A method for breeding a rabbit breed with improved growth rate

Abstract

This invention relates to the field of rabbit breeding technology and provides a method for cultivating rabbit breeds with improved growth rate. This invention utilizes SpRY-CBE gene editing technology to cultivate rabbit breeds with increased growth rate. A specific sgRNA sequence was designed targeting the CEP104 gene sequence of the New Zealand rabbit, and a base mutation was performed at the C site at position 6 of the sequence. After embryo injection and embryo transfer, a new rabbit breed with improved growth rate was successfully obtained. This invention not only opens up new avenues for animal genetic breeding but also creates new rabbit models or strains, effectively improving the growth rate of rabbits and achieving significant improvement in genetic traits. This achievement is of great significance for promoting the development of animal husbandry in my country and improving the economic benefits of the animal industry, while also providing a new approach to increasing the economic value of animals.

Description

Technical Field

[0001] This invention belongs to the field of rabbit breeding technology, and in particular relates to a method for cultivating rabbit breeds with improved growth rate. Background Technology

[0002] The livestock industry is playing an increasingly important role in my country's economy, with rabbit farming receiving widespread attention. With the rapid development of modern biotechnology, the deepening research into animal genetics and breeding techniques, and the growing demand for industrialization, animal breeding is shifting from traditional methods focused on quantitative traits to molecular breeding techniques based on rapid genotypic alteration. The application of the novel CRISPR / Cas9 gene-editing technology SpRY-CBE has enabled unrestricted PAM mutations, accelerating genetic breeding programs for important productive traits in rabbits and improving their economic value. Numerous studies have employed candidate gene methods to identify DNA markers related to economically relevant traits (such as meat quality and carcass traits, reproductive and growth traits) in meat-producing animals. Notably, in clinical cases of familial tall stature in humans (non-syndrome), the identification of candidate genetic variants revealed a shared heterozygous variant of p.G18S in the ciliary gene family CEP104 among tall members, providing clues for identifying candidate genetic variants.

[0003] my country possesses abundant local rabbit breeds, but these breeds generally suffer from slow growth and low meat production. Therefore, this invention proposes a method for breeding rabbit breeds with improved growth rates. Summary of the Invention

[0004] The purpose of this invention is to provide a method for breeding rabbits with improved growth rate, thereby addressing the problems mentioned in the background section.

[0005] The objective of this invention is achieved through the following technical solution:

[0006] A method for breeding rabbits with improved growth rate includes the following steps:

[0007] Step 1: Construction of the sgRNA expression vector;

[0008] A target sequence for sgRNA was designed for the New Zealand rabbit CEP104 p.Gly25Ser. A pair of oligonucleotide chains were synthesized and annealed at 95°C for 5 min, then cooled to room temperature to form double-stranded sgRNA. The PUC57 vector was linearized using BbsI restriction endonuclease, and the linearized vector was recovered by agarose gel electrophoresis. Finally, the double-stranded sgRNA was ligated to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector. After digestion at 37°C overnight, the DNA was recovered using a standard DNA agarose gel extraction kit after gel electrophoresis.

[0009] The oligonucleotide chain sequence is as follows:

[0010] sgRNA-F:GAAGCCGTCTTCATGTCCAG;

[0011] sgRNA-R: CTGGACATGAAGACGGCTTC;

[0012] Step 2: Transcriptional synthesis of SpRY-CBE mRNA;

[0013] The SpRY-CBE plasmid was digested overnight at 37°C to form linear DNA, which was then recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction, and then SpRY-CBE was transcribed and synthesized according to the instructions of the in vitro transcription kit.

[0014] Step 3: Preparation of CEP104 gene-edited rabbits using embryo microinjection technology;

[0015] After the synthesized sgRNA and SpRY-CBE were mixed, they were aspirated into an injection needle for nuclear injection of embryonic cells. The injected fertilized eggs were then transferred to the oviduct of a recipient female rabbit in estrus at the same time. After the female rabbit was pregnant for 25 days, she was transferred to the farrowing room until the expected delivery date, and finally CEP104 gene-edited rabbits were obtained.

[0016] Step 4: Rabbit genome identification;

[0017] DNA was extracted from the obtained CEP104 gene-edited rabbit ear tissue, and PCR was performed using the designed PCR primers. After PCR was completed, electrophoresis was performed for identification. If the PCR amplification was successful, the DNA of the PCR product was sequenced to obtain the genotype identification results.

[0018] The PCR primers are designed as follows:

[0019] Upstream primer: GGATCCACAACGCTGGTTA;

[0020] Downstream primer: ACCCTCTGGGACACAATTTC.

