Preparation method and application of bNabs-NK cells

By chimeric bNAbs on exosomes and co-incubating with NK cells, bNAbs-NK cells were formed, which solved the problems of short half-life, immune escape and high cost in the treatment of HIV, and achieved efficient, safe and economical HIV treatment effects.

CN120366226APending Publication Date: 2025-07-25WUHAN UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510511581.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The existing broad-spectrum neutralizing antibodies (bNAbs) in the treatment of HIV have problems such as short half-life, immune escape, high production costs and side effects, which limit its wide application in HIV treatment.

Method used

By chimeric bNAbs on exosomes and co-incubating with NK cells, bNAbs-NK cells are formed, and broad-spectrum neutralizing antibodies are targeted to deliver to the surface of NK cells using the exosome delivery system, enhancing the antiviral activity of NK cells, avoiding the risk of gene editing and immune escape, and reducing production costs.

Benefits of technology

It significantly improves the antiviral activity of NK cells, extends the half-life of antibodies, reduces therapeutic side effects, reduces production costs, and provides a more efficient, safe and economical HIV treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366226A_ABST
    Figure CN120366226A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method and application of bNabs-NK cells, and belongs to the technical field of biological medicines. The method comprises the following steps: carrying out homologous recombination on CD28TM, C / Dbox, a bNAbs heavy chain variable region fragment and a pFUSEss-chig-hg1 heavy chain expression vector, carrying out homologous recombination on a bNAbs light chain variable region fragment and a pFUSE2ss-clig-hk light chain expression vector, constructing a bNAbs heavy chain expression plasmid and a bNAbs light chain expression plasmid, co-transfecting a 293F cell with a CD63-L7Ae specific packaging plasmid and the two plasmids to obtain bNAbs EXO, incubating with an NK cell by utilizing the bNAbs EXO, and carrying out high-throughput screening on the bNAbs heavy chain expression plasmid and the bNAbs light chain expression plasmid. The target delivery of the antibody is realized under the condition of no gene modification, the NK cell surface expression bNAbs is successfully induced, the bNAbs-NK cell is constructed, the bNAbs-NK cell has higher in-vitro and in-vivo antiviral activity, the problems of short antibody half-life period, immune escape, treatment side effect, high production cost and the like in the existing treatment method are obviously solved, and the method is suitable for clinical application. And a more efficient, safer, economical and sustainable treatment strategy is provided for HIV treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a preparation method and application of bNAbs-NK cells. Background Art

[0002] The infection of Human Immunodeficiency Virus (HIV) remains a major challenge in the global public health field. Since the first discovery of HIV in the early 1980s, more than 75 million infection cases have been reported globally. Although Highly Active Antiretroviral Therapy (HAART) has significantly extended the survival period of infected patients, HIV infection still cannot be completely cured. Currently, the biggest challenges in the treatment of HIV infection are the latency of the virus in the body, drug resistance, and the long-term dependence of treatment. With the progress of scientific research, more and more potential treatment strategies have gradually emerged, including emerging therapies such as CAR-T cell therapy, gene editing technology (such as CRISPR), and broad-spectrum neutralizing antibody therapy. These methods not only supplement the existing HAART therapy but also bring new hope for the cure of HIV.

[0003] Highly Active Antiretroviral Therapy (HAART) is currently the standard treatment for HIV-infected patients. By combining the use of nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (INSTIs), it effectively inhibits HIV replication, reduces the viral load, thus significantly delaying the disease progression, improving the quality of life of patients, and reducing HIV-related complications and mortality. Although HAART can control the virus for a long time, it cannot completely eliminate the latent HIV virus in the body, and long-term treatment may lead to the development of drug resistance, drug side effects, and adverse drug interactions. Especially in areas with scarce treatment resources, the drug resistance problem is more prominent.

[0004] In recent years, CAR-T cell therapy, as a revolutionary immunotherapy, has been tried for the treatment of HIV. This method isolates patients' T cells in vitro, uses genetic engineering to make them express chimeric antigen receptors (CARs) that can recognize HIV-infected cells, and then re-infuses them into the body to enhance the ability of T cells to clear HIV-infected cells. CAR-T therapy shows potential in improving immune response and weakening virus escape, and is expected to bring a new direction for the functional cure of HIV. However, currently, CAR-T therapy is still in the clinical trial stage, with problems such as high treatment cost, possible cytokine release syndrome (CRS) and neurotoxicity, and its persistence in the body and the ability to avoid drug resistance still need to be further optimized.

[0005] Gene therapy, especially the application of the CRISPR-Cas system, also provides a new approach for the treatment of HIV. By targeting and knocking out the main HIV receptors such as CCR5 or CD4 genes, the resistance of host cells to the virus can be significantly enhanced. CRISPR-Cas9 is the most widely studied gene editing tool at present, while the new CRISPR-Cas12a system has attracted attention due to its higher editing accuracy and lower off-target risk. Nevertheless, gene therapy still faces technical challenges such as off-target effects, clinical operation safety, and how to ensure the long-term survival of edited cells in the body, which limits its practical application in the treatment of HIV.

[0006] Broadly Neutralizing Antibodies (bNAbs) are antibodies that target the surface glycoproteins gp120 or gp41 of the HIV virus and can neutralize multiple HIV subtypes, thereby preventing the binding of HIV to host cells and avoiding virus invasion. bNAbs can provide continuous immune protection for HIV-infected individuals, especially in cases where ART resistance occurs or patients cannot tolerate ART. Different from traditional single antibodies, bNAbs have cross-subtype immune activity and can effectively neutralize different types of HIV virus variants.

[0007] At present, preliminary results have been achieved in the clinical research of bNAbs. In some clinical trials, bNAbs have shown the potential to inhibit HIV viral load and delay the virus progression, and in some HIV-infected individuals, bNAbs can replace ART and play a role in maintaining a low level of virus for a long time. More importantly, bNAbs can be administered by intravenous injection or subcutaneous injection, providing a relatively convenient treatment method for patients.

[0008] However, despite the strong potential shown by bNAbs, there are still certain limitations. First, there is still a risk of immune escape of bNAbs against HIV, especially in the context of virus mutation, and the antibody may not be able to effectively recognize new variants. Second, the production and preparation process of bNAbs is complex and costly, which limits their wide application. Therefore, how to improve the treatment effect of bNAbs, reduce costs and solve the drug resistance problem remains the key issue that needs to be further addressed in this therapy.

[0009] Defects of the prior art:

[0010] As a therapeutic strategy against HIV, bNAbs can neutralize multiple HIV subtypes and effectively prevent virus-host cell binding by targeting viral surface glycoproteins such as gp120 and gp41. However, existing bNAb therapies still have some significant drawbacks that limit their widespread clinical use.

[0011] First, one of the major drawbacks of bNAb therapy is its short half-life, i.e., the antibodies have a relatively short duration in the body and usually require frequent injections to maintain their efficacy. This drawback leads to patients having to receive treatment regularly, increasing the complexity of treatment and the issue of patient compliance. The clearance rate of the antibodies is relatively high, especially after the immune system recognizes and removes these exogenous proteins, resulting in a rapid decline in their drug efficacy and potential recurrence of the virus during treatment intervals. In addition, frequent dosing not only places an economic burden on patients but also may affect their quality of life and reduce the feasibility of long-term treatment.

