amplification is: 50°C for 32 min; 94°C for 2 min; 94°C for 30 s, 53°C for 45 s, 72°C for 2 min, 30 cycles; 72°C for 10 min.
[0019] Preferably, when the primer combination is used for HIV-1 integrase drug resistance detection, the deep sequencing primer combination is used for the second round of RT-PCR amplification.
[0020] Preferably, the reaction system for the second-round RT-PCR amplification is: Ex Taq Premix Mixture 25 μL, deep sequencing primer combination with a concentration of 20 μΜ for both 2 μL, first-round amplification product 3 μL, RNase Free ddH2O 20 μL; the reaction system is used for the amplification of the target gene.
[0021] Preferably, the program for the second-round amplification is: 94°C for 5 min; 94°C for 30 s, 53°C for 45 s, 72°C for 1 min, 3 cycles; 94°C for 30 s, 56°C for 45 s, 72°C for 1 min, 32 cycles; 72°C for 1 min.
[0022] The present invention also provides a kit for detecting HIV-1 integrase drug resistance based on next-generation sequencing technology, and the kit contains the primer combination described in the above technical solution.
[0023] The present invention also provides the application of the kit described in the above technical solution in the preparation of HIV-1 integrase drug resistance detection products.
[0024] Beneficial effects:
[0025] Based on the current HIV-1 strain integrase drug resistance detection method in China and combined with deep sequencing technology, the present invention uses the described primer combination to establish a new HIV-1 integrase drug resistance detection method. The advantages are as follows: ① The cost of HIV drug resistance detection is greatly reduced. In the current detection, according to the principle of non-repetitive Barcode, 96 samples can be mixed in each reaction tube; coupled with different detection primers, more samples can be mixed, so that the results of multiple different samples can be produced in one reaction, thus greatly reducing the sequencing cost; ② More than 1500 sequences can be produced for a single sample, which provides sufficient data resources for analyzing the dominant drug-resistant strains and inferior drug-resistant strains of HIV-1 and can provide strong guidance for subsequent antiviral treatment. The new HIV-1 integrase inferior drug-resistant strain drug resistance detection method established by the present invention makes HIV-1 drug resistance detection a low-cost and high-output method, which has a significant impact on AIDS prevention and control and public health. Specific embodiments
[0026] The present invention provides a primer combination for detecting HIV-1 integrase drug resistance based on next-generation sequencing technology. The primer combination includes any one of IN-Mix-PLA primers and deep sequencing primer combinations; the nucleotide sequences of the primers in the IN-Mix-PLA primers are shown as SEQ ID No.1-4; the deep sequencing primer combination includes IN1-DP-PLA primer combination, IN2-DP-PLA primer combination and IN1-DP-PLA primer combination; the nucleotide sequences of the primers in the IN1-DP-PLA primer combination are shown as SEQ ID No.5-6; the nucleotide sequences of the primers in the IN2-DP-PLA primer combination are shown as SEQ ID No.7-8; the nucleotide sequences of the primers in the IN3-DP-PLA primer combination are shown as SEQ ID No.9-10.
[0027] The synthesis of the primers intended for deep sequencing in the present invention is as follows:
[0028] Screen primers for HIV IN drug resistance detection in the early stage, identify the primer combination IN-Mix-PLA that can meet the full-length drug resistance sites in the IN gene region. The detection region covers the full-length IN gene (from the 1st amino acid codon to the 288th amino acid codon). The strategic plan is to optimize the primer combination disclosed in the literature that can amplify the full-length IN gene. The base composition is shown in Table 1. Then, the full-length gene is split into three amplicons with a base length ≤ 500bp. The primer combinations used for the three amplicons are IN1-PLA, IN2-PLA, and IN3-PLA respectively, and the sequence composition is shown in Table 2. Couple IN1-PLA, IN2-PLA, and IN3-PLA with the commercial Barcode sequence for deep sequencing, and name them IN1-DP-PLA, IN2-DP-PLA, and IN3-DP-PLA respectively, to form a complete deep sequencing primer combination for detecting key drug resistance sites in IN (the sequences are shown in Tables 3, 4, and 5). Submit the sequences to Tianyi Huiyuan Biotechnology Co., Ltd. for sequence synthesis. Dilute the synthesized gene sequences into 20μΜ working solutions, take 100μL of the upstream and downstream primers respectively for equal-volume mixing, and then transfer them to a 96-well plate. The primer sequences corresponding to each well are shown in Tables 3, 4, and 5. Seal the 96-well plate with a sealing membrane and store it at -20°C for standby.
