3-ketosteroid-delta1-dehydrogenase mutant and application thereof in synthesis of prednisone acetate
The 3-sterone-Δ1-dehydrogenase mutants obtained through directional evolution and high-throughput screening, combined with the methanol-water phase system, solved the problems of low catalytic activity and poor solubility of cortisone acetate, and improved the biocatalytic conversion rate of prednisone acetate.
Patent Information
- Application Number
- CN202510513847.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-07-25
AI Technical Summary
The existing 3-sterone-Δ1-dehydrogenase KstD2 has a low catalytic activity on cortisone acetate, resulting in low biocatalytic conversion of prednisone acetate, and the difficulty of cortisone acetate insoluble in water affects production efficiency.
Through directional evolution and high-throughput screening methods, 3-sterone-Δ1-dehydrogenase mutants that efficiently express and catalyze the conversion of cortisone acetate into prednisone acetate were obtained. The methanol-aqueous phase system was used to improve substrate solubility and optimize reaction conditions, including the use of methanol as a cosolvent, phenazine methyl sulfate as a proton receptor, flavin adenine dinucleotide as a coenzyme, pH 6-10 buffer, and specific temperature and time.
The conversion rate of cortisone acetate has been significantly improved, from 64.8% to 92.1%, achieving a low-cost, green and efficient catalytic model.
Smart Images

Figure BDA0005372007180000061 
Figure BDA0005372007180000101 
Figure BDA0005372007180000111
Abstract
Description
(1) Technical Field
[0001] The present invention relates to a 3-sterone-Δ1-dehydrogenase mutant and its application in the synthesis of prednisolone acetate. (2) Background Art
[0002] Steroids are a general term for a class of cyclopentanoperhydrophenanthrene derivatives widely distributed in alkaloids, also known as sterols and steroid compounds. They have important applications in drug manufacturing, exhibit diverse biological activities, and are used as active ingredients in a variety of drugs clinically. For example, they can be used to treat various diseases such as inflammation, cardiovascular diseases, and tumors. In drug design and synthesis, the structural diversity of steroids makes them important templates for developing new drugs and are used as active pharmaceutical ingredients (APIs) or key precursors industrially to produce steroid drugs with various biological activities.
[0003] Microbe-mediated steroid transformation involves using microbial cells or their enzyme systems to perform specific biochemical modifications on steroid compounds. This biocatalytic process specifically modifies a particular site of the steroid, generating novel compounds or intermediates with similar structures but enhanced physiological activities. Compared with traditional chemical synthesis, microbial transformation offers multiple advantages: it reduces the synthesis steps, shortens the production cycle, increases the yield, while reducing the frequency of side reactions and having milder reaction conditions and being environmentally friendly. In addition, microbial transformation also has excellent stereo- and regioselectivity and can perform special reactions that are difficult or impossible to achieve by traditional chemical methods, such as dehydrogenation reactions at the C1,2 positions of the A ring, hydroxylation at the 11α and 11β positions, etc. With the continuous maturation of the microbial transformation process, the steroid drug synthesis production route has gradually been upgraded and transformed into a process route of "phytosterol - androstenedione - steroid drugs" and has gradually become the mainstream industrial production method in the steroid drug industry.
[0004] Directed evolution is also considered irrational design and is one of the most commonly used protein engineering techniques. Directed evolution of enzymes refers to in vitro simulation of natural evolution under experimental conditions. After multiple rounds of repeated mutation and directed screening, a new enzyme mutant that meets the expectations is finally obtained. The two most important processes in directed evolution are, one is to introduce random mutations into the target gene to construct a mutant library; the other is to perform high-throughput screening on the constructed library. Directed evolution randomly mutates the entire sequence of the target protein, which enables the screening of even amino acids that are far from the protein active site. Compared with rational design, directed evolution does not require knowledge of the three-dimensional structure of the target protein nor relevant structure-function information. In addition, directed evolution randomly mutates the entire sequence, including amino acid sites that are far from the active site but are important for maintaining the structure, stability, catalytic characteristics of the entire enzyme active site, etc., and has more possibilities for enzyme modification.
[0005] 3-Sterone-Δ1-dehydrogenase KstD2 from Mycobacterium neoaurum, which is 1674 bp in length and encodes 557 amino acids. 3-Sterone-Δ1-dehydrogenase is a key enzyme in the microbial metabolism of steroid compounds, responsible for catalyzing the dehydrogenation reaction at the C1,2 positions on the A ring of 3-ketosteroid compounds, converting 3-ketosteroid compounds into products with higher biological activity. Currently, 3-sterone-Δ1-dehydrogenase KstD2 exhibits good dehydrogenation catalytic activity towards a series of steroid substrates; it shows high catalytic activity towards 17α-hydroxy-pregn-4-ene-3,20-dione, 16,17α-epoxyprogesterone, 4-androstenedione, and 17α,21-dihydroxyprogesterone 21-acetate, among which the catalytic activity towards 17α-hydroxy-pregn-4-ene-3,20-dione is the best( The value reaches 470.91×10 6 M -1 s -1 ); it also shows certain catalytic activity towards 9α-hydroxy-4-androstene-3,17-dione, cortisone acetate, and canrenone, but the catalytic activity of KstD2 towards cortisone acetate is only half that of 17α-hydroxy-pregn-4-ene-3,20-dione. Therefore, we used the method of directed evolution to modify the enzyme molecule, obtained mutant strains that can efficiently catalyze cortisone acetate, and optimized the optimal reaction conditions of the enzyme to improve the conversion rate of cortisone acetate. (III) Summary of the Invention
[0006] The object of the present invention is to provide a 3-sterone-Δ1-dehydrogenase mutant and its application in the synthesis of prednisolone acetate. The present invention screened a 3-sterone-Δ1-dehydrogenase mutant that can be highly expressed in Escherichia coli and catalyze the dehydrogenation of cortisone acetate to prednisolone acetate through the method of directed evolution combined with high-throughput screening, effectively improving the catalytic activity and its reaction stability, and realizing a low-cost, green and efficient catalytic mode.