[0012] Second, immune escape is another key drawback of bNAb therapy. Although bNAbs can neutralize multiple HIV subtypes, due to the high variability of HIV, the virus may escape antibody neutralization through mutations. These mutations usually occur in the antigenic epitopes targeted by the antibodies, enabling the virus to survive and continue replicating under the pressure of the immune system. Therefore, over time, in some patients, antibody failure or increased viral drug resistance may occur, and this immune escape effect significantly reduces the long-term effectiveness and universality of the treatment.

[0013] In addition, the high production cost of bNAbs is an important obstacle to their widespread use. Existing bNAbs are usually produced through complex recombinant technologies in cell culture, requiring expensive facilities and highly refined quality control to ensure the purity and activity of the antibodies. This high cost results in expensive treatment, making it difficult to promote this therapy in low-income countries and regions and limiting its global popularity. Moreover, although bNAbs show strong efficacy in the short term, since their therapeutic effect is usually temporary, patients may relapse after treatment stops. This means that bNAbs do not have a long-term maintenance effect and cannot fundamentally eliminate HIV infection. The recurrence of the virus not only increases the need for retreatment in patients but also may lead to a rebound in viral load, thereby affecting the immune function of patients and increasing the risk of secondary infections.

[0014] Finally, bNAbs treatment may trigger some immune-related side effects. Although bNAbs are usually monoclonal antibodies that have been rigorously screened and optimized, in some patients, adverse reactions such as allergic reactions, overactivation of the immune system, and cytokine storms may still occur. Long-term use of these antibodies may lead to an increased burden on the immune system and even trigger immune tolerance or immunosuppression, thus affecting the patient's resistance to other pathogens.

[0015] In summary, the existing bNAbs for HIV treatment have defects such as short half-life, immune escape, high production cost, treatment temporariness, and potential immune-related side effects. These problems limit the wide application of broad-spectrum neutralizing antibodies in HIV treatment, and innovative technologies and methods are urgently needed to address these deficiencies. Summary of the Invention

[0016] To achieve the above objectives, the present invention adopts the following technical solutions:

[0017] In the first aspect, the present invention provides a method for preparing bNAbs-NK cells, comprising the following steps:

[0018] (1) Take six fragments: the variable heavy chain region of VRC01 antibody VRC01-VH, the variable light chain region of VRC01 antibody VRC01-VL, the variable heavy chain region of 3BNC117 antibody 3BNC117-VH, the variable light chain region of 3BNC117 antibody 3BNC117-VL, the variable heavy chain region of N6 antibody N6-VH, and the variable light chain region of N6 antibody N6-VL. Use restriction enzymes to double-digest the pFUSE2ss-clig-hk and pFUSEss-chig-hg1 vectors to obtain linearized antibody light and heavy chain expression vectors. Homologously recombine CD28 TM, C / Dbox with the above bNAbs heavy chain variable region fragments and the pFUSEss-chig-hg1 vector, and homologously recombine the above bNAbs light chain variable region fragments with the pFUSE2ss-clig-hk vector. Transform and screen to obtain the heavy chain expression plasmids and light chain expression plasmids of the three antibodies;

[0019] (2) Conduct experiments using the above three bNAbs heavy chain expression plasmids and light chain expression plasmids respectively: Take 50-150 μg, the heavy chain expression plasmid and light chain expression plasmid of the same bNAbs with a mass ratio of 1:5-1-5, and 10-100 μg of the CD63-L7Ae specific packaging plasmid. Co-transfect PEI with the above expression plasmids and packaging plasmids into HEK 293F cells to obtain chimeric bNAbs exosomes VRCCD28CDbox-EXO, BNCCD28CDbox-EXO, and N6CD28CDbox-EXO;

[0020] (3) The three resulting chimeric bNAbs exosomes were co-incubated with NK cells at a ratio of 10 5 -10 10 particles / cells respectively to obtain bNAbs-NK cell VRCCD28CDbox-NK, BNCCD28CDbox-NK, N6CD28CDbox-NK;

[0021] The nucleotide sequences of the six fragments of VRC01-VH, VRC01-VL, 3BNC117-VH, 3BNC117-VL, N6-VH, and N6-VL are shown in SEQ ID NO.1-6;

[0022] The nucleotide sequence of CD28 TM is shown in SEQ ID NO.7;

[0023] The nucleotide sequence of C / Dbox is shown in SEQ ID NO.8;

[0024] The nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO.9.

[0025] Furthermore, in step (1), the pFUSEss-chig-hg1 vector was double-digested with EcoRI-HF and NheI-HF; the pFUSE2ss-clig-hk vector was double-digested with EcoRI-HF and NcoI-HF.

[0026] Furthermore, in step (2), 100 μg of heavy chain expression plasmid and light chain expression plasmid were taken, and the mass ratio of the heavy chain expression plasmid to the light chain expression plasmid was 2:3; the dosage of the specific packaging plasmid CD63-L7Ae was 50 μg.

[0027] Furthermore, the heavy chain expression plasmid, light chain expression plasmid, and specific packaging plasmid were added to 4 mL of F complete medium and mixed, and left standing at room temperature for 5 min. At the same time, 300 μg of PEI with a concentration of 1 μg / μL was added to another 4 mL of F complete medium and mixed, and left standing at room temperature for 5 min. Then the plasmid / F medium was added to the PEI / F medium and mixed, and left standing at room temperature for 30 min. Then the obtained plasmid / PEI medium was added to HEK 293F cells for transfection. After 24 h, 1 / 20 of the transfection system of OPM-CHO PFF06 protein-free cell feed and 1 / 50 of the transfection system of L-glutamine were added and cultured for another 72 h, and the supernatant was collected and purified by ultracentrifugation to obtain chimeric bNAbs exosomes.

[0028] Further, the method of ultracentrifugation is as follows: centrifuge at 1 - 5 °C and 100×g - 500×g for 1 - 10 min, then centrifuge at 1000×g - 5000×g for 20 - 40 min, and finally centrifuge at 5000×g - 15000×g for 50 - 70 min. Collect the supernatant, add nuclease with a final concentration of 1 - 3 U and magnesium chloride with a concentration of 1 - 5 μmol / L, and incubate overnight. Centrifuge at 90000×g - 110000×g for 80 - 100 min, discard the supernatant, resuspend the precipitate with 10 - 30 mL of PBS, then centrifuge at 90000×g - 110000×g for 80 - 100 min again, discard the supernatant, resuspend the precipitate with 100 - 30 mL of PBS, and collect the supernatant after 48 - 96 h. Centrifuge at 50000×g - 150000×g for 50 - 100 min and repeat twice to obtain bNAbs - chimeric exosomes.

[0029] Further, the F medium is obtained by mixing OPM - 293CD05 Medium without antibiotics and SMM293 - TII medium at a volume ratio of 1 - 2:1 - 2.

[0030] In a second aspect, the present invention provides a bNAbs - NK cell, which is obtained by the preparation method of the bNAbs - NK cell.

[0031] In a third aspect, the present invention also provides the application of the bNAbs - NK cell in the preparation of an anti - HIV product for treatment.

[0032] Further, the product is an anti - HIV drug.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] 1. Improve the antiviral treatment effect: Through the efficient delivery system of exosomes, bNAbs can quickly and effectively act on immune cells, enhancing the antiviral activity of NK cells. In the solution of the present invention, exosomes bind to FCγRIII / CD16 on the surface of NK cells through their surface Fc, successfully transforming NK cells into bNAbs - NK cells, thereby significantly improving the recognition and clearance ability of NK cells against HIV virus. Through this mechanism, the virus replication level of HIV is effectively reduced, with high in - vivo antiviral activity and significantly improved treatment effect.