[0021] Furthermore, in step 1, the enzyme digestion system consists of: 20 μL of PUC57 plasmid, 20 μL of 10× Buffer, 1 μL of BbsⅠ and 159 μL of ddH2O; the gel recovery process is as follows: enzyme digestion is performed overnight at 37°C, followed by agarose gel electrophoresis, and then recovery is performed using a standard DNA agarose gel recovery kit.

[0022] Furthermore, in step 2, the enzyme digestion system consists of: AgeI 1 μL, xBaI 1 μL, SpRY-CBE plasmid 20 μL, rCut Smart Buffer 10 μL, and ddH2O 18 μL;

[0023] The transcription synthesis system consisted of: 1 μg linear SpRY-CBE, 10 μL NTPBuffer, 2 μL T7 RNApolymerase, and 5 μL ddH2O.

[0024] The transcription synthesis process was as follows: after mixing, incubate at 37°C for 1 h; after transcription was completed, add 1 μL LDNaseI to digest the transcription template, react at 37°C for 15 min, and then add a polyA tail.

[0025] Furthermore, the specific process of step 3 is as follows: using a microinjector, 12 ng / μL of synthesized sgRNA and 70 ng / μL of SpRY-CBE are mixed, and 2.5 μL is aspirated into the injection needle for nuclear injection of embryonic cells. The injected fertilized eggs are then transferred to the oviduct of a recipient female rabbit in estrus at the same time. After the female rabbit reaches 25 days of pregnancy, she is transferred to the farrowing room until the expected delivery date, and finally, CEP104 gene-edited rabbits are obtained.

[0026] Furthermore, in step 4, the PCR reaction system consists of: 1.5 μL template DNA, 2 μL upstream primer, 2 μL downstream primer, 12.5 μL 2×Taqplus, and 7 μL ddH2O; the PCR reaction conditions are: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 40 s; 38 cycles; and 72℃ extension for 5 min.

[0027] Furthermore, in step 4, if the C at position 6 of the sgRNA sequence is mutated to T, it proves that a single-base mutation has been obtained.

[0028] Compared with the prior art, the beneficial effects of the present invention are:

[0029] This invention discloses a method for breeding rabbits with improved growth rate using SpRY-CBE gene editing technology. The advantage of this technology is that it does not restrict sequence recognition in the PAM region. Inspired by a high-stature design mutation in human non-syndrome families, this invention designs a specific sgRNA sequence targeting the CEP104 gene sequence of New Zealand rabbits, achieving a base mutation at position 6 (C). After embryo injection and embryo transfer, a new rabbit breed with improved growth rate was successfully obtained. This invention not only opens up new avenues for animal genetic breeding but also creates new rabbit models or strains, effectively improving the growth rate of rabbits and achieving significant improvement in genetic traits. This achievement is of great significance for promoting the development of animal husbandry in my country and improving the economic benefits of the animal industry, while also providing a new approach to increasing the economic value of animals. Attached Figure Description

[0030] Figure 1 This is a schematic diagram of sgRNA design.

[0031] Figure 2 This is a Sanger sequencing image of the CEP104 gene mutation in newborn rabbits.

[0032] Figure 3 This is a comparison of body length between 3-month-old normal rabbits and CEP104 gene-edited rabbits.

[0033] Figure 4 This is a comparison of the body length of normal rabbits and CEP104 gene-edited rabbits at 100 days old.

[0034] Figure 5 This is a statistical analysis of the weight changes of normal rabbits and CEP104 gene-edited rabbits over 100 days. Detailed Implementation

[0035] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0036] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0037] This invention provides a method for breeding rabbit breeds with improved growth rate, the method comprising the following steps:

[0038] Step 1: Construction of the sgRNA expression vector (PUC57-sgRNA);

[0039] Figure 1This is a schematic diagram of sgRNA design. An sgRNA sequence was designed to target the CEP104 p.Gly25Ser nucleotide sequence of the New Zealand rabbit. A pair of oligonucleotide chains were synthesized, and the oligonucleotide chain sequences are as follows:

[0040] sgRNA-F: GAAGCCGTCTTCATGTCCAG (as shown in SEQ ID NO.1);

[0041] sgRNA-R: CTGGACATGAAGACGGCTTC (as shown in SEQ ID NO.2);

[0042] The selection principle for the sgRNA oligonucleotide chains is as follows: ensure that the mutated base position is located at the 6th position that pairs with the target DNA sequence.

[0043] Oligonucleotide chains were annealed at 95°C for 5 min and cooled to room temperature to form double-stranded sgRNA. Simultaneously, the PUC57 vector was linearized using BbsI restriction endonuclease, and the linearized vector was recovered by agarose gel electrophoresis. Finally, the double-stranded sgRNA was ligated to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector. After digestion at 37°C overnight, the vector was recovered by a standard DNA agarose gel extraction kit after electrophoresis.