[0007] The technical solution adopted by the present invention is as follows:
[0008] In the first aspect, the present invention provides a 3-sterone-Δ1-dehydrogenase mutant, and the amino acid sequence of the mutant is as shown in SEQ ID NO: 3.
[0009] The 3-sterone-Δ1-dehydrogenase mutant of the present invention is obtained by the error-prone PCR technology of directed evolution from 3-sterone-Δ1-dehydrogenase KstD2 derived from Mycobacterium neoaurum, and the nucleotide sequence of the encoding gene of the 3-sterone-Δ1-dehydrogenase is as shown in SEQ ID NO: 1.
[0010] Second aspect, the present invention provides a coding gene for a 3-oxosteroid-Δ1-dehydrogenase mutant, and the nucleotide sequence is as shown in SEQ ID NO: 2.
[0011] Third aspect, the present invention provides a recombinant expression vector containing the coding gene for the 3-oxosteroid-Δ1-dehydrogenase mutant, and the recombinant expression vector is based on the plasmid pET-28a(+).
[0012] Fourth aspect, the present invention provides a recombinant genetic engineering bacterium constructed by the recombinant expression vector, and the recombinant genetic engineering bacterium uses Escherichia coli BL21(DE3) as the host bacterium.
[0013] Fifth aspect, the present invention provides an application of a 3-oxosteroid-Δ1-dehydrogenase mutant in catalyzing the synthesis of prednisolone acetate from cortisone acetate.
[0014] Furthermore, the method of the application is as follows: using the wet cells obtained by induced culture of a recombinant genetic engineering bacterium containing the coding gene for the 3-oxosteroid-Δ1-dehydrogenase mutant or the crude enzyme solution extracted by ultrasonic disruption of the wet cells as the catalyst, using cortisone acetate as the substrate, using methanol as the cosolvent, using phenazine methosulfate (PMS) as the proton acceptor, using flavin adenine dinucleotide (FAD) as the coenzyme, and using a buffer solution with a pH of 6-10 as the reaction medium to construct a reaction system, reacting at 25-45 °C and 180 rpm for 48-120 h (preferably 30 °C and 96 h) to obtain a reaction solution containing the dehydrogenated compound prednisolone acetate.
[0015] Furthermore, the buffer solution is preferably a Tris-HCl buffer solution with a pH of 8.0 and a concentration of 50 mM.
[0016] Furthermore, in the reaction system, the final concentration of the substrate cortisone acetate added is 30-80 g / L (preferably 30-60 g / L); the final concentration of PMS added is 1 mM; the final concentration of FAD added is 0.2 mM; the dosage of the catalyst is 10-30 g / L (preferably 20 g / L) based on the mass of the wet cells; the volume addition concentration of methanol is 5-15% (preferably 10%).
[0017] Furthermore, the catalyst is prepared by the following method:
[0018] Inoculate a recombinant genetic engineering bacterium containing the coding gene for the 3-oxosteroid-Δ1-dehydrogenase mutant into an LB liquid medium containing 50 μg / mL kanamycin, culture overnight at 37 °C and 180 rpm to obtain a seed solution; inoculate the seed solution into an LB liquid medium containing 50 μg / mL kanamycin at an inoculation amount of 3% by volume, and culture at 37 °C and 180 rpm until OD 600It was 0.6 - 0.8, IPTG with a final concentration of 0.1 mM was added, and induction culture was carried out at 20 °C and 180 rpm for 16 h to obtain a fermentation broth; the fermentation broth was centrifuged at 8000 rpm and 4 °C for 10 min, the obtained bacterial cell precipitate was resuspended with physiological saline, and then centrifuged at 8000 rpm and 4 °C for 10 min to collect wet bacterial cells;
[0019] The wet bacterial cells were resuspended with 50 mM Tris-HCl buffer (pH = 8.0). After the resuspended solution was placed on ice for 30 min, ultrasonic disruption was carried out (conditions: ultrasonic power 360 W, ultrasonic for 3 s, intermittent for 7 s, ultrasonic for 10 min). After the disrupted solution after ultrasonic treatment was centrifuged at 8000 rpm and 4 °C for 10 min, the precipitate was discarded, and the obtained supernatant was the crude enzyme solution.
[0020] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:
[0021] In the present invention, directed evolution was carried out on 3-oxosteroid-Δ1-dehydrogenase KstD2 derived from Mycobacterium neoaurum DSM 1381, a mutant gene with high catalytic activity for cortisone acetate was screened and obtained, and it was constructed into a pET-28a(+)-KstD2-T recombinant plasmid, and further an E. coli BL21(DE3)-pET-28a(+)-KstD2-T recombinant genetic engineering bacterium was constructed.
[0022] Cortisone acetate is insoluble in water, which reduces the production efficiency of biocatalytic preparation of prednisolone acetate. To solve the problems that organic substrates are insoluble in water and their mass transfer in the aqueous phase is low. The present invention adopts a methanol-aqueous phase (Tris-HCl buffer) system to increase the solubility of the substrate and thus improve the biocatalytic efficiency. In the single aqueous phase system (Tris-HCl buffer) without adding methanol, for a cortisone acetate feeding amount of 60 g / L, its conversion efficiency was only 64.8%, while under the same other conditions, in the Tris-HCl buffer system added with methanol, the conversion rate was increased to 92.1%, and the conversion rate was increased by 1.42 times. (IV) BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 It is a schematic diagram of KstD2 catalyzing the dehydrogenation of the substrate cortisone acetate to prepare prednisolone acetate.
