Microbial material for reducing salt heave and frost heave of highway subgrade salinized soil as well as preparation method and application of microbial material

Abstract

The invention discloses a microbial material for reducing salt heave and frost heave of highway subgrade salinized soil as well as a preparation method and application of the microbial material, a microorganism is nitrogen-fixing bacteria and is classified and named as Neorhizobium alkalisoli XJIPC-GNJ0001, the strain is preserved in China General Microbiological Culture Collection Center (CGMCC) on January 20, 2025, and the preservation number is CGMCC No.33310. The invention further discloses a preparation method of the microbial material for reducing the salt heave and frost heave of the highway subgrade salinized soil and application of the microbial material for reducing the salt heave and frost heave of the highway subgrade salinized soil. The strain belongs to extremely halophilic bacteria and adapts to a strong alkali environment, and a microbial material prepared from fermentation liquor of the strain can reduce salt heave and frost heave of highway subgrade salinized soil. The preparation method is simple, low in cost and easy to produce, and the material is green, environment-friendly and good in stability. The microbial solid preparation of the novel alkali rhizobium and the fermentation liquor can be used as a cementing substance and forming power, is used for preparing a material for preventing salt heaving and frost heaving of road salinized soil, can relieve or reduce engineering diseases such as salt heaving and frost heaving in road subgrade filling in a salinized soil area, is beneficial to road subgrade protection and stabilization, and has a good application prospect. The resource utilization way of the salinized soil is widened, and the application prospect is wide.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and in particular, to a microbial material for reducing salt expansion and frost heaving of highway subgrade saline soil, a preparation method thereof, and an application thereof. Background Art

[0002] Saline soil refers to soil with easily soluble salt content exceeding 0.3% within 1 meter of the ground surface, which is widely distributed in inland arid and semi-arid regions and coastal areas. The total area of saline soil in China reaches 3.69×10 7 hectares, and the saline-alkali land in Xinjiang Uygur Autonomous Region is the most concentrated. Problems such as salt expansion, frost heaving, pumping, and secondary salinization of saline soil seriously affect the stability and durability of highway subgrade, resulting in subgrade deformation and shortened service life, becoming a key problem in highway engineering construction.

[0003] Soil microorganisms produce extracellular polysaccharides, enzymes, surfactants and other bioactive substances through metabolic activities, which can promote soil aggregation, improve soil structure, and enhance the salt tolerance of plants. Microbial technology is considered a potential method for improving saline soil due to its environmental friendliness and sustainability. However, existing microbial technologies still face problems such as poor strain adaptability, low survival rate, and unstable effects in saline soil improvement.

[0004] When saline soil undergoes freeze-thaw cycles in seasonally frozen soil areas, the water and salt repeatedly crystallize and dissolve, resulting in prominent problems of soil salt expansion and frost heaving. This phenomenon not only exacerbates the deformation and damage of the subgrade, but also poses a serious threat to the stability of highway engineering. At present, the microbial improvement technology for salt expansion and frost heaving problems of saline soil is still in the exploration stage, lacking efficient and stable solutions. With the continuous increase of infrastructure construction in saline soil areas. Developing a microbial material that can effectively reduce salt expansion and frost heaving of saline soil and its preparation method is of great significance for improving the stability and durability of highway engineering, saving construction costs, and protecting the ecological environment. However, there is no mature solution for efficient microbial improvement materials and their applications for salt expansion and frost heaving problems of saline soil in the existing technology. Summary of the Invention

[0005] The object of the present invention is to provide a microbial material for reducing salt expansion and frost heaving of saline soil in highway subgrade, a preparation method and an application thereof. The microorganism is a nitrogen-fixing bacterium, classified and named as Neorhizobium alkalisoli XJIPC-GNJ0001. This strain was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on January 20, 2025, with the deposit number of CGMCC No. 33310. This bacterium belongs to extreme halophilic bacteria and can adapt to strong alkaline environment. The microbial material prepared from its fermentation broth can reduce salt expansion and frost heaving of saline soil in highway subgrade. The production method of the present invention is simple, low-cost and easy to produce, and the material is green, environmentally friendly and has good stability. The microbial solid preparation of the Neorhizobium and its fermentation broth can be used as a cementing substance and a forming power to prepare materials for preventing salt expansion and frost heaving of highway saline soil, which can reduce or alleviate engineering diseases such as salt expansion and frost heaving in the filling of highway subgrade in saline soil areas, is beneficial to the protection and stability of highway foundation, broadens the resource utilization way of saline soil, and has broad application prospects.