[0029] Table 1 Base composition of primers for amplifying the full-length HIV-1 IN gene
[0030]
[0031]
[0032] In its sequence, R is A / G, Y is C / T, D is A / T / G, and W is A / T.
[0033] Table 2 Base composition of primers used in the first round of RT-PCR for HIV-1 drug resistance detection
[0034]
[0035] ⑵ Using the total RNA of the virus to be tested as a template, formulate the primers shown in Sequence Table 1 in proportion to form the primer combination IN-Mix-PLA, and then perform the synthesis of cDNA and the first round of amplification of nested PCR to obtain the first-round PCR amplification product.
[0036] ⑶ After the first round of PCR, using the amplification product of the first round of PCR as a template, adopt a segmented amplification method, that is, use primer combinations IN1-DP-PLA, IN2-DP-PLA, and IN3-DP-PLA for the second round of PCR amplification respectively. Among them, the expected length of the detection fragment of primer combination IN1-DP-PLA is 444bp, the expected length of the detection fragment of primer combination IN2-DP-PLA is 500bp, and the expected length of the detection fragment of primer combination IN1-DP-PLA is 348bp. After the amplification, if the specific DNA fragments of 444bp, 500bp, and 348bp are respectively present in the second-round PCR amplification product, it indicates that the specific target gene fragment has been effectively amplified.
[0037] ⑷ Purification and recovery of the target gene fragment: Use the N96 DNA product purification kit of Beijing Tiangen Biotech Co., Ltd. to purify the target gene fragment obtained by the second round of nested PCR, and then proceed with nucleic acid quantification. Mix and set aside using 3μg / sample of nucleic acid amount as the standard.
[0038] ⑸ Hand over the mixed samples to Novogene for sequence determination using the Illumina HiSeq PE300 sequencing platform. The subsequent obtained results are analyzed using the SnpEff biological analysis software, and the frequency of drug-resistant mutations occurring at the IN key sites is statistically analyzed, so as to analyze the composition ratio of the inferior drug-resistant strains in the patient's body.
[0039] SEQ ID No.5: ATGGGTACCAGCACACAAAGG;
[0040] SEQ ID No.6: TTTTACTGGCCATCTTCCTGCT.
[0041] Table 3 Primer combination system IN1-DP-PLA (SEQ ID No.5 - 6) formed by coupling IN1-PLA with different Barcodes
[0042]
[0043]
[0044]
[0045] SEQ ID No.7: ACAGGGCAGGAAACAGCATA;
[0046] SEQ ID No.8: TGCCCCTTCACCTTTCCAGA.
[0047] Table 4 Primer combination system IN2-DP-PLA (SEQ ID No. 7-8) formed by coupling IN2-PLA with different Barcodes
[0048]
[0049]
[0050]
[0051] SEQ ID No. 9: TCCTCTGGAAAGGTGAAGGG;
[0052] SEQ ID No. 10: TCCTGTATGCARACCCCAATATG.
[0053] Table 5 Primer combination system IN3-DP-PLA (SEQ ID No. 9-10) formed by coupling IN3-PLA with different Barcodes
[0054]
[0055]
[0056]
[0057]
[0058]
[0059] The present invention also provides the application of the primer combination described in the above technical solution in the preparation of an HIV-1 integrase drug resistance detection reagent.