[0035] 2. Enhance the targeted killing ability of immune cells: Since exosomes bind to the FCγRIII / CD16 sites expressed on the surface of NK cells through their surface Fc segments, they can enhance the targeted killing ability of NK cells and significantly improve their clearance effect on HIV-infected cells. Experimental data show that bNAbs-NK cells can quickly recognize and kill infected cells, thus playing an important role in HIV treatment.

[0036] 3. Reduce side effects during treatment: Since the method of delivering antibodies by exosomes has low immunogenicity and can precisely deliver antibodies to the surface of immune cells, the present invention avoids the systemic side effects and immune responses in traditional treatment methods. Compared with the prior art, this solution is milder and more efficient, greatly reducing the adverse reactions of patients during treatment.

[0037] 4. Reduce the potential risks of immune cell gene editing: Compared with the common gene editing methods in the prior art, the present invention does not rely on the modification of cell genes and avoids the adverse reactions or potential risks that gene editing may bring (such as gene mutations or over-strong immune responses). This solution only delivers through exosomes and binds to Fc receptors, without changing the cell genetic material, reducing the adverse effects on the immune system during treatment, and is simple to operate with high safety.

[0038] 5. Effective countermeasure against immune escape: Through the binding of exosome carriers to the Fc receptors on the surface of NK cells, the present invention can effectively bypass the traditional immune escape mechanism and reduce the immune escape ability of viruses or tumor cells. Compared with traditional therapies, this technical solution enhances the anti-tumor and anti-viral effects of NK cells through natural immune pathways, thereby providing a more precise and long-lasting immunotherapy.

[0039] The innovation of the technical solution of the present invention lies in chimerizing bNAbs on exosomes and co-incubating the exosomes of the chimeric antibody with natural killer (NK) cells to form bNAbs-NK cells. Exosomes not only carry broad-spectrum neutralizing antibodies but also encapsulate the mRNA of bNAbs, thus significantly prolonging the half-life of the antibodies. In this way, exosomes can effectively protect the antibodies from degradation by enzymes in the body and, by regulating their release mechanism, extend the retention time of the antibodies in the body, thereby reducing the frequency of frequent drug administration for patients. In addition, this technical solution utilizes the synergistic effect of exosomes and NK cells to enhance the therapeutic effect. NK cells can recognize and eliminate infected cells, thus overcoming the problem of viral immune escape and enhancing the immune effect of the antibodies. As a delivery carrier, exosomes can precisely deliver broad-spectrum neutralizing antibodies to target cells, improve the targeting and efficacy of the antibodies, while reducing interference with the systemic immune system, reducing treatment side effects, and ensuring the safety of treatment. In addition, exosomes have good biocompatibility and can avoid excessive immune responses caused by antibodies, thus providing a safer treatment. By optimizing the production process of exosomes, this technology not only ensures the stability of the antibodies but also improves production efficiency, reduces production costs, and further reduces treatment costs. In summary, the technical solution of the present invention innovatively chimerizes broad-spectrum neutralizing antibodies on exosomes and synergistically acts with NK cells, significantly solving the problems of short antibody half-life, immune escape, treatment side effects, and high production costs in existing treatment methods, and providing a more efficient, safe, economical, and sustainable treatment strategy for HIV treatment. Description of the Drawings

[0040] Figure 1 Schematic diagram of the construction of the light and heavy chains of bNAbs and the recombinant plasmid map in Example 1;

[0041] Figure 2 Transmission electron microscope (TEM) characterization diagram of exosomes in Example 2;

[0042] Figure 3 Nanoparticle tracking characterization diagram of exosomes in Example 2;

[0043] Figure 4 Detection and surface marker analysis diagram of exosomes in Example 2;

[0044] Figure 5 Analysis of exosome particle concentration and surface antibody expression by nanoparticle flow cytometry in Example 3;

[0045] Figure 6 Analysis of the expression of the Fc segment on the surface of exosomes by flow cytometry in Example 3;

[0046] Figure 7 Analysis of the expression of surface markers on NK cells and their amplification in Example 4;

[0047] Figure 8 It is the time result graph of exosome-targeted delivery of bNAbs to NK cells in Example 5;

[0048] Figure 9 It is the time gradient expression of bNAbs-NK detected by flow cytometry in Example 5 based on engineered EXO;

[0049] Figure 10 It is the expression analysis graph of co-incubation of exosomes with Fc segment on the surface blocked or unblocked and NK cells in Example 6;

[0050] Figure 11 It is the expression analysis graph of co-incubation of exosomes with FCγRIII / CD16 on the surface of NK cells blocked or unblocked in Example 7;

[0051] Figure 12 It is the result graph of the in vitro killing experiment of bNAbs-NK in Example 8;

[0052] Figure 13 It is the result graph of detecting immune cells in the peripheral blood of humanized immunodeficient mice by flow cytometry in Example 9;

[0053] Figure 14 It is the small animal imaging, body weight change and survival curve graph of the HIV-infected humanized mouse model in Example 9; Detailed implementation manners

[0054] For better illustration of the present invention, the following examples are specifically listed. Obviously, the described examples are only a part of the present invention, rather than all the examples. Other examples obtained by those skilled in the art based on the examples in the present invention without creative efforts all fall within the protection scope of the present invention.

[0055] The technical solution of the present invention will be further described below with reference to the drawings and examples.

[0056] The VRC01-VH nucleotide sequence is as shown in SEQ ID NO.1:

[0057] caggtgcagctggtgcagtctgggggtcagatgaagaagcctggcgagtcgatgagaatttcttgtcgggcttctggatatgaatttattgattgtacgctaaattggattcgtctggcccccggaaaaaggcctgagtggatgggatggctgaagcctcgggggggggccgtcaactacgcacgtccacttcagggcagagtgaccatgactcgagacgtttattccgacacagcctttttggagctgcgctcgttgacagtagacgacacggccgtctacttttgtactaggggaaaaaactgtgattacaattgggacttcgaacactggggccggggcaccccggtcatcgtctcatca(SEQ IDNO.1);

[0058] The VRC01-VL nucleotide sequence is as shown in SEQ ID NO.2:

[0059] gaaattgtgttgacacagtctccaggcaccctgtctttgtctccaggggaaacagccatcatctcttgtcggaccagtcagtatggttccttagcctggtatcaacagaggcccggccaggcccccaggctcgtcatctattcgggctctactcgggccgctggcatcccagacaggttcagcggcagtcggtgggggccagactacaatctcaccatcagcaacctggagtcgggagattttggtgtttattattgccagcagtatgaattttttggccaggggaccaaggtccaggtcgacattaagcga(SEQ ID NO.2);

[0060] The 3BNC117-VH nucleotide sequence is as shown in SEQ ID NO.3:

[0061] CAGGTCCAATTGTTACAGTCTGGGGCAGCGGTGACGAAGCCCGGGGCCTCAGTGAGAGTCTCCTGCGAGGCTTCTGGATACAACATTCGTGACTACTTTATTCATTGGTGGCGACAGGCCCCAGGACAGGGCCTTCAGTGGGTGGGATGGATCAATCCTAAGACAGGTCAGCCAAACAATCCTCGTCAATTTCAGGGTAGAGTCAGTCTGACTCGACACGCGTCGTGGGACTTTGACACATTTTCCTTTTACATGGACCTGAAGGCACTAAGATCGGACGACACGGCCGTTTATTTCTGTGCGCGACAGCGCAGCGACTATTGGGATTTCGACGTCTGGGGCAGTGGAACCCAGGTCACTGTCTCGTCAGCGTCGACCAAGGGCCCA(SEQ ID NO.3);