[0006] The microbial material for reducing salt expansion and frost heaving of saline soil in highway subgrade according to the present invention, the microorganism is a nitrogen-fixing bacterium, classified and named as Neorhizobium alkalisoli XJIPC-GNJ0001. This strain was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on January 20, 2025, with the deposit number of CGMCC No. 33310. The nitrogen-fixing bacterium is derived from the salt lake area of Xinjiang Uygur Autonomous Region. Through 16S identification of the nitrogen-fixing bacterium, the phylogenetic analysis shows that it belongs to Neorhizobium. The logarithmic growth time of Neorhizobium alkalisoli is 8-26 h. Neorhizobium alkalisoli grows in an environment with less than 15% NaCl. Neorhizobium alkalisoli grows in an alkaline environment with pH 12, and the alkali reduction ability reaches 29%.

[0007] The microbial material for reducing salt expansion and frost heaving of saline soil in highway subgrade contains Neorhizobium alkalisoli, the fermentation broth of Neorhizobium alkalisoli, the freeze-dried powder of Neorhizobium alkalisoli, the inactivated cells of Neorhizobium alkalisoli, the lysate of Neorhizobium alkalisoli or the extract containing Neorhizobium alkalisoli.

[0008] The preparation method of the microbial material for reducing salt expansion and frost heaving of saline soil in highway subgrade is carried out according to the following steps:

[0009] a. Strain activation: Inoculate the newly isolated Rhizobium alkaligenes preserved at low temperature onto a solid nitrogen-fixing medium, and culture it in an incubator at 33°C. After colonies grow, pick a single colony and transfer it to a liquid nitrogen-fixing medium, and culture it in a shaker at 33°C and 180 rpm for 24 h. The solid nitrogen-fixing medium is composed of raw materials in mass percentages: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate. Adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, add 1.5 g of agar, sterilize at 121°C for 20 minutes. The liquid nitrogen-fixing medium is composed of raw materials in mass percentages: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate. Adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilize at 121°C for 20 minutes.

[0010] b. Seed liquid preparation: Inoculate the strain obtained in step a into a liquid nitrogen-fixing medium at an inoculation volume ratio of 6%, and culture it in a shaker at 33°C and 180 rpm for 24 h to obtain a seed liquid. The liquid nitrogen-fixing medium is composed of raw materials in mass percentages: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate. Adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilize at 121°C for 20 minutes.

[0011] c. Fermentation broth preparation: Inoculate the seed liquid obtained in step b into a liquid nitrogen-fixing medium at an inoculation volume ratio of 6%, and culture it in a shaker at 33°C and 180 rpm for 120 h to obtain a fermentation broth. The liquid nitrogen-fixing medium is composed of raw materials in mass percentages: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate. Adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilize at 121°C for 20 minutes.

[0012] d. Solid dry powder preparation: Spray-dry the fermentation broth obtained in step c using a large centrifugal spray dryer ZLPG - 20, a spray drying tower, with an inlet temperature of 50°C, an outlet temperature of 80°C, and a flow rate of 192.0 ml / min to obtain a solid powder microbial material with a water content of 1.4%, viable bacteria count of 4.6×10 15 cfu / g, and solubility ≤ 100 mg / ml.

[0013] The application of the microbial material for reducing the salt expansion and frost heaving of highway subgrade soil. The mixing ratio of the obtained microbial material and the saline soil is 1-4% by mass percentage. At a temperature of 5°C - 15°C, the percentage reduction in the salt expansion amount of the saline soil is 5% - 50%.

[0014] The microbial material obtained by the method of the present invention is used to reduce the salt expansion and frost heaving of highway subgrade soil. By mixing with the saline soil, it can reduce the salt expansion amount of the saline soil by 5% - 50% in the temperature range of 5°C to -15°C. The specific operation is as follows:

[0015] Mixing ratio: The mixing ratio of the microbial material and the saline soil is 1-4% by mass percentage.