[0060] In the present invention, when the primer combination is used for HIV-1 integrase drug resistance detection, the IN-Mix-PLA primer is used for the first round of RT-PCR amplification to obtain the first-round amplification product. In the present invention, the reaction system for the first-round amplification is preferably: 1 μL of PrimeScript 1Step Enzyme Mix, 12.5 μL of 2×1Step Buffer, 1 μL of the IN1-DP-PLA primer combination with a concentration of 20 μΜ for each primer, 10 μL of RNA template, and 0.5 μL of RNA Free H2O. In the present invention, the program for the first-round amplification is preferably: 50°C for 32 min; 94°C for 2 min; 94°C for 30 s, 53°C for 45 s, 72°C for 2 min, for 30 cycles; 72°C for 10 min.
[0061] In the present invention, when the primer combination is used for HIV-1 integrase drug resistance detection, the deep sequencing primer combination is used for the second round of RT-PCR amplification. In the present invention, the reaction system for the second round of RT-PCR amplification is preferably: 25 μL of Ex Taq Premix Mixture, 2 μL of the deep sequencing primer combination with a concentration of 20 μΜ each, 3 μL of the first-round amplification product, and 20 μL of RNase Free ddH2O. In the present invention, the reaction system is mainly used for the amplification of the target gene. In the present invention, the program for the second-round amplification is preferably: 94 °C for 5 min; 94 °C for 30 s, 53 °C for 45 s, 72 °C for 1 min, for 3 cycles; 94 °C for 30 s, 56 °C for 45 s, 72 °C for 1 min, for 32 cycles; 72 °C for 1 min.
[0062] The present invention also provides a kit for HIV-1 integrase drug resistance detection based on the second-generation sequencing technology according to the above technical solution, and the kit contains the primer combination according to the above technical solution.
[0063] The present invention also provides the application of the kit according to the above technical solution in the preparation of HIV-1 integrase drug resistance detection products.
[0064] To further illustrate the present invention, the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0065] In this experiment, specific experiments have been carried out on other viruses such as HBV (representing human hepatitis B virus) and HCV (representing human hepatitis C virus) using the primers in advance. There is no cross-positive for the detection of the above two viruses, and it has very good specificity, which will not be elaborated in the present invention.
[0066] Example 1
[0067] Establishment of a method for HIV-1 integrase drug resistance detection based on the second-generation sequencing technology
[0068] 1. Primer combination:
[0069] ⑴ Preparation of primers for the first round of RT-PCR: Take the synthesized primers INT-OF, INT-OR, KVL068, and KVL-069, and dilute them with ddH2O into a solution with a concentration of 20 μM. Mix the diluted primers, and mix the 4 primers according to 1 / 4 of the total volume respectively. After mixing well, mix them thoroughly and set aside, named IN-Mix-PLA. The final concentration of each primer is theoretically 5 μM.
[0070] ⑵ Preparation of primers for the second-round detection intended for deep sequencing:
[0071] Synthesize the upstream and downstream primers in Tables 3, 4, and 5, then dilute them with ddH2O into a solution with a concentration of 20 μM, mix them according to an equal volume ratio, and then add the mixed primers to the corresponding wells A01, B01, C01... H12 in a 96-well plate. The final concentration of each primer is 10 μM. For example, add the A01 mixture to well A01 of the 96-well plate, the B01 mixture to well B01 of the 96-well plate, the C01 mixture to well C01 of the 96-well plate... Store the well-packed 96-well plate at -20 °C for later use.
[0072] ⑶ Detection reaction system and conditions of the target gene:
[0073] ① The cDNA synthesis and the first-round amplification system and reaction conditions of nested PCR are shown in Table 6.
[0074] Table 6 RT-PCR reaction system and procedure
[0075]
[0076] ② After the first round is completed, take the first-round amplification product as the template for the second-round amplification. The second-round amplification system and conditions are shown in Table 7:
[0077] Table 7 Nested second-round PCR reaction system and procedure
[0078]
[0079]
[0080] ⑷ Detection, purification, quantification, and sequence determination of the target gene fragment: Use 1.5% agarose gel electrophoresis to identify the second-round PCR products. The sizes of the target gene fragments are approximately 444 bp, 500 bp, and 348 bp. Gel-cut and purify the samples with positive detection, and quantify the purified and recovered nucleic acids. Mix them with a nucleic acid amount of 3 μg / sample. Hand over the mixed nucleic acid sample mixture to Novogene for sequence determination. The sequencing platform used is Illumina HiSeqPE300. The generated batch of sequence data is analyzed using the SnpEff biological analysis software to analyze the frequency of drug resistance mutations at key IN sites, so as to analyze the drug resistance occurrence in patients and the presence of disadvantageous drug-resistant strains in patients.