[0044] Enzyme digestion system: 20 μL PUC57 plasmid; 20 μL 10× Buffer; 1 μL BbsⅠ; 159 μL ddH2O.

[0045] Gel recovery process: After enzyme digestion overnight at 37°C and agarose gel electrophoresis, DNA was recovered using a standard DNA agarose gel recovery kit (purchased from Shanghai Sangon Biotech Co., Ltd., Shanghai, China). The specific operation was performed according to the instructions.

[0046] Step 2: Transcriptional synthesis of SpRY-CBE mRNA;

[0047] The SpRY-CBE plasmid (preserved in our laboratory) was digested with enzymes overnight at 37°C to form linear DNA, which was then recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction.

[0048] The enzyme digestion system was as follows: AgeI 1 μL; xBaI 1 μL; SpRY-CBE plasmid 20 μL; rCut Smart Buffer 10 μL; ddH2O 18 μL.

[0049] The transcription synthesis system consisted of: linear SpRY-CBE 1 μg; NTP Buffer 10 μL; T7 RNA polymerase 2 μL; and ddH2O 5 μL.

[0050] The transcription synthesis process was as follows: after mixing, incubate at 37°C for 1 hour. After transcription was complete, add 1 μL LDNaseI to digest the transcription template, react at 37°C for 15 minutes, and then add a polyA tail.

[0051] Step 3: Preparation of CEP104 gene-edited rabbits using embryo microinjection technology;

[0052] Using a microinjection apparatus, 12 ng / μL of synthesized sgRNA and 70 ng / μL of SpRY-CBE were mixed, and 2.5 μL was aspirated into an injection needle for nuclear injection into embryonic cells. The injected fertilized eggs were then transferred to the oviducts of recipient rabbits in estrus. The surrogate rabbits were provided with ample water and food, and after 25 days of gestation, they were transferred to the farrowing house until their expected delivery date, ultimately yielding CEP104 gene-edited rabbits.

[0053] Step 4: Rabbit genome identification;

[0054] DNA was extracted from the obtained CEP104 gene-edited rabbit ear tissue according to the kit instructions (purchased from Tiangen Pharmaceuticals, Beijing, China). Then, PCR was performed using the designed PCR primers. After PCR, electrophoresis was performed for identification. If the PCR amplification was successful, the PCR product was sequenced to obtain the genotype identification results.

[0055] The PCR primers are designed as follows:

[0056] Upstream primer: GGATCCACAACGCTGGTTA (as shown in SEQ ID NO.3);

[0057] Downstream primer: ACCCCTGGGACACAATTTC (as shown in SEQ ID NO.4);

[0058] PCR reaction system: template DNA 1.5 μL; upstream primer 2 μL; downstream primer 2 μL; 2×Taqplus 12.5 μL; ddH2O 7 μL.

[0059] Reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 40 s; 38 cycles; 72℃ extension for 5 min.

[0060] The PCR product was sent to Sangon Biotech for sequencing. If the 25th amino acid sequence of the rabbit CEP104 gene (GeneID: 100340818) changed from GGC to AGC (the reverse sequence is the 6th C to T mutation in the sgRNA sequence), then a single-base mutation was obtained. Figure 2 As shown, a heterozygous mutation, indicated by the arrow, occurred at the corresponding position in the rabbit CEP104 gene. Therefore, this invention yielded a rabbit with a CEP104 gene mutation.

[0061] Example 1: Phenotypic analysis of CEP104 gene-edited rabbits;

[0062] 1) Comparison of body length between 3-month-old normal rabbits (WT) and CEP104 gene-edited rabbits;

[0063] Body lengths of normal rabbits and CEP104 gene-edited rabbits were observed at 3 months of age. Figure 3 As shown, the body length of the 3-month-old CEP104 gene-edited rabbits was significantly larger than that of normal rabbits; WT refers to normal rabbits, while F0-3 and F0-5 are CEP104 gene-edited rabbits with serial numbers 3 and 5, respectively, obtained after embryo transfer.

[0064] 2) Comparison of body length between normal rabbits (WT) and CEP104 gene-edited rabbits at 100 days;

[0065] Body lengths were measured at 100 days in normal rabbits and CEP104 gene-edited rabbits, such as... Figure 4 As shown, when the rabbits continued to grow to 100 days old, the body length of the CEP104 gene-edited rabbits was significantly larger than that of normal rabbits.

[0066] 3) Statistical analysis of weight changes in normal rabbits (WT) and CEP104 gene-edited rabbits over 100 days;

[0067] The body weights of normal rabbits and CEP104 gene-edited rabbits were recorded over a 100-day period after birth. Figure 5 As shown, the weight and growth rate of CEP104 gene-edited rabbits were both greater than those of normal rabbits.