[0024] Figure 2 It is the nucleic acid electrophoresis pattern of the error-prone PCR amplification product in Example 2; Lane1, 2, and 3 are all error-prone PCR amplification products.
[0025] Figure 3Electrophoresis diagram of double digestion of plasmid pET-28a(+) and plasmid pET-28a(+)-KstD2 in Example 2; among them, Lane1 is the plasmid pET-28a(+) without double digestion, Lane2, 3, 4, 5 are the double digestion products of plasmid pET-28a(+)-KstD2, and Lane6, 7, 8, 9 are the double digestion products of plasmid pET-28a(+).
[0026] Figure 4 Electrophoresis diagram of colony PCR products of randomly selected single colonies on the same plate in Step 4 of Example 2; Lane1 and 2 are negative transformants that were not successfully transformed, and Lane3 and 4 are positive transformants that were successfully transformed.
[0027] Figure 5 Column chart of substrate conversion rates of 12 dominant mutants obtained by primary screening in Example 4. (V) Specific implementation modes
[0028] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:[[]]END]]
[0029] The composition of the culture medium in the embodiments of the present invention:[[]]END]]
[0030] The composition of LB liquid medium: NaCl 10 g / L, peptone 10 g / L, yeast extract 5 g / L, the solvent is water, and the pH is 7.0.
[0031] The composition of LB solid medium: NaCl 10 g / L, peptone 10 g / L, yeast extract 5 g / L, agar 20 g / L, the solvent is water, and the pH is 7.0.
[0032] The composition of TB medium: tryptone 11.8 g / L, yeast extract 23.6 g / L, K2HPO4 9.4 g / L, KH2PO4 2.2 g / L, glycerol 4 mL / L, and the solvent is water.
[0033] The Tirs-HCl buffer solution used in the embodiments of the present invention refers to a 50 mM, pH 8.0 tris(hydroxymethyl)aminomethane hydrochloride buffer solution. Unless otherwise specified, the solvent of the solutions in the embodiments of the present invention is double-distilled water.
[0034] Example 1: Construction of recombinant genetic engineering bacteria of 3-oxosteroid-Δ1-dehydrogenase KstD2
[0035] 1. Obtaining the target gene of 3-oxosteroid-Δ1-dehydrogenase KstD2
[0036] Screen the steroid compound C1,2 dehydrogenase by consulting the literature, and select the C1,2 dehydrogenase KstD2 with high catalytic potential for cortisone acetate and good enzyme stability. Then, through retrieval in the NCBI database, select the gene sequence of 3-oxosteroid-Δ1-dehydrogenase KstD2 (Genbank: MG251736) derived from Mycobacterium neoaurum DSM 1381. Hand over the obtained gene sequence to Beijing Tsingke Biotechnology Co., Ltd., Hangzhou Branch for synthesis. The nucleotide sequence is as shown in SEQ ID NO: 1, and the synthesized gene has a His-tag at the end.
[0037] SEQ ID NO: 1:
[0038] GTGACCGACCAGAACAACATCACCGTGGATCTGGTTGTTGTGGGTTCTGGTACTGGTATGGC
[0039] AGCTGCACTTGCTGCACACGAACTGGGTATGTCCACTCTGATCGTTGAGAAATCCGCTTACG
[0040] TTGGTGGTTCTACCGCTCGTTCTGGTGGTGCGTTCTGGCTGCCGGGTTCTTCCATTCTGAAAG
[0041] ACGCTGGTTCTGCAGATACTCCAGCTAAAGCACGTACCTATCTGGAAGCGCTGGTTGGTGAT
[0042] GACGTTTCTCCGGAACGTGCACGCACCTTCATCGACCAGATTCCAGCAACTATCGACATGCT
[0043] CCGTCGTACCACTCCGATGAAATTCATGTGGGCGAAAGGCTACTCTGACTACCATCCGGAAC
[0044] GTCCAGGTGGTTCTGCTGTTGGTCGTACCTGCGAATGTCGTCCGTTCGACACCGCAGTACTG
[0045] GGTCCGGAACTGGCACGTCTGCGTCCGGGTGTTATGAAATCCAGCTTCCCGATGCCGGTTAC
[0046] CGGTGCGGACTACCGTTGGCTGAACCTGATGGCGCGTACTCCACGTAAATCTTGGCCGCGTA
[0047] TCATGCTGCGTGCAATGCAGGGTGTTGGTGGTCTGGCACTGCGTCGTCGTTACGCAGCAGGT
[0048] GGTCAGGCACTGGCAGCAGGTATGTTCGCAGGTGTTCTGCAGGCGGGTATCCCGGTTTGGAC
[0049] CGACTCCACCGTTACCGAACTGATCACTGATGGTGGTCGTGTTACCGGTGCTCGTGTTCTGC
[0050] GTGAAGGCTCTGCTGTTACTGTTACCGCTCGTCGTGGTATCGTGTTGGCAACCGGTGGTTTC
[0051] GACCACGAAATGAACTGGCGTCGTAAATTCCAGTCTGAACTTCTGGGTGAACACCTGAGCC
[0052] TGGGTGCGGAATCCAACACCGGTGATGGTATCCGTCTGGCACAAGACCTGGGTGCTGGCAC
[0053] CGGTCTGATGGACCAGGCATGGTGGTTTCCGGCATTCGCACCACTGCCGGGTGGTGATCCAA
[0054] CCGTAATGCTGGCGGAACGTTCTCTGCCGGGTTGCTTGCTGGTTGACCAGACTGGTGAACGC
[0055] TTCATCAACGAAGCTACCGACTACATGAGCTTCGGTCAGCAGCTGCTGCGTCGTGAACATGC
[0056] GGGTAATCCGGTTGAAACCATGTGGATGATCTTCGACCAGCGTTACCGTAACTCTTACCTGCT
[0057] GGCGGCTGAACTGTTTCCACGTATGCCGATTCCGCAGTCTTGGTACGATGCTGGTATCGCGCA
[0058] TCGTGGTACTGATGCTGAAGCGCTGGGTCGTCAGATCGGTTTCGATCCAGCGACTCTGGTAG
[0059] CGACCATCGAACGTTTCAACGGTCTGGCTGATGCTGGTGTAGATGCGGATTTCCAGCGTGGT
[0060] GCTTCTGCTTATGACCGTTATTACGGTGATCCGACCATCACTCCGAATCCGAACCTGCGTCCA
[0061] CTTGATCCAGGTCCGCTTTACGCGGTTAAAGTTGTTCTGTCTGATCTGGGTACTTGCGGTGGT
[0062] GTTCTGTGCGACGTTAACGGTCGTGTTCTCCGTGAAGACGGTGTTCCAATCGACGGTCTGTA
[0063] CGCGATCGGTAACACCGCAGCTAACGCGTTCGGTAAGACCTATCCAGGTGCAGGTGCTACCATCGCTCAGGGTCTGGTTTACGGTCACGTAGCAGCACAGCACGCTGCAGGTCACACCTAA。
[0064] 2. Synthesis of recombinant plasmid pET-28a(+)-KstD2
[0065] Entrusted Beijing Tsingke Biotechnology Co., Ltd. Hangzhou Branch to insert the target gene KstD2 into two restriction enzyme sites, HindIII and BmaHI, of the expression vector pET-28a(+), to obtain the recombinant plasmid pET-28a(+)-KstD2.