[0016] Application method: Uniformly mix the microbial material into the saline soil and process it according to the provisions of the salt expansion test of saline soil in T0195-2019 of the "Highway Geotechnical Test Regulations" JTG-3430-2020.

[0017] The microbial material, preparation method and application for reducing the salt expansion and frost heaving of highway subgrade soil according to the present invention have the following remarkable advantages: The preparation method of the microbial material involved in the present invention is simple, low-cost, easy to produce and prepare; it is small in volume, convenient for storage, transportation and use, etc., and can make up for various deficiencies in the process of highway construction; the microbial material is green, environmentally friendly and has good stability, can effectively maintain the activity of the bacterial strain, and the effective viable count still reaches 4.5×10 12 cfu / g after being stored at room temperature for 12 months, and the effective viable count still reaches 3.3×10 14 cfu / g after being stored at -4°C for 12 months, and the number of bacterial cells is equivalent to the initial value.

[0018] The microbial material, preparation method and application for reducing the salt expansion and frost heaving of highway subgrade soil according to the present invention have the following beneficial effects: The application effect shows that the biological material has an obvious reducing and alleviating effect on the salt expansion and frost heaving of the saline soil, enhances the stability of the subgrade and pavement, resists various disasters, extends the service life, and can significantly improve the quality of the highway subgrade; it can effectively reduce the construction cost of highway engineering and obtain good economic, environmental and social benefits. Description of the Drawings

[0019] Figure 1 It is the morphological characteristic diagram of the new alkaligenes rhizobium of the present invention;

[0020] Figure 2 It is the evolutionary analysis diagram of the new alkaligenes rhizobium of the present invention;

[0021] Figure 3 It is the growth characteristic curve diagram of the new alkaligenes rhizobium of the present invention;

[0022] Figure 4 It is the salt tolerance graph of the new alkaline rhizobium of the present invention;

[0023] Figure 5 It is the alkali tolerance graph of the new alkaline rhizobium of the present invention;

[0024] Figure 6 It is the graph of the new microbial material of the present invention reducing salt swelling;

[0025] Figure 7 It is the infrared spectrum analysis graph of different blending ratios of the present invention;

[0026] Figure 8 It is the flow chart of the present invention. Detailed implementation manners

[0027] All technical and scientific terms used in the present invention, unless otherwise stated, generally have the same meaning as commonly understood by those of ordinary skill in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The test materials, reagents, drugs, etc. used in the following examples can all be obtained as conventional products through regular channels unless otherwise specified.

[0028] The present invention will be further described in detail below with reference to specific examples and data. The following examples are only for illustrating the present invention and do not limit the protection scope of the present invention in any way.

[0029] Example 1

[0030] Isolation, purification and identification of strains:

[0031] 1.1 Isolation and purification of strains:

[0032] Soil sampling: On November 3, 2021, Yanhu Scenic Area, Urumqi City, Xinjiang Uygur Autonomous Region, altitude 1009m, longitude 88.1384452, latitude 43.3809974;

[0033] Isolation: Dilution plating method: Take 10 g of soil sample passed through a 20-mesh sieve and put it into 90 ml of sterilized deionized water, shake and mix evenly at 150 rpm for 30 min, take 1 ml of the soil shaking solution and add it to a pre-sterilized test tube containing 9 ml of sterile water, shake and mix evenly, named test tube No. 1, and the solution dilution factor is 10 -2 , take 1 ml of the solution in test tube No. 1 and add it to test tube No. 2 containing 9 ml of sterile water pre-sterilized, shake and mix evenly, and the solution dilution factor is 10 -3 ; In the same way, take 1 ml of the solution in the previous test tube and add it to the next test tube containing 9 ml of sterile water in turn until test tube No. 8, and the solution dilution factor is 10-9 Up to this point, 150 μl was taken from each of test tubes No. 5, 6, 7, and 8 and spread on an Ashby solid medium plate. Each test tube was replicated and spread on 3 plates, and the plates were incubated in an inverted position at 37°C. The raw material composition of the solid Ashby medium in terms of mass-volume percentage is as follows: mannitol (or glucose) 1 g, magnesium sulfate 0.01 g, potassium dihydrogen phosphate 0.02 g, sodium chloride 0.02 g, calcium sulfate 0.01 g, calcium carbonate 0.5 g. The pH was adjusted to 7.0 - 7.20 with 1 mol / l hydrochloric acid, and 1.5 g of agar was added. It was sterilized at 115°C for 30 min.