[0081] Example 2
[0082] Sensitivity assessment of the deep sequencing method for HIV-1 IN drug resistance detection
[0083] I. Experimental samples
[0084] Plasma samples from 96 newly clinically diagnosed HIV-infected individuals (all signed informed consent forms) who were about to receive antiviral treatment were used as experimental samples, among which the viral load of the infected individuals was ≥ 400 Copies / mL.
[0085] II. Drug resistance detection of the IN region gene of HIV-1 infected individuals using the deep sequencing method established in Example 1
[0086] The plasma of each patient in Step 1 was subjected to the following experiments respectively:
[0087] 1. Nucleic acid purification of the plasma sample to be tested
[0088] All steps were carried out according to the kit instructions and will not be elaborated here.
[0089] 2. Preparation of deep sequencing samples
[0090] 2.1 Using the total RNA in Step 1 as a template, cDNA synthesis and the first round of nested PCR amplification were carried out:
[0091] Table 8 RT-PCR reaction system and procedure
[0092] Components V(μL) PrimeScript 1Step Enzyme Mix 1 2×1Step Buffer 12.5 Primer mix IN-Mix-PLA 1 <![CDATA[RNase Free dH2O]]> 0.5 RNA 10 Total 25
[0093] Table 9 Reaction conditions
[0094]
[0095]
[0096] 2.2 Second round of nested PCR amplification:
[0097] Table 10 Second round of nested PCR amplification procedure
[0098] Components V(μL) <![CDATA[Premix Ex Taq TM > 25 IN1-DP-PLA or IN2-DP-PLA or IN3-DP-PLA 2 First-round DNA template 3 <![CDATA[RNase Free dH2O]]> 20 Final volume 50
[0099] Table 11 Reaction conditions
[0100]
[0101] 3. Identification and purification of the target gene
[0102] In this reaction system, the sizes of the three target gene fragments are 444 bp, 500 bp, and 348 bp. After two rounds of amplification, 5 μL of the PCR product is taken and identified by 1.5% agarose gel electrophoresis. If a specific target gene band appears at the position of the DL2000 Marker size, it indicates that the target gene fragment has been amplified; otherwise, it is negative. Among the 96 samples, 92 samples were positive for nucleic acid detection with the primer system IN1-DP-PLA, and the positive detection rate was 95.8%; 91 samples were positive for nucleic acid detection with the primer system IN2-DP-PLA, and the positive detection rate was 94.8%; 94 samples were positive for nucleic acid detection with the primer system IN3-DP-PLA, and the positive detection rate was 97.9%; 91 samples were positive for all three target genes, and the overall positive rate was 94.8%, indicating that this detection system has good sensitivity for samples with a viral load ≥ 400 Copies / mL. The samples identified as positive were subjected to gel cutting, purification, and recovery. The recovered products were quantified for nucleic acid using a micro nucleic acid quantifier. The quantified nucleic acid samples were mixed at 3 μg / sample, and after mixing, they were set aside for use.
[0103] 4. Sequence determination and sequence analysis
[0104] The subsequent sequence determination and analysis were carried out according to the description in item ⑷ of "Establishment and Application of a Second-Generation Sequencing Technology-Based HIV-1 Integrase Drug Resistance Detection Method", which will not be elaborated here. In the sequence output, the number of sequences output for each sample was more than 1500 (see Table 12 for details). Among them, 12 cases had a sequence output between 1500 and 2000, and the composition ratio was 13.2%; the proportion of the sequence volume between 2001 and 5000 reached 28.6%, and the proportion of the sequence output maintained between 5001 and 10000 reached 47.3%; 11.0% had a sequence output of more than 10000. The number of output sequences fully met the requirements for the analysis of minority drug-resistant strains and quasispecies.