[0066] 3. Construction of recombinant genetically engineered bacteria
[0067] The pET-28a(+)-KstD2 plasmid was introduced into E. coli BL21(DE3) competent cells. The specific method was as follows: After thawing the E. coli BL21(DE3) competent cells on ice for 20 min, 10 μL of the recombinant plasmid pET-28a(+)-KstD2 was added to 100 μL of E. coli BL21(DE3) competent cells. After gently pipetting and mixing, the mixture was ice-bathed for 30 min, then heat-shocked in a 42 °C water bath for 90 s. After ice-bathing for 2 min, 0.9 mL of LB liquid medium without antibiotics was added, and the cells were resuscitated at 37 °C and 180 rpm for 1 h. The resuscitated bacterial solution was centrifuged in a centrifuge, and 900 μL of the supernatant was discarded. The remaining 100 μL of the bacterial solution and the precipitate were pipetted and mixed, and then spread on an LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C.
[0068] Single colonies were randomly picked from the overnight culture plate and inoculated into an LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C and 180 rpm. Verification was performed by 0.9% nucleic acid agarose gel electrophoresis to obtain transformed positive clones. The plasmid pET-28a(+)-KstD2 was extracted using an E. coli plasmid extraction kit and stored in a -20 °C refrigerator.
[0069] Example 2: Construction and optimization of a random mutant library of 3-oxosteroid-Δ1-dehydrogenase KstD2
[0070] 1. Primer design
[0071] Error-prone PCR primers F and R were designed according to the gene sequence of 3-oxosteroid-Δ1-dehydrogenase KstD2 in Example 1 and synthesized by Beijing Tsingke Biotechnology Co., Ltd., Hangzhou Branch.
[0072] Primer F: 5’-agcaaatgggtcgcggatccGTGACCGACCAGAACAACATCAC-3’,
[0073] Primer R: 5’-tcgagtgcggccgcaagcttTTAGGTGTGACCTGCAGCG-3’.
[0074] 2. Error-prone PCR amplification
[0075] First, the error-prone PCR system was optimized. The specific steps were as follows:
[0076] Using the plasmid pET-28a(+)-KstD2 obtained in Example 1 as a template, the target gene KstD2 was amplified by error-prone PCR using primers F and R in step 1.
[0077] To obtain an appropriate mutation frequency, the mutation frequency of error-prone PCR was optimized by changing the concentrations of Mg 2+ and Mn 2+ . Specifically, the concentration gradients of Mg 2+ were 2, 3, 4 mM; the concentration gradients of Mn 2+ were 0.05, 0.1, 0.2, 0.3 mM, for a total of 12 groups. After PCR amplification, it was verified by 0.9% nucleic acid agarose gel electrophoresis, and then recovered and purified by a Sangon column DNA gel recovery kit. After sequencing, the mutation frequencies that met 3‰ - 6‰ were selected: the concentration of Mg 2+ was 2 mM and the concentration of Mn 2+ was 0.1 mM (Table 1).
[0078] Table 1. Mutation frequencies corresponding to different concentrations of Mg 2+ and Mn 2+
[0079]
[0080] Secondly, amplification was carried out using the optimized error-prone PCR amplification system. After amplification, the fragment was verified by 0.9% nucleic acid agarose gel electrophoresis ( Figure 2 ), and the target fragment KstD2-T was recovered and purified by a Sangon column DNA gel recovery kit. The specific steps are as follows:
[0081] Error-prone PCR amplification system: The total reaction volume was 50 μL, including 0.5 μL of plasmid template, 2 μL of primer F, 2 μL of primer R, 5 μL of 10× Taq Buffer, 1 μL of dNTPs, 0.5 μL of Taq enzyme, 4 μL of 25 mM MgCl2, 0.5 μL of 10 mM MnCl2, and 34.5 μL of ddH2O.
[0082] Error-prone PCR amplification program: ① 95°C for 5 min, ② 95°C for 15 s, ③ 55°C for 15 s, ④ 72°C for 2 min, ⑤ 72°C for 5 min, and cycles of ②③④ were repeated 35 times. Taq enzyme, 10× Taq Buffer, and dNTPs were purchased from Nanjing Novoprotein Scientific Inc.