[0034] Purification: Observe the growth of bacteria on the plate. After the colonies grew out, pick typical single colonies with obvious differences in size, shape, color, etc., number them, and streak them on an Ashby solid medium plate for culturing and purification until the colonies on the plate are all uniform. Pick single colonies into 5 ml of sterilized liquid nitrogen-fixing bacteria medium, culture at 33°C with a rotation speed of 180 min / r for 24 h. Mix 1:1 with a 50% glycerol solution (mixed with ultrapure water and glycerol in a volume ratio of 1:1), aliquot 1 ml into 1.5 ml centrifuge tubes, and store them at -80°C in the refrigerator for standby. The raw material composition of the liquid nitrogen-fixing medium in terms of mass-volume percentage is as follows: mannitol 2.0 g, potassium dihydrogen phosphate 0.02 g, dipotassium hydrogen phosphate 0.08 g, magnesium sulfate 0.01 g, calcium sulfate 0.01 g, yeast extract 0.05 g, ferric chloride 0.001 g, sodium molybdate 0.0002 g. The pH was adjusted to 7.0 - 7.20 with 1 mol / l hydrochloric acid, and it was sterilized at 121°C for 20 min.

[0035] 1.2 Identification of strains:

[0036] The morphological characteristics of the isolated strain XJIPC-GNJ0001 are as Figure 1 shown:

[0037] Molecular biology identification:

[0038] DNA extraction: Activate the screened strain XJIPC-GNJ0001 to the logarithmic phase, collect the bacterial cells, and extract DNA using the Ezup column bacterial genomic DNA extraction kit (B518255) from Sangon Biotech (Shanghai) Co., Ltd. for PCR amplification of 16S rDNA primers.

[0039] The 16S rDNA primer sequences are as follows:

[0040] 27F: AGAGTTTGATCCTGGCTCAG;

[0041] 1492R: GGTTACCTTGTTACGACTT;

[0042] The PCR amplification system is as follows: 1.5 μl of DNA template, 1 μl each of upstream and downstream primers, 25 μl of 2*Taq PCR Green Mix, and sterile water is added to make the total volume 50 μl; The PCR amplification conditions are 95 °C for 5 min, 94 °C for 50 s, 54 °C for 30 s, 72 °C for 30 s, 72 °C for 7 min, for a total of 30 cycles, and stored at 4 °C for standby;

[0043] Sequencing: The PCR products were detected by 1% agarose gel electrophoresis, and the PCR products with obvious amplification bands were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing; The sequence of strain XJIPC-GNJ0001 (5’→3’) was obtained;

[0044] Sequence list of the novel Neorhizobium strain of the present invention:

[0045]

[0046] Sequence analysis: The measured sequence was aligned and analyzed using the BLAST program Nucleotide BLAST in the National Center for Biotechnology Information (NCBI) of the United States to obtain homologous strains of strain XJIPC-GNJ0001; 13 strains with high homology to XJIPC-GNJ0001 were selected, as shown in Table 1; A phylogenetic tree was constructed to determine the species and genus category of strain XJIPC-GNJ0001, Figure 3 as shown;

[0047] Table 1 Strains with high sequence homology to strain XJIPC-GNJ0001

[0048]

[0049]

[0050] The results showed that the homology of strain XJIPC-GNJ0001 with Neorhizobium alkalisoli s t rain TRM85146 reached 99.20%, and the homologies with Neorhizobium sp. strain YH5S, Rhizobium sp. SAB15b, and Neorhizobium galegae strain JZ48 were 98.97%, 98.82%, and 98.81% respectively. Therefore, strain XJIPC-GNJ0001 was named Neorhizobium alkalisoli;

[0051] The novel strain Neorhizobium alkalisoli XJIPC-GNJ0001 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing) on January 20, 2025, with the deposit number CGMCC NO. 33310.