[0062] The 3BNC117-VL nucleotide sequence is shown in SEQ ID NO.4 as follows:

[0063] GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCCTCTGTGGGAGATACCGTCACTATCACTTGCCAGGCAAACGGCTACTTAAATTGGTATCAACAGAGGCGAGGGAAAGCCCCAAAACTCCTGATCTACGATGGGTCCAAATTGGAAAGAGGGGTCCCATCAAGGTTCAGTGGAAGAAGATGGGGGCAAGAATATAATCTGACCATCAACAATCTGCAGCCCGAAGACATTGCAACATATTTTTGTCAAGTGTATGAGTTTGTCGTCCCTGGGACCAGACTGGATTTGAAACGTACGGTGGCTGCACCA(SEQ ID NO.4);

[0064] The N6-VH nucleotide sequence is shown in SEQ ID NO.5 as follows:

[0065] CGAGCGCACCTGGTACAATCAGGGACTGCGATGAAGAAACCGGGGGCCTCAGTAAGAGTCTCCTGCCAGACCTCTGGATACACCTTTACCGCCCACATATTATTTTGGTTCCGACAGGCCCCCGGGCGAGGACTTGAGTGGGTGGGGTGGATCAAGCCACAATATGGGGCCGTGAATTTTGGTGGTGGTTTTCGGGACAGGGTCACATTGACTCGAGACGTATATAGAGAGATTGCGTACATGGACATCAGAGGCCTTAAACCTGACGACACGGCCGTCTATTACTGTGCGAGAGACCGTTCCTATGGCGACTCCTCTTGGGCCTTAGATGCCTGGGGACAGGGAACGACGGTCGTCGTCTCCGCG(SEQ IDNO.5);

[0066] The N6-VL nucleotide sequence is as shown in SEQ ID NO.6:

[0067] TACATCCACGTGACCCAGTCTCCGTCCTCCCTGTCTGTGTCTATTGGAGACAGAGTCACCATCAATTGCCAGACGAGTCAGGGTGTTGGCAGTGACCTACATTGGTATCAACACAAACCGGGGAGAGCCCCTAAACTCTTGATCCACCATACCTCTTCTGTGGAAGACGGTGTCCCCTCAAGATTCAGCGGCTCTGGATTTCACACATCTTTTAATCTGACCATCAGCGACCTACAGGCTGACGACATTGCCACATATTACTGTCAAGTTTTACAATTTTTCGGCCGAGGGAGTCGACTCCATA TTAAA(SEQ ID NO.6);

[0068] The nucleotide sequence of CD28 TM is as shown in SEQ ID NO.7:

[0069] TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTG CTAGTAACAGTGGCCTTTATTATTTTCTGGGTG(SEQ ID NO.7);

[0070] The nucleotide sequence of the C / D box is shown in SEQ ID NO.8:

[0071] TGCAAAATAGACTTTAGAGGGTACCGTGATCCGAAAGGTGAGTACCCTGCAACCTCGACTTCGAACTCGAGA(SEQ ID NO.8);

[0072] The nucleotide sequence of the CD63-L7Ae is shown in SEQ ID NO.9:

[0073]

[0074] Construction of bNAbs Expression Vector in Example 1

[0075] The bNAbs expression plasmids include the bNAbs heavy chain expression plasmid and the bNAbs light chain expression plasmid, and the two need to be constructed separately. The pFUSEss-chig-hg1 vector contains the human IgG1 heavy chain constant region, while the pFUSE2ss-clig-hk vector contains the human IgG1 light chain constant region. Both vectors are purchased from Invivogen. When constructing the bNAbs expression plasmid, only the corresponding antibody heavy chain variable region (VH) and light chain variable region (VL) need to be cloned onto the corresponding vector by homologous recombination.

[0076] Using the plasmids of PLVX-EF1α-VRC01-strep-Ⅱ-tag-G4S-3, BRD-PTK-kan-3BNC117-01, and BRD-PTK-kan-N6-01 as templates, six fragments, namely the VRC01 antibody heavy chain variable region VRC01-VH, the VRC01 antibody light chain variable region VRC01-VL, the 3BNC117 antibody heavy chain variable region 3BNC117-VH, the 3BNC117 antibody light chain variable region 3BNC117-VL, the N6 antibody heavy chain variable region N6-VH, and the N6 antibody light chain variable region N6-VL (the nucleotide sequences of the six fragments are shown in SEQ ID NO.1-6), were obtained by PCR amplification. The fragments were recovered by gel electrophoresis. The pFUSEss-chig-hg1 vector was double-digested with restriction enzymes (EcoRI-HF, NheI-HF), and at the same time, the pFUSE2ss-clig-hk vector was double-digested with restriction enzymes (EcoRI-HF, NcoI-HF) to obtain linearized antibody light and heavy chain expression vectors. CD28TM and C / Dbox were homologously recombined with the above bNAbs heavy chain variable region fragments and the linearized pFUSEss-chig-hg1 heavy chain expression vector, and the above bNAbs light chain variable region fragments were homologously recombined with the linearized pFUSE2ss-clig-hk light chain expression vector. After transformation and screening, three bNAbs heavy chain expression plasmids (the RNA packaging signal C / Dbox was inserted into the 3' end of the bNAbs heavy chain expression plasmid) and light chain expression plasmids were obtained. The construction of bNAbs light and heavy chains and the recombinant plasmid maps are as Figure 1 shown.

[0077] Exosome Packaging and Purification in Example 2

[0078] The CD63-L7Ae specific packaging plasmid (the nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO.9), the bNAbs light chain expression plasmid and the bNAbs heavy chain expression plasmid were co-transfected into 293F cells to jointly construct an exosome specific packaging system.

[0079] 1. HEK 293F cell transfection

[0080] HEK 293F cells were cultured in F medium which was a mixture of OPM-293CD05Medium medium without antibiotics and SMM293-TII medium at a volume ratio of 1:1. The culture conditions were 125 rpm, 37 °C, 5% CO2, and the cell seeding density was 0.3×10 6 cells / mL. They were placed in a shaker and cultured for 72 h. The cell density on the day of transfection should reach 2×10 6 cells / mL, and then the cells were seeded into a 500 mL shake flask containing 100 mL of medium and continued to be cultured.

[0081] Take 100 μg of plasmid (pFuSE2ss-VRC01-VL:pFuSEss-VRC01CD28CDbox-VH = 3:2, that is, 60 μg of pFuSE2ss-VRC01-VL and 40 μg of pFuSEss-VRC01CD28CDbox-VH), 50 μg of CD63-L7Ae specific packaging plasmid, and add them to 4 mL of F complete medium and mix well; at the same time, add 300 μg of PEI solution (1 μg / μL) to another 4 mL of F complete medium, and mix well respectively. Both mixed systems were left standing at room temperature for 5 min. Use a left-handed electric pipette to pipette the PEI / F complete medium mixture, and at the same time, use a right-handed electric pipette to gradually add drop by drop the plasmid / F complete medium mixture that has passed through a 0.22 μm filter membrane into the PEI / F complete medium mixture. After mixing, leave it standing at room temperature for 30 min. Slowly drip the plasmid / PEI mixed medium into the prepared HEK 293F cells for transfection. After 24 h of transfection, add OPM-CHO PFF06 protein-free cell feed (1 / 20 of the transfection system) and L-glutamine (1 / 50 of the transfection system), and continue to culture for 72 h and then collect the supernatant.