[0083] 3. Double digestion of pET-28a(+) vector:
[0084] The pET-28a(+) vector was double-digested using Takara restriction enzyme BamHI and Takara restriction enzyme HindⅢ, and the digestion system was reacted at 37°C for 3 h. After the double digestion reaction, it was verified by 0.9% nucleic acid agarose gel electrophoresis ( Figure 3 ) The pET-28a(+) vector after digestion was recovered and purified using the Shengong Column DNA Gel Extraction Kit.
[0085] The double digestion reaction system of the pET-28a(+) vector was as follows: 2 μL of BamHI, 2 μL of HindⅢ, 10 μL of 10×K Buffer, and 70 μL of pET-28a(+).
[0086] 4. Construction and identification of mutant recombinant genetically engineered bacteria
[0087] The target fragment KstD2-T in Step 2 was ligated with the digested pET-28a(+) vector in Step 3 according to the corresponding ligation system. After reacting at 50 °C for 5 min, the pET-28a(+)-KstD2-T recombinant plasmid was obtained.
[0088] The ligation system of the target gene KstD2-T and the digested vector pET-28a(+) was as follows: 5 μL of 2×ClonExpressMix, 3.5 μL of the vector pET-28a(+), and 1.5 μL of KstD2-T. Among them, 2×ClonExpress Mix was purchased from Nanjing Novoprotein Science and Technology Co., Ltd.
[0089] The method for introducing the pET-28a(+)-KstD2-T recombinant plasmid into E. coli BL21 competent cells was as follows: After thawing the E. coli BL21 competent cells (purchased from Beijing Tsingke Biotechnology Co., Ltd.) on ice for 20 min, 10 μL of the recombinant plasmid was added to 100 μL of E. coli BL21 competent cells. After gently pipetting and mixing, it was ice-bathed for 30 min, then heat-shocked in a 42 °C water bath for 90 s, ice-bathed for 2 min, and then 0.9 mL of LB antibiotic-free liquid medium was added. It was resuscitated at 37 °C and 180 rpm for 1 h. After centrifuging the resuscitated bacterial solution in a centrifuge, 900 μL of the supernatant was discarded. The remaining 100 μL of the bacterial solution was pipetted and mixed with the precipitate, and then spread on an LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C.
[0090] Five single colonies were randomly selected from the overnight cultured plates and pipetted and mixed in the corresponding numbered 30 μL of ddH2O. 10 μL of each mixed solution was transferred into the corresponding numbered LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C and 180 rpm. The remaining 20 μL of each mixed solution was boiled for 10 min, cooled, and used as a template for colony PCR, and then verified by 0.9% nucleic acid agarose gel electrophoresis ( Figure 4 ). After verification by colony PCR, the single colonies of positive clones were the random mutation library.
[0091] The total volume of the colony PCR system is 25 μL, which consists of 1 μL of boiled bacterial liquid template, 1 μL of primer F, 1 μL of primer R, 12.5 μL of 2×Hieff PCR Master Mix, and 9.5 μL of ddH2O. The PCR amplification program is as follows: ① 94°C for 5 min, ② 94°C for 30 s, ③ 55°C for 30 s, ④ 72°C for 1 min, ⑤ 72°C for 10 min, and steps ②③④ are cycled 30 times. The 2×Hieff PCR Master Mix is purchased from Beijing Tsingke Biotechnology Co., Ltd., and the primers are the same as in step 1.
[0092] Example 3: Screening of the random mutant library of 3-sterone-Δ1-dehydrogenase KstD2
[0093] (1) The random mutant library obtained in Example 2 was picked with a sterile toothpick into a 96-deep well plate (master plate), and 1000 μL of TB medium containing 50 μg / mL kanamycin had been added to each well of the 96-deep well plate in advance. The sealed 96-deep well plate with inoculated bacteria was placed in an incubator at 37°C and shaken at 180 rpm overnight. Then, 10 μL of the overnight culture broth was taken from each well and added to another 96-deep well culture plate containing 1000 μL of TB medium with a final concentration of 0.1 mM IPTG and 50 μg / mL kanamycin in each well. The inoculated 96-well culture plate was placed on a shaker at 20°C and shaken at 220 rmp for 20 h. This new 96-deep well plate was named the replication plate. The master plate was stored in a 4°C refrigerator.
[0094] (2) The operation of library screening is as follows: The induced replication plate was placed in a plate centrifuge at 4°C and centrifuged at 3000 rpm for 15 min, and the supernatant was discarded; 500 μL of 50 mM Tris-HCl buffer (pH = 8.0) was aspirated with a multi-channel pipette to resuspend the bacterial cells; the 96-well plate after resuspension was centrifuged at 4°C and 3000 rpm for 10 min, and the supernatant was discarded; 200 μL of 50 mM Tris-HCl buffer (pH = 8.0) was aspirated with a multi-channel pipette to resuspend the bacterial cells; the 96-well plate was placed in an -80°C refrigerator for 2 h, taken out and thawed at room temperature, and then lysozyme with a final concentration of 0.5 mg / mL was added and incubated for 30 min, followed by centrifugation to obtain a crude enzyme solution.
[0095] (3) 200 μL of the high-throughput screening reaction system was added to the enzyme-linked immunosorbent assay (ELISA) plate and placed in an ELISA reader with an absorbance of 600 nm for reaction at 37°C; the change in absorbance was measured and recorded every 2 min for 5 consecutive times. For mutants with a faster decrease in absorbance than the pre-mutation KstD2, the position of the corresponding master plate was recorded.