[0052] Example 2

[0053] Strain preparation:

[0054] a. Strain activation: The cryopreserved Neorhizobium alkalisoli was inoculated onto a solid nitrogen-fixing medium and cultured in an incubator at 33°C. After colonies grew, single colonies were picked and transferred to a liquid nitrogen-fixing medium, and cultured in a shaker at 33°C and 180 rpm for 24 h. The solid nitrogen-fixing medium was composed of raw materials in mass-volume percentage: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate, adjusted to pH 7.0 - 7.20 with 1 mol / l hydrochloric acid, 1.5 g of agar, sterilized at 121°C for 20 minutes. The liquid nitrogen-fixing medium was composed of raw materials in mass-volume percentage: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate, adjusted to pH 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilized at 121°C for 20 minutes.

[0055] b. Seed liquid preparation: The strain obtained in step a was transferred into a liquid nitrogen-fixing medium at an inoculation amount of 6%, and cultured in a shaker at 33°C and 180 rpm for 24 h to obtain a seed liquid. The liquid nitrogen-fixing medium was composed of raw materials in mass-volume percentage: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate, adjusted to pH 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilized at 121°C for 20 minutes.

[0056] c. Fermentation broth preparation: The seed liquid obtained in step b was transferred into a liquid nitrogen-fixing medium at an inoculation amount of 6%, and cultured in a shaker at a temperature of 33°C and 180 rpm for 120 h to obtain a fermentation broth; the liquid nitrogen-fixing medium was composed of raw materials in mass-volume percentage: 2.0 g of mannitol, 0.02 g of potassium dihydrogen phosphate, 0.08 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate, 0.01 g of calcium sulfate, 0.05 g of yeast extract, 0.001 g of ferric chloride, 0.0002 g of sodium molybdate, and the pH was adjusted to 7.0 - 7.20 with 1 mol / l hydrochloric acid, and sterilized at 121°C for 20 minutes;

[0057] d. Solid dry powder preparation: The fermentation broth obtained in step c was spray-dried using a large centrifugal spray dryer ZLPG-20, spray drying tower, with an inlet temperature of 50°C, an outlet temperature of 80°C, and a flow rate of 192.0 ml / min to obtain a solid powder microbial material with a water content of 1.4%, viable bacteria count of 4.6×10 15 cfu / g, and solubility ≤ 100 mg / ml.

[0058] Example 3

[0059] Strain characteristics:

[0060] Growth characteristics: The activated liquid of the strain in Example 2 was transferred into 100 ml of liquid nitrogen-fixing medium at an inoculation amount of 6%, and cultured in a shaker at a temperature of 33°C and 180 rpm. Samples were taken at 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, 24 h, 26 h, and 28 h to measure OD600. The blank liquid medium without inoculation was used as a control ck, and a curve graph was made to obtain the growth curve of the new alkaligenic rhizobium XJIPC-GNJ0001, as shown in the appendix Figure 3 , and it can be seen that the logarithmic growth time of the new alkaligenic rhizobium is 8 - 26 h;

[0061] Salt tolerance: The seed liquid of the strain in Example 2 was transferred into 100 ml of liquid nitrogen-fixing medium containing 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, and 20% NaCl respectively at an inoculation amount of 6%. The blank liquid medium without inoculation was used as a control ck, and cultured in a shaker at a temperature of 33°C and 180 rpm for 24 h, and OD600 was measured, and a curve graph was made, as shown in the appendix Figure 4 , and it can be seen that the new alkaligenic rhizobium can grow in an environment with NaCl below 15% mass-volume percentage; according to the classification standard of halophilic bacteria, the new alkaligenic rhizobium belongs to extreme halophilic bacteria (14.63% - 30.40% NaCl);

[0062] Alkaline resistance and alkalinity reduction: The strain seed liquid in Example 2 was transferred into 100 ml of liquid nitrogen-fixing medium with pH values of 7, 8, 9, 10, 11, and 12 at an inoculation amount of 6%. The non-inoculated blank liquid medium was used as the control ck. It was cultured in a shaker at a temperature of 33°C and 180 rpm for 24 h, and the OD600 and pH values were measured to make a curve graph, as shown in the appendix Figure 5 and Table 2. It can be seen from Figure 5 that the new alkalinitrobacter can grow in a strong alkaline environment with a pH of 12. It can be seen from Table 2 that the alkalinity reduction ability of the new alkalinitrobacter can reach 29%;