[0082] The method of transfecting the 3BNC117, N6 antibody light and heavy chain expression plasmids into cells is the same as that of the VRC01 antibody light and heavy chain expression plasmids. Similarly, the relevant experimental operation methods of the subsequent three antibodies are all the same.

[0083] 2. Isolation and characterization of exosomes

[0084] Collect the cell supernatant 72 h after transfection, ensuring that the cell viability exceeds 95%. Centrifuge the cell supernatant at 300×g for 5 min at 4°C in sequence to remove live cells, and then centrifuge at 3000×g for 30 min to remove dead cells and larger cell debris. Finally, centrifuge at 10000×g for 60 min to remove larger extracellular vesicles (such as microvesicles) and organelles, etc. Add Universal Benzo nuclease with a final concentration of 2 U and magnesium chloride with a concentration of 2 μmol / L to the treated supernatant and incubate overnight at 4°C. Transfer the treated supernatant to an ultracentrifugation tube, and use an Optima XE-100 ultracentrifuge to centrifuge at 100000×g for 90 min. Discard the supernatant, resuspend the precipitate in 20 mL PBS, and then centrifuge at 100000×g for 90 min again. Discard the supernatant, resuspend the precipitate in 200 μL PBS. Collect the cell supernatant at 72 h and centrifuge at 100000×g for 90 min, repeating the centrifugation operation twice to obtain bNAbs-targeted exosomes (VRCCD28CDbox-EXO, BNCCD28CDbox-EXO, N6CD28CDbox-EXO). After the exosomes are resuspended in PBS, their morphology, particle size distribution, and molecular characteristics are systematically characterized by a variety of methods, including transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA), and exosome capture bead binding flow cytometry.

[0085] Transmission electron microscopy ( Figure 2 ) observation shows that the isolated exosomes present a typical "cup-shaped" vesicle structure, with an average particle size of about 123 nm, which conforms to the classical morphological characteristics of exosomes. Nanoparticle tracking analysis further confirms that the particle size distribution of the extracted exosomes is mainly concentrated between 30 - 150 nm, showing a single peak and a normal distribution ( Figure 3 ), which is consistent with the particle size range of exosomes reported in the literature. Then, the surface marker proteins of exosomes are tested by magnetic bead capture flow cytometry. After incubating the exosomes with magnetic beads overnight, add 1 μL of flow antibodies against anti-human CD9, anti-human CD63, anti-human CD81 and the corresponding isotype control antibodies respectively, mix gently, and incubate for 60 min at 4°C in the dark. Wash the sample with 1 mL of PBS wash solution containing 2% FBS, place the test tube on the magnetic rack and let it stand for 5 min to collect the magnetic beads. After discarding the supernatant, repeat 2 times, and resuspend the sample in 350 μL of 1× detection buffer for flow cytometer analysis, as Figure 4 shown.

[0086] Example 3 Determination of Antibodies and Fc on the Surface of Exosomes

[0087] 1. Determination of Antibodies on the Surface of Exosomes

[0088] First, use a nano-flow cytometer (model: NanoFCM U30E) to measure the particle size and concentration of the exosome sample. Calibrate it with standard products QS2503 and S23M-Exo (provided by the supplier) to ensure the accuracy of the measurement results. Then, use the self-made exosome blank sample (exosomes obtained from culturing 293F cells without any treatment) and the sample transfected with the antibody plasmid for further measurement of particle size and concentration. During this process, detect from low concentration to high concentration by gradient dilution to determine the optimal dilution multiple, and obtain the particle size distribution and concentration data of the sample. Subsequently, according to the optimal dilution multiple, use the 07BC-FdAPC flow antibody to label the surface antibody of the exosome, and analyze the exosome by flow cytometry.

[0089] The particle size, concentration, and antibody labeling information obtained by flow cytometry show that the surface antibody expression of exosomes transfected with the antibody plasmid is 13.1%, while there is no significant antibody expression in the blank exosomes, as Figure 5 shown. This indicates that 13.1% of the exosomes have successfully incorporated the broad-spectrum neutralizing antibody.

[0090] 2. Determination of Fc on the surface of exosomes

[0091] During the exosome isolation process, add an appropriate amount of 10× washing buffer (the washing buffer is taken from the PSCapture TM Exosome Flow Cytometry Kit, catalog number SKJ1291) into a 15 mL centrifuge tube, dilute it to 1× with ultrapure water, and mix well with a vortex mixer. Add 50 μL (1:100) of exosome binding enhancer (100×, also taken from the PSCapture TM Exosome Flow Cytometry Kit) to the washing buffer and mix well to prepare the buffer containing the binding enhancer.

[0092] Transfer 300 μL of the prepared buffer to a new 1.5 mL microcentrifuge tube. Before use, mix the exosome capture magnetic beads with a vortex mixer for 10 s to ensure they are fully suspended. After incubating the exosomes with the magnetic beads overnight, add 1 μL of the BV421 anti-human IgG Fc flow antibody, mix gently, and incubate for 60 min in the dark at 2 - 8 °C. Wash the sample with 1 mL of PBS wash solution containing 2% FBS. Place the test tube on the magnetic rack and let it stand for 5 min to collect the magnetic beads. After discarding the supernatant, repeat this process twice. Resuspend the sample in 350 μL of PBS wash solution containing 2% FBS for flow cytometry analysis. Use the isotype control flow antibody as the isotype control group.

[0093] This set of data verified the expression of the Fc segment on the surface of exosomes by flow cytometry. The isotype control group showed extremely low positive signals, while exosomes derived from 293F cells and exosomes harvested after transfection (VRCCD28CDbox, BNCCD28CDbox, N6CD28CDbox) all showed significant positive signals, and the positive rates all exceeded 99%, as Figure 6 shown. These results indicate that the Fc segment was successfully expressed on the surface of exosomes, verifying their surface marker characteristics.

[0094] Example 4: Culture of NK cells

[0095] Collect 30 mL of peripheral blood from healthy donors, and isolate mononuclear cells using Ficoll lymphocyte separation solution. After counting, cell culture was performed using the Dako natural killer (NK) cell induction culture kit 2.0.

[0096] First, add the NK cell activator to the NK cell expansion medium to prepare the NK cell induction medium. On the first day, take 1.5×10 7 PBMCs and inoculate them into a T25 culture flask. The culture conditions are 37°C and 5% CO2. Add 50 μL of the NK cell activator to initiate cell expansion; on the third day, add 5 mL of fresh NK cell expansion medium (containing 5% heat-inactivated human plasma) to maintain the cell concentration. On the fifth day, monitor the proliferation of NK cells, and supplement fresh NK cell expansion medium (containing 5% heat-inactivated human plasma) according to the cell concentration, and adjust the cell concentration to 0.8 - 1.0×10 6 cells / mL to ensure that the cells continue to expand in the optimal growth state. After 7 days of culture, gradually reduce the concentration of heat-inactivated human plasma to 1% according to the cell growth situation, and harvest the cells on the 15th day. Flow cytometry analysis showed that after 15 days of culture, the proportion of CD3 - CD56 + cells on the surface of NK cells increased significantly to 88%. CD16 is an important receptor on the surface of NK cells. It can bind to the Fc segment of antibodies, initiate immune responses, and promote the recognition and killing of target cells by NK cells. The expression of CD16 on the surface of NK cells + was 96.6%. At the same time, the increase in CD16 + cells in NK cells reflects the enhanced functionality of NK cells, enabling them to effectively recognize and kill target cells, especially by the help of antibodies (such as anti-tumor antibodies) to mediate immune responses. At the same time, the amplification multiple of NK cells reached more than 4000 times (as Figure 7 shown). This method significantly promoted the proliferation of NK cells and ensured the cell activity and high purity.