[0096] The high-throughput screening reaction system is as follows: 20 μL of 15 mM methylene blue sulfate aqueous solution (PMS), 20 μL of 4 mM 2,6-dichlorophenol indophenol aqueous solution (DCPIP), 20 μL of 5 mM cortisone acetate methanol aqueous solution, 130 μL of 50 mM Tris-HCl buffer (pH = 8.0), and 10 μL of crude enzyme solution. Mix them evenly to form a 200 μL reaction system.
[0097] (4) According to the positions recorded in (3), preserve the bacterial solutions on the corresponding master plates to obtain 12 dominant mutants. Take 500 μL each of the bacterial solution and 40% glycerol and place them in a cell cryopreservation tube, and store them in a -20°C refrigerator.
[0098] Example 4: Re-screening of 3-sterone-Δ1-dehydrogenase KstD2 mutants
[0099] Re-screen the 12 dominant mutants obtained from the primary screening to prevent false positives. Prepare wet bacterial cells as catalyst resting cells for the 12 mutants using the method of Example 1, and conduct a catalytic reaction with the substrate cortisone acetate. Screen to obtain the best dominant mutants through liquid chromatography analysis.
[0100] The reaction system of 5 mL consists of: 20 g / L resting cells, 1 mM PMS, 30 g / L substrate cortisone acetate, 0.2 mM FAD, 10% (v / v) methanol, and make up to 5 mL with 50 mM Tris-HCl buffer (pH = 8.0). React at 180 rpm in a 37°C shaker for 96 h. After the reaction is completed, extract the reaction solution with the same volume of ethyl acetate. After evaporating the ethyl acetate layer, redissolve it with acetonitrile and filter through a 0.22 μm filter membrane. Detect the substrate peak area of the filtrate by high performance liquid chromatography and calculate the substrate conversion rate. The results are shown in Figure 5 . Select mutant 10 as the optimal mutant, name it KstD2-T, the nucleotide sequence is as shown in SEQ ID NO: 2, the amino acid sequence is as shown in SEQ ID NO: 3, and the corresponding recombinant genetic engineering bacterium is E. coli BL21(DE3)-pET-28a(+)-KstD2-T.
[0101] The high performance liquid chromatography uses an LC-20A high performance liquid chromatograph (purchased from Shimadzu Corporation, Japan), equipped with a C18 chromatographic column (Ultimate, 5 μm, 250 mm × 4.6 mm), a 30°C, 254 nm ultraviolet detector. The mobile phase is acetonitrile: water with a volume ratio of 43:57, the flow rate is 0.8 mL / min, and the injection volume is 10 μL.
[0102] SEQ ID NO: 3
[0103] VTDQNNITVDLVVVGSGTGMAAALAAHELGMSTLIVEKSAYVGGSTARSGGAFWLPGSSILKDAGSADTPAKARTYLEALVGDDVSPERARTFIDQIPATIDMLRRTTPMKFMWAKGYSDYHPERPGGSAVGRSCECRPFDTAVLGPELARLRPGVMKSSFPMPVTGADYRWLNLMARTPRKSWPRIMLRAMQGVGGLALRRRYAAGGQALAAGMFAGVLQAGIPVWTDSTVTELITDGGRVTGARVLREGSAVTVTARRGIVLATGGFDHEMNWRRKFQSELLGEHLSLGAESNTGDGIRLAQDLGAGTGLMDQAWWFPAFAPLPGGDPTVMLAERSLPGCLLVDQTGERFINEATDYMSFGQQLLRREHAGNPVETMWMIFDQRYRNSYLLANELFPRMPIPQSWYDAGIAHRGTDAEALGRQIGFDPATLVATIERFNGLADAGVDADFQRGASAYDRWYGDPTITPNPNLRPLDPGPLYAVKVVLSDLGTCGGVLCDVNGRVLREDGVPIDGLYAIGNTAANAFGKTYPGAGATIAQGLVYGHVAAQHAAGHT*。
[0104] Example 5: Preparation of crude enzyme solution of E. coli BL21(DE3)-pET-28a(+)-KstD2-T
[0105] (1) Fermentation culture
[0106] 10 μL was taken from the glycerol bacteria of the recombinant genetic engineering bacteria E. coli BL21(DE3)-pET-28a(+)-KstD2-T screened in Example 4 and inoculated into 50 mL of LB liquid medium containing 50 μg / mL kanamycin, and cultured overnight at 37 °C and 180 rpm to obtain a seed solution.
[0107] The seed solution was inoculated into 150 mL of LB liquid medium containing 50 μg / mL kanamycin at an inoculation amount of 3% (v / v), and cultured at 37 °C and 180 rpm until OD 600It was 0.6 - 0.8. IPTG with a final concentration of 0.1 mM was added, and the culture was induced at 20 °C and 180 rpm for 16 h to obtain the fermentation broth. The fermentation broth was centrifuged at 8000 rpm and 4 °C for 10 min. The obtained cell precipitate was resuspended with normal saline and then centrifuged at 8000 rpm and 4 °C for 10 min to collect the wet cells, denoted as KstD2-T resting cells.
[0108] (2) Crude enzyme solution
[0109] The wet cells in step (1) were resuspended with 50 mM Tris-HCl buffer (pH = 8.0) at a ratio of 80 g / L. After the resuspended solution was placed on ice for 30 min, it was ultrasonically disrupted (conditions: ultrasonic power 360 W, ultrasonic treatment for 3 s, intermittent for 7 s, ultrasonic treatment for 10 min). After the disrupted solution was centrifuged at 8000 rpm and 4 °C for 10 min, the precipitate was discarded, and the obtained supernatant was the crude enzyme solution.
[0110] Example 6: Influence of reaction temperature on dehydrogenation reaction
[0111] The catalytic activity of KstD2-T was detected at different temperatures to explore the influence of different temperatures on the activity of KstD2-T, and the reaction system was designed.