[0063] The formula for calculating the alkalinity reduction of the microbial strain is:

[0064] Table 2 Alkalinity reduction characteristics of the new alkalinitrobacter

[0065]

[0066] Example 4

[0067] Characteristics of the microbial material solid dry powder in different storage states and at different times:

[0068] The solid dry powder of the microbial material obtained in Example 2 was respectively stored in a dry place at room temperature, -4°C, -20°C, and -40°C. After 1, 6, 12, 18, and 24 months of storage, samples were taken to detect the viable bacteria count. The results are shown in Table 1. After 24 months of storage, at room temperature, the strain activity of the microbial material was as high as 2.0×10 7 cfu / g, showing good preservation characteristics, as shown in Table 3;

[0069] Table 3 Changes in the viable bacteria count of the microbial material strain with storage conditions and time (cfu / g)

[0070]

[0071] Example 5

[0072] The solid dry powder of the microbial material reduces the salt expansion and frost heave of highway subgrade saline soil:

[0073] The solid dry powder of the microbial material obtained in Example 2 was mixed with saline soil at mass percentages of 1.11%, 4.44%, and 6.66%, respectively. After mixing evenly, according to the regulations of the latest "Highway Geotechnical Test Regulations" JTG-3430-2020, T0195-2019 for the salt expansion test of saline soil, in this test, the freeze-thaw cycle was taken with temperatures of 10°C, 5°C, 0°C, -5°C, -10°C, and -15°C as a freeze-thaw cycle period, and the temperature was controlled at each temperature node for 10 h; after the specimens were compacted and formed, they were placed in a low-temperature box for freezing; the observation time was 12 days, and the results are shown in the appendix Figure 6As shown, with the decrease in temperature, the salt expansion of each group increases. The obvious change point of salt expansion in the blank group is 5°C, which is higher than that of all specimens in the microbial material group. At a temperature of -15°C, the salt expansion of the blending groups with 1.11%, 4.44%, and 6.66% in the microbial material group is lower than that of the blank group, reducing the salt expansion by 50%.

[0074] The calculation formula for the salt expansion reduction by the microbial strain is as follows:

[0075] Example 6

[0076] Infrared spectroscopy analysis:

[0077] Samples of the microbial material solid dry powder before and after treating saline soil are dried and then mixed and ground evenly with dry potassium bromide (KBr) at a mass ratio of 1:120 - 150. The mixed powder is pressed into a thin slice using a mold and detected on an infrared spectrometer, and the data is recorded. The results are as follows Figure 7 , there are changes in the absorption peaks before and after the treatment of the microbial material and saline soil.

[0078] In summary, the new alkalinitrilobium sp. described in the present invention belongs to extreme halophiles, with a logarithmic growth time of 8 - 26 h, can grow in an environment with a NaCl content of less than 15% (mass / volume) and a strong alkaline environment with a pH of 12, and the alkali reduction ability can reach 29%. The water content of the microbial material solid dry powder is 1.4%, and the solubility is ≤100 mg / ml. Under room temperature conditions, after 24 months of storage, the strains of the microbial material retain high activity. The new alkalinitrilobium sp. and its fermentation products can reduce the salt expansion and frost heaving of saline soil in highway subgrades.

Claims

1. A microbial material for reducing the salt expansion and frost heaving of highway subgrade soil, characterized in that: The microorganism is a nitrogen-fixing bacterium, classified and named as Neorhizobium alkalicum Neorhizobium alkalisoli XJIPC-GNJ0001. This strain was deposited in the China General Microbiological Culture Collection Center on January 20, 2025, with the deposit number CGMCC No. 33310. The nitrogen-fixing bacterium is derived from the salt lake area of Xinjiang Uygur Autonomous Region. Through 16S identification of the nitrogen-fixing bacterium, phylogenetic analysis shows that it belongs to Neorhizobium alkalicum. The logarithmic growth time of Neorhizobium alkalicum is 8 - 26 h. Neorhizobium alkalicum grows in an environment with less than 15% NaCl. Neorhizobium alkalicum grows in an alkaline environment with a pH of 12, and the alkali reduction ability reaches 29%.