[0105] Table 12 List of sequence outputs of the deep sequencing method for HIV-1 PR drug resistance detection
[0106] Number of sequences generated Sequences obtained from samples to be tested (cases) Composition ratio (%) 1500~2000 12 13.2 2001~5000 26 28.6 5001~8000 22 24.2 8001~10000 21 23.1 >10000 10 11.0 Total 91 100
[0107] 5. Analysis of sequence alignment results
[0108] The analysis of next-generation sequencing results uses the free and open HIV drug resistance analysis database in Canada. Specifically, log in to the HyDRAWeb (hydra.canada.ca) website, click Launch HyDRA Web to enter the page, then click Analyze Now, and upload the sequence file in the Query files box. The file format can be.fastq or.fastq.gz; then perform parameter settings; export the drug resistance site results. Generate shared sequences at a threshold of ≥20%, and submit the sequences to the Stanford University Drug Resistance Database ( http: / / hivdb.stanford.edu / ), and analyze the occurrence of drug resistance in the integrase region. The comparison of mutations at different thresholds and the results of the Stanford University Drug Resistance Database are shown in Table 13. The results of the Stanford University Drug Resistance Database show that all mutations clearly related to drug resistance were not detected in the 96 samples tested; although these sites were detected in the established deep sequencing method system, the proportions were all below 5%, which should be inferior drug resistance mutations.
[0109] Table 13 Detection of integrase-related drug resistance sites
[0110]
[0111]
[0112] Example 3
[0113] Specific detection of the detection system
[0114] To verify whether the established detection system has cross-positive detection for similar viruses, take the HBV samples (26) and HCV (40) stored in the laboratory, and use the above detection process to detect the samples. The detection of HCV samples fully follows the above detection reaction system and procedures; in the first round of detection of HBV, the 50°C reverse transcription for 32 minutes is omitted, and the detection system and procedures are the same as before. The detection results show that the positive control has good specificity, and no specific target bands appear in the HBV, HCV detection samples and negative control of the entire detection system (primer combinations IN-Mix-PLA and IN1-DP-PLA, IN2-DP-PLA, IN3-DP-PLA), that is, the detection result is negative. The specific detection results confirm that the established detection system has no cross-reaction with similar viruses HBV and HCV.
[0115] The above results show that the method system of "establishment of an HIV-1 integrase drug resistance detection method based on next-generation sequencing technology" provided by the present invention can well detect the variation of the HIV-1 integrase gene, and thus can well analyze the composition ratio of inferior drug resistance strains. This method is simple and easy to operate and has a low detection cost.
[0116] The key point of this invention patent lies in the optimization and adjustment of the conventional HIV-1 integrase drug resistance detection method in the past, forming a new drug resistance detection method with low cost and high efficiency. In the later sequencing, instead of using the traditional Sanger sequencing method to separately sequence each sample, samples labeled with different Barcodes are mixed and sequenced simultaneously using the next-generation sequencing method for multiple samples, greatly reducing the sequencing cost. In addition, the greatest advantage of this method is that a single sample can produce batch data results. On the one hand, these results can be used for HIV drug resistance analysis, that is, to understand the occurrence of dominant drug-resistant strains and the proportion of inferior drug-resistant strains in patients. On the other hand, they can also be used for quasi-species analysis of the special virus HIV, thus achieving twice the result with half the effort.
[0117] (a) By virtue of the different Barcode labels of samples, this system enables the sequencing reaction of multiple samples (≥96) in one reaction tube, overcoming the limitation that only one sample can be detected in a single Sanger sequencing reaction in the past, greatly improving the sequencing efficiency and significantly reducing the sequencing cost.
[0118] (b) For a single sample, a batch of sequences can be produced in one sequencing. Each sample can produce more than 2,000 sequences. For the special pathogen HIV, the large number of sequence results produced can be used for multiple purposes, such as HIV quasi-species analysis and drug resistance analysis, achieving the effect of maximizing output with minimal input.