[0112] The reaction system of 5 mL consisted of: 20 g / L KstD2-T resting cells prepared in Example 5, 1 mM PMS, 30 g / L substrate cortisone acetate, 0.2 mM FAD, 10% (v / v) methanol, and 50 mM Tris-HCl buffer (pH = 8.0) was added to make up to 5 mL. The reaction was carried out at 25, 30, 35, 40, 45 °C and 180 rpm for 96 h. After the reaction was completed, the reaction solution was extracted with the same volume of ethyl acetate. After the ethyl acetate layer was evaporated to dryness, it was redissolved with acetonitrile and filtered through a 0.22 μm filter membrane. The substrate conversion rate of the filtrate was detected by the method of Example 4, and the results are shown in Table 2.
[0113] Table 2. Influence of different reaction temperatures on dehydrogenation reaction
[0114]
[0115] It can be seen from Table 2 that the maximum catalytic activity of the enzyme occurs at 30 °C. Although within the low temperature range, an increase in temperature will increase the collision frequency between the enzyme and substrate molecules, thus increasing the catalytic rate, when the temperature is greater than 30 °C, the activity of the enzyme begins to decline. This may be because too high a temperature will cause the enzyme to absorb a large amount of energy, resulting in the hydrogen bonds maintaining its structure being broken, and the spatial conformation of the protein being changed so that it cannot exert an effective catalytic function. Therefore, the reaction is preferably controlled at 30 °C for the most favorable catalysis.
[0116] Example 7: Influence of reaction pH on dehydrogenation reaction
[0117] The composition of the 5 mL reaction system is as follows: 20 g / L of the resting cells of KstD2-T prepared in Example 5, 1 mM PMS, 30 g / L of the substrate cortisone acetate, 0.2 mM FAD, 10% (v / v) methanol, and the volume is made up to 5 mL with buffers at pH 6.0, 7.0, 8.0, 9.0, and 10.0 (where 6.0 and 7.0 are 50 mM PB, 8.0 and 9.0 are 50 mM Tris-HCl, and 10.0 is 25 mM glycine-NaOH buffer). The reaction is carried out at 30 °C and 180 rpm for 96 h. After the reaction is completed, the reaction solution is extracted with the same volume of ethyl acetate. After the ethyl acetate layer is evaporated to dryness, it is redissolved in acetonitrile and filtered through a 0.22 μm filter membrane. The substrate conversion rate of the filtrate is detected by the method of Example 4, and the results are shown in Table 3.
[0118] Table 3. Effects of different pH values on the dehydrogenation reaction
[0119]
[0120] It can be found from Table 3 that KstD2-T has the highest activity at pH 8. Too high or too low pH can change the charged states of the substrate molecules and enzyme molecules, cause unfolding and exposure of the internal structure, resulting in the loss of enzyme activity, thus affecting the binding of the enzyme and the substrate; in addition to having a great impact on enzyme activity, pH also has a great impact on enzyme stability. Too high or too low pH will change the conformation of the active center of the enzyme, or even change the structure of the whole enzyme molecule and cause it to denature and inactivate. Therefore, KstD2-T is suitable for reacting in 50 mM Tris-HCl buffer at pH 8.
[0121] Example 8: Effects of reaction time on the dehydrogenation reaction
[0122] The composition of the 5 mL reaction system is as follows: 20 g / L of the resting cells of KstD2-T prepared in Example 5, 1 mM PMS, 30 g / L of the substrate cortisone acetate, 0.2 mM FAD, 10% (v / v) methanol, and the volume is made up to 5 mL with 50 mM Tris-HCl buffer (pH = 8.0). The reaction is carried out at 30 °C and 180 rpm for 48, 72, 96, and 120 h respectively. After the reaction is completed, the reaction solution is extracted with the same volume of ethyl acetate. After the ethyl acetate layer is evaporated to dryness, it is redissolved in acetonitrile and filtered through a 0.22 μm filter membrane. The substrate conversion rate of the filtrate is detected by the method of Example 4, and the results are shown in Table 4.
[0123] Table 4. Effects of different reaction times on the dehydrogenation reaction
[0124]
[0125] As can be seen from Table 4, with the extension of the reaction time, the conversion rate of KstD2-T enzyme gradually increases. After 96 h, the dehydrogenation reaction begins to slow down. Therefore, in order to save reaction time, the optimal reaction time for the dehydrogenation reaction is selected as 96 h.
[0126] Example 9: Influence of Substrate Concentration on Dehydrogenation Reaction
[0127] To meet the needs of industrial production, it is necessary to increase the substrate concentration in the reaction system as high as possible while ensuring the product yield and high enantioselectivity. Therefore, a reaction was designed to explore the product conversion rates at different substrate concentrations.
[0128] The 5 mL reaction system consists of: 20 g / L of the KstD2-T resting cells prepared in Example 5, 1 mM PMS, the substrate cortisone acetate (final concentrations are 30, 40, 50, 60, 70, 80 g / L respectively), 0.2 mM FAD, 10% (v / v) methanol, and 50 mM Tris-HCl buffer (pH = 8.0) to make up to 5 mL. The reaction was carried out at 30 °C and 180 rpm for 96 h. After the reaction was completed, the reaction solution was extracted with the same volume of ethyl acetate. After the ethyl acetate layer was evaporated to dryness, it was redissolved with acetonitrile and filtered through a 0.22 μm filter membrane. The substrate conversion rate of the filtrate was detected by the method of Example 4, and the results are shown in Table 5.
[0129] Table 5. Influence of Substrate Concentration on Dehydrogenation Reaction
[0130]
[0131] As can be seen from Table 5, the increase in the concentration of the substrate cortisone acetate will have a certain impact on the enzyme activity of the system. When the substrate concentration is higher than 60 g / L, the conversion rate of the substrate cortisone acetate in the system is lower, indicating that high concentrations of the substrate have an inactivating effect on the enzyme protein.