2. The microbial material for reducing salt expansion and frost heaving of highway subgrade soil according to claim 1, characterized in that, The microbial material contains Neorhizobium alkalisoli, the fermentation broth of Neorhizobium alkalisoli, the freeze-dried powder of Neorhizobium alkalisoli, the inactivated cells of Neorhizobium alkalisoli, the lysate of Neorhizobium alkalisoli or the extract containing Neorhizobium alkalisoli.

3. The preparation method of a microbial material for reducing the salt expansion and frost heaving of highway subgrade saline soil according to claim 1, characterized in that Proceed as follows: a. Strain activation: Inoculate the cryopreserved Neorhizobium alkalisoli into a solid nitrogen-fixing medium, and culture it in an incubator at 33°C. After colonies grow, pick a single colony and transfer it to a liquid nitrogen-fixing medium, and culture it in a shaker at 33°C and 180 rpm for 24 h; the solid nitrogen-fixing medium is composed of raw materials in mass percentages: mannitol 2.0 g, potassium dihydrogen phosphate 0.02 g, dipotassium hydrogen phosphate 0.08 g, magnesium sulfate 0.01 g, calcium sulfate 0.01 g, yeast extract 0.05 g, ferric chloride 0.001 g, sodium molybdate 0.0002 g, adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, agar 1.5 g, sterilization temperature 121°C, 20 minutes; the liquid nitrogen-fixing medium is composed of raw materials in mass percentages: mannitol 2.0 g, potassium dihydrogen phosphate 0.02 g, dipotassium hydrogen phosphate 0.08 g, magnesium sulfate 0.01 g, calcium sulfate 0.01 g, yeast extract 0.05 g, ferric chloride 0.001 g, sodium molybdate 0.0002 g, adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilization temperature 121°C, 20 minutes; b. Seed liquid preparation: Inoculate the strain obtained in step a into a liquid nitrogen-fixing medium at an inoculation amount of 6% by volume, and culture it in a shaker at 33°C and 180 rpm for 24 h to obtain a seed liquid; the liquid nitrogen-fixing medium is composed of raw materials in mass percentages: mannitol 2.0 g, potassium dihydrogen phosphate 0.02 g, dipotassium hydrogen phosphate 0.08 g, magnesium sulfate 0.01 g, calcium sulfate 0.01 g, yeast extract 0.05 g, ferric chloride 0.001 g, sodium molybdate 0.0002 g, adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilization temperature 121°C, 20 minutes; c. Fermentation broth preparation: Inoculate the seed liquid obtained in step b into a liquid nitrogen-fixing medium at an inoculation amount of 6% by volume, and culture it in a shaker at 33°C and 180 rpm for 120 h to obtain a fermentation broth; the liquid nitrogen-fixing medium is composed of raw materials in mass percentages: mannitol 2.0 g, potassium dihydrogen phosphate 0.02 g, dipotassium hydrogen phosphate 0.08 g, magnesium sulfate 0.01 g, calcium sulfate 0.01 g, yeast extract 0.05 g, ferric chloride 0.001 g, sodium molybdate 0.0002 g, adjust the pH to 7.0 - 7.20 with 1 mol / l hydrochloric acid, sterilization temperature 121°C, 20 minutes; d. Solid dry powder preparation: The fermentation broth obtained in step c is spray-dried using a large centrifugal spray dryer ZLPG-20, a spray drying tower, with an inlet temperature of 50°C, an outlet temperature of 80°C, and a flow rate of 192.0 ml / min, to obtain a solid powder microbial material with a water content of 1.4%, viable bacteria count of 4.6×10 15 cfu / g, and solubility ≤ 100 mg / ml.

4. Use of a microbial material for reducing salt expansion and frost heaving of highway subgrade saline soil according to claim 1, characterized in that, The mixing ratio of the obtained microbial material and saline soil is 1 - 4% by mass percentage, and at a temperature of 5°C - 15°C, the salt expansion amount of the saline soil is reduced by 5% - 50%.

Images