[0097] Example 5: Co-incubation of NK cells with bNAbs-EXO through Fc segment ligation

[0098] 1. Expression of bNAbs in NK cells

[0099] The formation of bNAbs-NK cells is achieved by delivering broad-spectrum neutralizing antibodies (bNAbs) to natural killer cells (NK cells) via exosomes, and binding the Fc segment on the surface of exosomes to the Fc receptor (FcγR) on the surface of NK cells, thereby activating NK cells and enhancing their targeted killing function. This process does not rely on gene editing, but uses exosomes as natural delivery vectors to efficiently transfer antibodies, stably introduce them into NK cells, and enable the surface expression of the antigen-binding domain of the antibody, endowing them with the ability to target pathogens.

[0100] To study the targeting effects of different types of broad-spectrum neutralizing antibody chimeric exosomes (such as VRCCD28CDbox-EXO, BNCCD28CDbox-EXO, N6CD28CDbox-EXO) on NK cells, given that the Fc segment is expressed on the surface of exosomes and the Fc receptor (FcγR) is expressed on the surface of NK cells, exosomes bind to the Fc receptor on the surface of NK cells through the Fc segment to form bNAbs-NK cells. This study further explored the effect of the C / Dbox mRNA delivery system combined with CD63-L7Ae on the targeting of bNAbs EXO to NK cells. To evaluate the efficiency and dose-dependent experiment of bNAbs EXO delivering bNAb mRNA and specifically targeting NK cells to convert them into bNAbs-NK, 293F kong-EXO without adding broad-spectrum neutralizing antibody plasmid was used as a control. In the experiment, exosomes were added to NK cells with a purity greater than 80% at a dose of 10 6 particles / cells, incubated at 37 °C and 5% CO2, cells were collected at 12 hours and 24 hours respectively, and after incubating with 07BC-FdAPC flow antibody for 30 min, the expression of bNAbs on the surface of NK cells was detected by flow cytometry.

[0101] The results showed that bNAbs EXO could effectively deliver bNAbs to NK cells without relying on a viral system, induce their expression of bNAbs, achieve the transformation of NK cells into the bNAb-NK phenotype, and the transformation process showed a time- and dose-dependent enhancement trend. After co-incubating VRCCD28CDbox-EXO, BNCCD28CDbox-EXO, and N6CD28CDbox-EXO exosomes with NK cells, the expression of bNAbs could be detected on the surface of NK cells at each time point, and this effect was significantly higher than that of the kong-EXO treatment group, successfully inducing the formation of a targeting effect similar to CAR-NK cells. Especially at 24 hours of incubation, the expression of bNAbs in the N6CD28CDbox-EXO treatment group was the most significant. Compared with the kong-EXO group, the formed bNAbs-NK cells had both the effect of broad-spectrum neutralizing antibodies and the targeting killing mechanism of NK cells, providing a new theoretical basis and potential method for the application of exosomes in immunotherapy.

[0102] 2. Time-gradient expression of bNAbs in NK cells

[0103] The bNAbs-targeted exosomes were prepared using an exosome targeting system, and 293F kong-EXO without adding the broad-spectrum neutralizing antibody plasmid was used as a control. The obtained exosomes were co-cultured with the expanded NK cells. Similarly, the exosomes were added to the NK cells at a dose of 10 6 particles / cells, incubated at 37 °C and 5% CO2, and the expression of bNAbs on the surface of NK cells was detected on the 2nd, 5th, 8th, and 12th days, respectively, and analyzed using flowjo.

[0104] The results showed that on day 2, the Fc segment on the surface of exosomes bound to the Fc receptor (FcγR) on the surface of NK cells, and the bNAbs carried on the surface of exosomes bound to NK cells, thus forming bNAbs-NK cells. The bNAbs expression rates in the VRCCD28CDbox-NK group, BNCCD28CDbox-NK group, and N6CD28CDbox-NK group were 58.3%, 58.0%, and 55.0% respectively, which were much higher than those in the kong-EXO group. With the extension of the incubation time, on day 5, the expression of bNAbs-NK cells was still at a relatively high level, significantly higher than that in the blank group. On day 8, although the expression of bNAbs-NK cells decreased, due to the expression of mRNA, the expression of antibodies on the surface of NK cells could still be detected. By day 12, the expression levels of bNAbs on the surface of NK cells in all treatment groups decreased. Although the expression of BNAbs-NK cells changed during the incubation process, exosomes labeled with CD28CDbox (such as VRCCD28CDbox EXO, BNCCD28CDbox EXO, and N6CD28CDbox EXO) could maintain a relatively high bNAbs expression level for a long time, especially in the early incubation stage, indicating that CD28CDbox-labeled exosomes could effectively prolong the continuous expression time of bNAbs-NK cells and enhance the targeted immune effect of NK cells. In contrast, after co-incubation of kong-EXO with NK cells, bNAbs-NK cells were not formed, verifying the advantages and potential of CD28CDbox exosomes in targeted immunotherapy. This result provides a new theoretical basis and application prospect for the potential of exosomes in immunotherapy.

[0105] Example 6 Experiment of Co-incubating Exosomes with Blocked Fc Segment on the Surface and NK Cells

[0106] First, harvest exosome samples using the ultracentrifugation method and dilute them to an appropriate concentration (usually 1×10 13 particles / ml), and select the exosome usage amount according to the experimental design, usually 10 6 particles / cell. To reduce the non-specific binding of exosomes to other Fc receptors, mix the exosomes with 100 μL of phosphate buffer containing 1 μg of Fc segment blocker (such as HumanTruStain FcX TM , Biolegend) and incubate on ice for 10 min to block the Fc segment. Then, centrifuge to remove the unbound blocker and resuspend the exosomes with PBS buffer containing 2% FBS. Next, co-incubate the exosomes with blocked Fc segment and NK cells at a ratio of 10 6Mix with (number of particles / cells), and at the same time incubate EXO without blocking treatment with NK cells as a control in an incubator at 37°C for 24 h. After incubation, wash the cells with PBS buffer containing 2% FBS, and add antibodies against NK cell surface markers (such as CD3, CD56, CD16, etc.) for staining. Finally, analyze the interaction between NK cells and exosomes by flow cytometry, monitor the changes in NK cell surface markers and exosome binding conditions.

[0107] When NK cells were co-incubated with exosomes with blocked Fc segments, flow cytometry results showed that the expression of bNAbs antibodies was not detected on the surface of NK cells, but the expression of Fc receptor (CD16) on the surface of NK cells could be detected, indicating that the blocking of the Fc segment on the surface of exosomes effectively prevented the binding of exosomes to the Fc receptor (CD16) of NK cells, thereby inhibiting the expression of bNAbs antibodies. However, in the experimental group without blocking the Fc segment on the surface of exosomes, flow cytometry results showed that the expression of bNAbs antibodies was successfully detected on the surface of NK cells, while the Fc receptor (CD16) was not detected, indicating that exosomes bound to the Fc receptor on the surface of NK cells through their surface Fc segments, thereby effectively guiding broad-spectrum neutralizing antibodies (bNAbs) to the surface of NK cells.