[0132] Example 10: Influence of the Enzyme on Substrate Catalysis before and after Mutation and Methanol on Dehydrogenation Reaction
[0133] The 5 mL reaction system 1 consists of: 20 g / L of the KstD2-T resting cells prepared in Example 5, 1 mM PMS, 60 g / L of the substrate cortisone acetate, 0.2 mM FAD, 10% (v / v) methanol, and 50 mM Tris-HCl buffer (pH = 8.0) to make up to 5 mL.
[0134] The 5 mL reaction system 2 consists of: 20 g / L of the unmutated KstD2 resting cells prepared in Example 1, 1 mM PMS, 60 g / L of the substrate cortisone acetate, 0.2 mM FAD, and 50 mM Tris-HCl buffer (pH = 8.0) to make up to 5 mL.
[0135] Composition of the 5 mL reaction system 3: 20 g / L of the KstD2-T resting cells prepared in Example 5, 1 mM PMS, 60 g / L of the substrate cortisone acetate, 0.2 mM FAD, and made up to 5 mL with 50 mM Tris-HCl buffer (pH = 8.0).
[0136] Composition of the 5 mL reaction system 4: 20 g / L of the KstD2 resting cells prepared in Example 1, 1 mM PMS, 60 g / L of the substrate cortisone acetate, 0.2 mM FAD, 10% (v / v) methanol, and made up to 5 mL with 50 mM Tris-HCl buffer (pH = 8.0).
[0137] Each of the above reaction systems was reacted at 30 °C and 180 rpm for 96 h. After the reaction was completed, the reaction solution was extracted with the same volume of ethyl acetate. After the ethyl acetate layer was evaporated to dryness, it was redissolved in acetonitrile and filtered through a 0.22 μm filter membrane. The substrate conversion rate of the filtrate was detected by the method of Example 4, and the results are shown in Table 6.
[0138] Table 6. Effects of the enzyme on substrate catalysis before and after mutation and methanol on dehydrogenation reaction
[0139]
[0140] It can be seen from Table 6 that by mutation and adding methanol to increase the solubility of the substrate, the dehydrogenation reaction of cortisone acetate was increased from 64.8% to 92.1%, which was increased by 1.42 times; even though methanol was added in both cases, comparing reaction systems 1 and 4, the catalytic efficiency of the mutant KstD2-T for cortisone acetate was increased by 2.08 times compared with the unmutated KstD2.
Claims
1. A 3-oxosteroid-Δ1-dehydrogenase mutant, characterized in that, The mutant amino acid sequence is as shown in SEQ ID NO:
3.
2. A recombinant genetically engineered bacterium containing the gene encoding the 3-sterone-Δ1-dehydrogenase mutant according to claim 1.
3. Use of the 3-sterone-Δ1-dehydrogenase mutant according to claim 1 in the catalytic synthesis of prednisolone acetate from cortisone acetate.
4. The application according to claim 3, wherein The method of the use is as follows: Using the wet bacterial cells obtained by induced culture of the recombinant genetically engineered bacterium containing the gene encoding the 3-sterone-Δ1-dehydrogenase mutant or the crude enzyme solution extracted by ultrasonic disruption of the wet bacterial cells as the catalyst, using cortisone acetate as the substrate, using methanol as the cosolvent, using phenazine methosulfate as the proton acceptor, using flavin adenine dinucleotide as the coenzyme, and using a buffer solution with a pH of 6-10 as the reaction medium to construct a reaction system, reacting at 25-45 °C and 180 rpm for 48-120 h to obtain a reaction solution containing prednisolone acetate.
5. The application according to claim 4, characterized in that The buffer solution is a 50 mM Tris-HCl buffer solution with a pH of 8.
0.
6. The application according to claim 4, characterized in that, In the reaction system, the final concentration of the substrate cortisone acetate added is 30-80 g / L; the final concentration of phenazine methosulfate added is 1 mM; the final concentration of the coenzyme added is 0.2 mM; the dosage of the catalyst is 10-30 g / L based on the mass of the wet bacterial cells; the volume addition concentration of methanol is 5-15%.
7. The application according to claim 4, characterized in that, The catalyst is prepared by the following method: The recombinant genetically engineered bacteria containing the gene encoding the 3-sterone-Δ1-dehydrogenase mutant were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C and 180 rpm to obtain a seed solution; the seed solution was inoculated into LB liquid medium containing 50 μg / mL kanamycin at an inoculation volume concentration of 3% and cultured at 37 °C and 180 rpm until the OD 600 was 0.6 - 0.8, then IPTG with a final concentration of 0.1 mM was added, and the culture was induced at 20 °C and 180 rpm for 16 h to obtain a fermentation broth; the fermentation broth was centrifuged at 8000 rpm and 4 °C for 10 min, the obtained cell precipitate was resuspended with physiological saline, then centrifuged at 8000 rpm and 4 °C for 10 min, and the wet cells were collected; the wet cells were resuspended with 50 mM Tris-HCl buffer at pH 8.0, the resuspended solution was placed on ice for 30 min, then sonicated at a sonication power of 360 W for 10 min with a sonication time of 3 s and an interval of 7 s. After sonication, the disrupted solution was centrifuged at 8000 rpm and 4 °C for 10 min, and the precipitate was discarded. The obtained supernatant was the crude enzyme solution.
Citation Information
Cited By
3-ketosteroid-delta1-dehydrogenase mutant and application thereof in catalyzing dehydrogenation of steroid compound
CN120366249A
A 3-ketosteroid delta1-dehydrogenase mutant and use thereof in catalyzing dehydrogenation of steroid compounds
CN120366249B