[0068] In summary, this invention has successfully bred a new CEP104 gene-edited rabbit breed, which exhibits significantly superior growth traits such as body length and weight compared to normal rabbits. This is of great significance for improving the growth capacity of domestic rabbit breeds and promoting the sound development of my country's animal breeding industry.

[0069] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent.

Claims

1. A method for breeding rabbit breeds with improved growth rate, characterized in that, Includes the following steps: Step 1: Construction of the sgRNA expression vector; A target sequence for sgRNA was designed for the New Zealand rabbit CEP104 p.Gly25Ser. A pair of oligonucleotide chains were synthesized and annealed at 95°C for 5 min, then cooled to room temperature to form double-stranded sgRNA. The PUC57 vector was linearized using BbsI restriction endonuclease, and the linearized vector was recovered by agarose gel electrophoresis. Finally, the double-stranded sgRNA was ligated to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector. After digestion at 37°C overnight, the DNA was recovered using a standard DNA agarose gel extraction kit after gel electrophoresis. The oligonucleotide chain sequence is as follows: sgRNA-F: GAAGCCGTCTTCATGTCCAG; as shown in SEQ ID NO.1; sgRNA-R: CTGGACATGAAGACGGCTTC; as shown in SEQ ID NO.2; The target sgRNA nucleotide sequence is as described in gRNA-F: GAAGCCGTCTTCATGTCCAG; as shown in SEQ ID NO.1; Step 2: Transcriptional synthesis of SpRY-CBE mRNA; The SpRY-CBE plasmid was digested overnight at 37°C to form linear DNA, which was then recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction, and then SpRY-CBE was transcribed and synthesized according to the instructions of the in vitro transcription kit. Step 3: Preparation of CEP104 gene-edited rabbits using embryo microinjection technology; After the synthesized sgRNA and SpRY-CBE were mixed, they were aspirated into an injection needle for nuclear injection of embryonic cells. The injected fertilized eggs were then transferred to the oviduct of a recipient female rabbit in estrus at the same time. After the female rabbit was pregnant for 25 days, she was transferred to the farrowing room until the expected delivery date, and finally CEP104 gene-edited rabbits were obtained. Step 4: Rabbit genome identification; DNA was extracted from the obtained CEP104 gene-edited rabbit ear tissue, and PCR was performed using the designed PCR primers. After PCR was completed, electrophoresis was performed for identification. If the PCR amplification was successful, the DNA of the PCR product was sequenced. If the C at position 6 of the sgRNA sequence was mutated to T, it proved that a single base mutation was obtained, and the genotype identification result was obtained. The PCR primers are designed as follows: Upstream primer: GGATCCACAACGCTGGTTA; as shown in SEQ ID NO.3; Downstream primer: ACCCTCTGGGACACAATTTC; as shown in SEQ ID NO.

4.

2. The method for improving the growth rate of rabbit breeds according to claim 1, characterized in that, In step 1, the enzyme digestion system consisted of 20 μL of PUC57 plasmid, 20 μL of 10× Buffer, 1 μL of BbsⅠ and 159 μL of ddH2O. The gel recovery process involved digestion overnight at 37°C, followed by agarose gel electrophoresis and recovery using a standard DNA agarose gel recovery kit.

3. The method for improving the growth rate of rabbit breeds according to claim 1, characterized in that, In step 2, the enzyme digestion system is: AgeI 1 μL, xBaI 1 μL, SpRY-CBE plasmid 20 μL, rCut Smart Buffer 10 μL and ddH2O 18 μL; The transcription synthesis system consisted of: 1 μg linear SpRY-CBE, 10 μL NTP Buffer, 2 μL T7 RNA polymerase, and 5 μL ddH2O. The transcription synthesis process was as follows: after mixing, incubate at 37°C for 1 hour; after transcription was completed, add 1 μL of DNaseI to digest the transcription template, react at 37°C for 15 minutes, and then add a polyA tail.

4. The method for improving the growth rate of rabbit breeds according to claim 1, characterized in that, The specific process of step 3 is as follows: using a microinjection apparatus, 12 ng / μL of synthesized sgRNA and 70 ng / μL of SpRY-CBE are mixed, and 2.5 μL is aspirated into the injection needle for nuclear injection of embryonic cells. The injected fertilized eggs are then transferred to the oviduct of a recipient female rabbit in estrus at the same time. After the female rabbit reaches 25 days of pregnancy, she is transferred to the farrowing room until the expected delivery date, and finally, CEP104 gene-edited rabbits are obtained.

5. The method for improving the growth rate of rabbit breeds according to claim 1, characterized in that, In step 4, the PCR reaction system consisted of: 1.5 μL template DNA, 2 μL upstream primer, 2 μL downstream primer, 12.5 μL 2×Taq plus, and 7 μL ddH2O. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 40 s; 38 cycles; and 72℃ extension for 5 min.

Images