[0108] Example 7 Experiment of co-incubating NK cells with blocked Fc segment (CD16) and exosomes

[0109] Use Ultra-LEAF TM Purified anti-human CD16 antibody (Biolegend) to block the Fc segment on the surface of NK cells. Resuspend 1×10 6 isolated NK cells in PBS buffer containing 2% FBS, and add anti-CD16 antibody (where the ratio of Fc Block to cell dosage is 10 μL Fc Block / 1×10 6 cells), incubate in the dark at 4°C for 12 min to reduce the non-specific binding of NK cells to exosomes or the Fc segment of antibodies through CD16. After completing the Fc segment blocking, wash the NK cells with NK medium, and mix them with exosomes at a ratio of 10 6 particles / cell, and at the same time incubate unblocked NK cells with bNAbs EXO as a control at 37°C for 24 h to ensure sufficient binding of exosomes to NK cells. After incubation, wash and stain the surface markers (such as CD3, CD56, CD16) of NK cells with PBS buffer containing 2% FBS, and then use flow cytometry to detect the binding of cell surface markers to exosomes.

[0110] In this experiment, use Ultra-LEAFTM After the purified anti-human CD16 antibody blocked the Fc receptor on the surface of NK cells, the flow cytometry results showed that after the NK cells with blocked Fc receptors were co-incubated with exosomes, the expression of bNAbs antibodies could not be detected on the surface of NK cells. In addition, the expression of Fc receptor (CD16) was not detected on the surface of NK cells after the blocking treatment. This indicates that the blocking of Fc receptors effectively prevented the binding of exosomes to NK cells through this receptor, thereby inhibiting the expression of bNAbs antibodies. In contrast, in the experimental group where the Fc receptors on the surface of NK cells were not blocked, the flow cytometry results showed that exosomes could effectively bind to NK cells through the Fc receptors on the surface of NK cells, and the expression of bNAbs antibodies could be detected on the surface of NK cells. At the same time, CD16 (Fc receptor) on the surface of NK cells was not detected due to its binding to the Fc receptor on the surface of exosomes, indicating that exosomes successfully expressed bNAbs antibodies on the surface of NK cells through their surface Fc. This result shows that NK cells without blocked Fc receptors can effectively bind to exosomes through their surface Fc receptors and import the antibodies on the surface of exosomes to the surface of NK cells.

[0111] Example 8 In vitro functional detection of bNAbs-NK cells

[0112] The in vitro anti-tumor function of bNAbs-NK cells was detected by the calcein detection method. The stably transfected cells 293T-NL4-gp120 EGFP and 293T-NDK-gp120 EGFP were selected as positive target cells (the cell construction method was: take 293T cells in good growth state, adjust the density to 1×10 6 cells / mL, and at 1×10 6Inoculate cells / well into a 6-well plate; add 100 μL of concentrated puc19-NL4-GFP and puc19-NDK-GFP lentivirus solution to each well, and add Polybrene at a final concentration of 4 μg / mL to enhance the virus infection efficiency; after incubating the cells at 37 °C and 5% CO2 for 4 - 6 h, discard the virus medium, add pre-warmed fresh complete medium (DMEM for cells, both containing 10% FBS and 1% P / S), and continue culturing; after 24 - 48 h of infection, add puromycin at a final concentration of 4 μg / mL for resistance screening; when the cell density reaches 80 - 90% density, digest with 0.05% Trypsin-EDTA and passage at a ratio of 1:3 - 1:5 to maintain the proliferation activity and long-term stability of the cells. The screening lasts for about 2 weeks. After the uninfected cells are completely apoptotic, reduce the puromycin concentration to 1 μg / mL to maintain stable screening and obtain stably transfected cells 293T-NL4-gp120EGFP and 293T-NDK-gp120 EGFP), using 293T cells as negative target cells.

[0113] Take appropriate amounts of the above 293T-NL4-gp120 EGFP, 293T-NDK-gp120 EGFP, and 293T target cells, and add Calcein-AM to a final concentration of 25 μM in a cell suspension of 1×10 6 cells / mL (PBS buffer containing 2% FBS), and incubate in an incubator for 30 min. At room temperature, wash twice and then resuspend the cells to 0.5×10 5 cells / mL. Add negative target cells and positive target cells to a 96-well plate. The positive target cells are divided into three groups. The first group: add 5000 293T-NL4-gp120 EGFP cells to each well; the second group: add 5000 293T-NDK-gp120 EGFP cells to each well; the third group: add 5000 293T cells to each well. Add kong-NK, VRCCD28CDbox-NK, BNCCD28CDbox-NK, and N6CD28CDbox-NK cells at effector-to-target ratios of 10:1, 5:1, 2.5:1, and 1:1 respectively, and incubate at 37 °C for 4 hours. After incubation, take the supernatant and measure the fluorescence intensity of calcein in it, and calculate the percentage of target cell lysis according to the spontaneous release control and the maximum release control.

[0114] The results of the percentage of target cell lysis are as Figure 12As shown, the results showed that bNAbs-NK cells could significantly promote the lysis of gp120-EGFP positive target cells (293T-NL4-gp120 EGFP, 293T-NDK-gp120 EGFP), and had no obvious killing effect on negative target cells (293T). As a carrier, exosomes could effectively deliver broad-spectrum neutralizing antibodies and enhance the targeted killing ability of NK cells, showing potential for application in immunotherapy.

[0115] Example 9 In vivo function detection of bNAbs-NK cells

[0116] 1. Establishment of a humanized model of immunodeficient mice

[0117] NPG mice were purchased from Vitalstar Biotechnology Co., Ltd. They were adaptively fed in the SPF-level barrier environment of Wuhan University of Science and Technology for 1 week before the experiment, and then transferred to the Biosafety Level 3 Laboratory of Wuhan Institute of Virology, Chinese Academy of Sciences for infection treatment. All mice were 6 weeks old. The animal experiment procedures used in the experiment had been approved by the Animal Ethics Committee of Wuhan University of Science and Technology, and the feed, water, and bedding were all sterilized by high-temperature and high-pressure treatment.

[0118] In humanized modeling, peripheral blood from healthy donors was obtained from Wuhan Central Blood Station, and PBMCs were separated by human lymphocyte separation medium and transplanted into mice. On the 17th day after transplantation, 150 μL of submandibular vein blood was collected from each mouse and anticoagulated with EDTA. The whole blood was mixed with an equal volume of red blood cell lysate, lysed on ice for 10 min, centrifuged at 500×g for 10 min. After removing the supernatant, the cells were resuspended with 100 μL of normal saline. After resuspension, 1 μL of anti-human CD45-BV421, CD3-APC-Cy7, CD4-FITC, and CD8-APC flow antibodies were added simultaneously, and stained at 4°C for 30 min, washed twice, and then 7-AAD dye was added for live / dead staining.

[0119] The results showed that 4 weeks after transplantation of human PBMCs into mice, the proportion of hCD45+ positive cells in peripheral blood was 73.3%, and the proportions of CD4 and CD8 were 42.2% and 53.1% respectively, which were significantly higher than the standard of 25%. After injecting PBMCs via the tail vein, human cells successfully proliferated and differentiated in mice, indicating that functional human immune cells had been established in the mice, and thus it could be considered that a stable NPG humanized mouse model had been successfully constructed, providing a basis for the subsequent establishment of an HIV-1 mouse infection model.

[0120] 2. Construction of an HIV mouse infection model

[0121] The HIV-1 NL4-3 virus is a wild-type CXCR4-tropic strain of HIV, which has the characteristic of infecting human peripheral blood CD4+ T cells. A luciferase (NanoLuc) gene was inserted successively between the Env gene and the Nef gene.