[0119] This invention discloses a method for the establishment and analysis of an HIV-1 integrase drug resistance detection method based on next-generation sequencing technology. Compared with the traditional detection method, this method greatly reduces the detection cost, and the data output is thousands of times more than that of the previous data output. It is indeed a brand-new method for HIV integrase detection and analysis. The data output can be used for both HIV drug resistance analysis and HIV quasi-species analysis, especially having unique advantages in the detection of inferior drug-resistant strains in the HIV protease gene region. In addition, the sequencing method and analysis method involved in this method are both based on domestic mature technology platforms, with good promotion and practicality. Therefore, this invention patent has important guiding significance for the prevention and control of AIDS in China and contributes to the realization of the three "95%" goals proposed by the WHO.
[0120] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A primer combination for detecting HIV-1 integrase drug resistance based on next-generation sequencing technology, characterized in that, The primer combination includes any one of IN-Mix-PLA primers and deep sequencing primer combinations; The nucleotide sequences of the primers in the IN-Mix-PLA primers are as shown in SEQ ID No. 1-4; The deep sequencing primer combination includes IN1-DP-PLA primer combination, IN2-DP-PLA primer combination and IN1-DP-PLA primer combination; The nucleotide sequences of the primers in the IN1-DP-PLA primer combination are as shown in SEQ ID No. 5-6; The nucleotide sequences of the primers in the IN2-DP-PLA primer combination are as shown in SEQ ID No. 7-8; The nucleotide sequences of the primers in the IN3-DP-PLA primer combination are as shown in SEQ ID No. 9-10.
2. Use of the primer combination according to claim 1 in the preparation of an HIV-1 integrase drug resistance detection reagent.
3. The application according to claim 2, wherein When the primer combination is used for HIV-1 integrase drug resistance detection, the IN-Mix-PLA primers are used for the first round of RT-PCR amplification to obtain the first-round amplification product.
4. The application according to claim 3, characterized in that, The reaction system for the first-round amplification is: 1 μL of PrimeScript 1Step Enzyme Mix, 12.5 μL of 2×1Step Buffer, 1 μL of IN1-DP-PLA primer combination with a concentration of 20 μΜ for each primer, 10 μL of RNA template, and 0.5 μL of RNA Free H2O.
5. The application according to claim 4, characterized in that, The program for the first-round amplification is: 50°C for 32 min; 94°C for 2 min; 94°C for 30 s, 53°C for 45 s, 72°C for 2 min, 30 cycles; 72°C for 10 min.
6. The application according to claim 2, wherein When the primer combination is used for HIV-1 integrase drug resistance detection, the deep sequencing primer combination is used for the second round of RT-PCR amplification.
7. The application according to claim 6, characterized in that, The reaction system for the second-round RT-PCR amplification is: 25 μL of ExTaq Premix Mixture, 2 μL of deep sequencing primer combination with a concentration of 20 μΜ, 3 μL of the first-round amplification product, and 20 μL of RNase Free ddH2O; the reaction system is used for the amplification of the target gene fragment.
8. The application according to claim 7, characterized in that, The program for the second-round amplification is: 94°C for 5 min; 94°C for 30 s, 53°C for 45 s, 72°C for 1 min, 3 cycles; 94°C for 30 s, 56°C for 45 s, 72°C for 1 min, 32 cycles; 72°C for 1 min.
9. A kit for detecting HIV-1 integrase drug resistance based on next-generation sequencing technology, characterized in that, The kit contains the primer combination according to claim 1.
10. Use of the kit according to claim 9 in the preparation of an HIV-1 integrase drug resistance detection product.
Citation Information
Patent Citations
Establishment and application of novel HIV-1 drug resistance detection method
CN108866207A
HIV-1 recombinant, primer set and method for detecting drug-resistance mutation of integrase area and application of primer set
CN110066771A
Establishment and application of novel HIV-1 reverse transcriptase drug-resistant mutation site detection method
CN111500782A