[0122] The successfully modeled mice were infected by intraperitoneal injection of 200 μl of HIV-1 NL4-3 virus solution with a titer of 200 TCID50. Fluorescence signals were collected by a small animal in vivo imaging system (Xenogen, Hopkinton). The in vivo imaging data were normalized using software Living image (Version 4.0). Imaging was performed on the 6th day after infection to monitor the distribution of HIV virus in the mice and the level of virus replication. Then, small animal in vivo imaging was performed on the 11th, 15th, 19th, 23rd, and 27th days respectively. Starting from the day after each imaging, the mice were treated by intravenous injection of 1×10 7 293F kong-NK cells and the above three bNAbs-NK cell types.

[0123] Figure 14 The results of the five treatment groups are shown. These include a positive control group (positive), a group of 293F-derived NK cells without engineering (293F kong-NK), and three engineered bNAbs-NK treatment groups (VRCCD28CDbox-NK, BNCCD28CDbox-NK, N6CD28CDbox-NK). Bioluminescence imaging was performed on each group of mice on the 6th, 11th, 15th, 19th, 23rd, and 27th days to detect the viral load and treatment effect in their bodies. In the positive control group, strong bioluminescence signals appeared in the mice starting from the 6th day, and the signals gradually increased over time until some mice died after the 15th day, indicating rapid virus replication and the induction of fatal immune failure. In the 293F kong-NK group, the bioluminescence signals in the early stage (Day 6) were lower than those in the positive control group, but over time, the signals gradually increased, and deaths began to occur on the 19th day, suggesting that unmodified NK cells have limited effectiveness in controlling virus amplification.

[0124] In contrast, the three engineered bNAbs-NK cell treatment groups showed significantly lower bioluminescence signals throughout the observation period. In particular, the VRCCD28CDbox-NK and N6CD28CDbox-NK treatment groups had the best effects. The signal intensity of the BNCCD28CDbox-NK treatment group was significantly lower compared to the positive control group, and the in vivo signal began to rapidly amplify on day 19, indicating the positive effect of this group of treatments in slowing down virus amplification. However, no deaths occurred in any of the groups treated with bNAbs-NK on day 27. Engineered bNAbs-NK cells can effectively play an antiviral role, not only inhibiting virus amplification but also significantly prolonging the survival period of mice, demonstrating the potential of this treatment against HIV.

[0125] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing bNAbs-NK cells, characterized in that, Comprising the following steps: (1) Take six fragments, namely the variable region of the heavy chain of VRC01 antibody (VRC01-VH), the variable region of the light chain of VRC01 antibody (VRC01-VL), the variable region of the heavy chain of 3BNC117 antibody (3BNC117-VH), the variable region of the light chain of 3BNC117 antibody (3BNC117-VL), the variable region of the heavy chain of N6 antibody (N6-VH), and the variable region of the light chain of N6 antibody (N6-VL). Use restriction endonucleases to double-digest the pFUSE2ss-clig-hk and pFUSEss-chig-hg1 vectors to obtain linearized antibody light and heavy chain expression vectors. Perform homologous recombination of CD28 TM, C / D box with the above bNAbs heavy chain variable region fragments and the pFUSEss-chig-hg1 vector, and perform homologous recombination of the above bNAbs light chain variable region fragments with the pFUSE2ss-clig-hk vector. Transform and screen to obtain the heavy chain expression plasmids and light chain expression plasmids of the three antibodies; (2) Conduct experiments respectively using the heavy chain expression plasmids and light chain expression plasmids of the above three bNAbs: Take 50 - 150 μg, the heavy chain expression plasmid and light chain expression plasmid of the same bNAbs with a mass ratio of 1:5 - 1:5, and 10 - 100 μg of the CD63-L7Ae specific packaging plasmid. Co-transfect PEI and the above expression plasmids and packaging plasmid into HEK 293F cells to obtain chimeric bNAbs exosomes VRCCD28CDbox-EXO, BNCCD28CDbox-EXO, N6CD28CDbox-EXO; (3) Incubate the three resulting chimeric bNAbs exosomes with NK cells at a ratio of 10 5 -10 10 particles / cells respectively to obtain bNAbs-NK cell VRCCD28CDbox-NK, BNCCD28CDbox-NK, and N6CD28CDbox-NK; The nucleotide sequences of the six fragments of VRC01-VH, VRC01-VL, 3BNC117-VH, 3BNC117-VL, N6-VH, and N6-VL are as shown in SEQ ID NO.1 - 6; The nucleotide sequence of the CD28 TM is as shown in SEQ ID NO.7; The nucleotide sequence of the C / D box is as shown in SEQ ID NO.8; The nucleotide sequence of the CD63-L7Ae is as shown in SEQ ID NO.

9.

2. The preparation method according to claim 1, characterized in that, In step (1), the pFUSEss-chig-hg1 vector is double-digested with EcoRI-HF and NheI-HF; the pFUSE2ss-clig-hk vector is double-digested with EcoRI-HF and NcoI-HF.

3. The preparation method according to claim 2, characterized in that, In step (2), take 100 μg of the heavy chain expression plasmid and light chain expression plasmid, where the mass ratio of the heavy chain expression plasmid to the light chain expression plasmid is 2:3; the dosage of the specific packaging plasmid CD63-L7Ae is 50 μg.

4. The preparation method according to claim 3, characterized in that, Add the heavy chain expression plasmid, light chain expression plasmid and specific packaging plasmid into 4 mL of F complete medium, mix them, and let them stand at room temperature for 5 min. At the same time, add 300 μg of PEI with a concentration of 1 μg / μL into another 4 mL of F complete medium, mix them, and let them stand at room temperature for 5 min. Then add the plasmid / F medium into the PEI / F medium, mix them, and let them stand at room temperature for 30 min. Add the obtained plasmid / PEI medium into HEK 293F cells for transfection. After 24 h, add 1 / 20 of the transfection system of OPM-CHO PFF06 protein-free cell feed and 1 / 50 of the transfection system of L-glutamine, and continue culturing for 72 h. Collect the supernatant, and purify it by ultracentrifugation to obtain chimeric bNAbs exosomes.

5. The preparation method according to claim 4, characterized in that, The operation method of the ultracentrifugation is as follows: Centrifuge at 1 - 5 °C and 100×g - 500×g for 1 - 10 min, then centrifuge at 1000×g - 5000×g for 20 - 40 min, and finally centrifuge at 5000×g - 15000×g for 50 - 70 min. Collect the supernatant, add nuclease with a final concentration of 1 - 3 U and magnesium chloride with a concentration of 1 - 5 μmol / L, and treat it overnight; centrifuge at 90000×g - 110000×g for 80 - 100 min, discard the supernatant, resuspend the precipitate with 10 - 30 mL of PBS, then centrifuge at 90000×g - 110000×g for 80 - 100 min, discard the supernatant, resuspend the precipitate with 100 - 30 mL of PBS. After 48 - 96 h, collect the supernatant, and centrifuge at 50000×g - 150000×g for 50 - 100 min, repeat twice, to obtain bNAbs chimeric exosomes.

6. The preparation method according to claim 4, characterized in that, The F medium is obtained by mixing OPM-293CD05Medium medium without antibiotics and SMM293-TII medium at a volume ratio of 1 - 2:1 - 2.

7. A bNAbs-NK cell, characterized in that, Prepared by the preparation method of bNAbs-NK cells according to any one of claims 1 - 6.

8. Use of the bNAbs-NK cells according to claim 7 in the preparation of an anti-HIV therapeutic product.

9. The application according to claim 8, characterized in that The product is an anti-HIV drug.