Sucrose phosphorylase mutant and application thereof in preparation of L-ascorbyl glucoside

By mutation of the amino acid sequence of sucrose phosphorylase, the recombinant expression vector was constructed and expressed in E.coli BL21 (DE3), the problems of low efficiency and poor thermal stability of sucrose phosphorylase in L-ascorbic acid glucoside synthesis were solved, and the effect of efficient preparation of L-ascorbic acid glucoside was achieved.

CN120366254APending Publication Date: 2025-07-25SHANDONG UNIV OF TECH +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510350895.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The existing sucrose phosphorylases are inefficient and poor thermal stability in the synthesis of L-ascorbic glucoside, which limits their industrial application potential.

Method used

L-ascorbic acid glucoside was prepared by performing amino acid sequence mutations on sucrose phosphorylase derived from Salipaludibacillus keqinensis, specifically R134A, V325I, M329H, and G338F, and recombinant expression vectors were constructed and expressed in E.coli BL21 (DE3), thereby catalyzing the reaction of sucrose and L-ascorbic acid.

Benefits of technology

The catalytic activity of sucrose phosphorylase was improved by 7.2 times, significantly improving the production efficiency of L-ascorbic glucoside, with a yield of 140.4 g/L and a conversion rate of 83%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366254A_ABST
    Figure CN120366254A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of bioengineering, and particularly relates to a sucrose phosphorylase mutant and application thereof in preparation of L-ascorbyl glucoside. Sucrose phosphorylase (SkSP) derived from Salipaludibacillus keqinensis has relatively high stability, and according to the invention, the SkSP is subjected to molecular modification, so that four sucrose phosphorylase mutants with improved catalytic activity are obtained. The sucrose phosphorylase mutant V325I obtained through screening has good catalytic efficiency in a reaction for catalyzing sucrose and L-ascorbic acid to prepare L-ascorbyl glucoside, and the yield of the L-ascorbyl glucoside reaches 140.4 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering, and particularly relates to a sucrose phosphorylase mutant and its application in the preparation of L-ascorbic acid glucoside. Background Art

[0002] L-ascorbic acid glucoside (AA-2G, chemically named L-Ascorbic acid 2-glucoside) is a compound derived from glycosylation of vitamin C (i.e., L-ascorbic acid). Its structural feature is that the glucose molecule is linked to the 2-hydroxy group of vitamin C through a glycosidic bond. Currently, the industrial production of AA-2G is mainly achieved through two routes: chemical synthesis method and enzymatic catalysis method, but both face significant challenges. The traditional chemical synthesis method not only has complex steps and high energy consumption, but also often requires the use of highly toxic substances (such as hydrogen cyanide, halides), resulting in many by-products and low product yield. In contrast, enzymatic synthesis is favored due to its advantages such as green and efficient, stereoselective specificity.

[0003] However, the currently known wild-type sucrose phosphorylase performs poorly in the synthesis of AA-2G. The main problems are low synthesis efficiency and poor thermal stability, which severely limit its potential for industrial application. For example, the sucrose phosphorylase derived from Leuconostoc mesenteroides has a weak affinity for L-ascorbic acid (Km > 50 mM), resulting in a yield of AA-2G of less than 50%. In addition, the enzyme has poor thermal stability, and its optimal working temperature is usually only 30°C, making it difficult to adapt to the high-temperature environment of industrial production. Although some studies have attempted to improve sucrose phosphorylase through enzyme engineering technology, the improvement effect still has certain limitations.

[0004] In summary, in order to improve the industrial preparation efficiency of L-ascorbic acid glucoside, it is particularly urgent to develop a sucrose phosphorylase mutant with high catalytic activity and good stability. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a sucrose phosphorylase mutant, which can efficiently catalyze the reaction of sucrose and L-ascorbic acid to prepare L-ascorbic acid glucoside. In addition, the corresponding amino acid sequence, nucleotide sequence, recombinant expression plasmid capable of inducing the expression of the sucrose phosphorylase mutant, genetically engineered strain and its preparation method are also the key points protected by the present invention.

[0006] The sucrose phosphorylase mutant provided by the present invention is obtained by mutating the amino acid sequence shown in SEQ ID NO: 1 of sucrose phosphorylase (the nucleotide sequence encoding this sucrose phosphorylase is shown in SEQ ID NO: 2), and the sequence of the sucrose phosphorylase mutant is selected from one of the following sequences:

[0007] (1) Replace the arginine at position 134 of the amino acid sequence shown in SEQ ID NO: 1 with alanine;

[0008] (2) Replace the valine at position 325 of the amino acid sequence shown in SEQ ID NO: 1 with isoleucine;

[0009] (3) Replace the methionine at position 329 of the amino acid sequence shown in SEQ ID NO: 1 with histidine;

[0010] (4) Replace the glutamine at position 338 of the amino acid sequence shown in SEQ ID NO: 1 with phenylalanine.

[0011] Preferably, the amino acid sequence of the mutant is as shown in SEQ ID NOs: 3-6.

[0012] Preferably, the wild-type sucrose phosphorylase is the sucrose phosphorylase derived from Salipaludibacillus keqinensis.

[0013] Preferably, the gene of the sucrose phosphorylase derived from Salipaludibacillus keqinensis is as shown in SEQ ID NO: 2.

[0014] The technical solution of the present invention further includes:

[0015] A recombinant expression vector, comprising the gene encoding the above-mentioned sucrose phosphorylase mutant, wherein the nucleotide sequence of the gene is as shown in SEQ ID NOs: 7-10.

[0016] A recombinant engineering bacterium is obtained by transforming the above-mentioned recombinant expression vector into a host microorganism.

[0017] The application of the above-mentioned sucrose phosphorylase mutant or recombinant engineering bacterium in the preparation of L-ascorbic acid glucoside is also the content that the present invention focuses on protecting;

[0018] Among them, in the above preparation process, sucrose and L-ascorbic acid are used as substrates to catalytically synthesize L-ascorbic acid glucoside, which specifically includes the following steps:

[0019] (1) Ferment and culture the recombinant engineering bacterium and then break the wall to obtain a crude enzyme solution;

[0020] (2) Add 20 - 30 g / L of crude enzyme solution, 0.5 - 1.0 M of sucrose, and 0.2 - 0.8 M of L - ascorbic acid to the reaction system. Adjust the pH to 6 - 7 using MES buffer at a concentration of 50 mM, and react at 50 °C for 8 - 12 hours, where L - ascorbic acid is added in 3 - 6 portions.

[0021] In addition, the present invention also provides a method for preparing the above - mentioned sucrose phosphorylase mutant, which includes the following steps: site - directed mutagenesis of the sucrose phosphorylase - encoding gene, constructing an expression vector, transforming a protein - expressing host bacterium, and inducing protein expression.

[0022] Furthermore, the present invention obtained the encoding gene of the mutant using molecular cloning technology, induced the expression by constructing a 6×His fusion expression vector of the mutant gene and introducing it into the genetic engineering bacterium E. coli BL21(DE3) to obtain the mutant enzyme protein, and used the mutant as a catalyst to carry out an enzymatic reaction under appropriate conditions to convert sucrose and L - ascorbic acid into AA - 2G.

[0023] The results show that the catalytic activity of the mutant provided by the present invention is 7.2 times higher than that of the wild - type sucrose phosphorylase, and it has great application potential and value.

[0024] All the mutation sites mentioned above in the present invention and any combination of mutations encoding the sucrose phosphorylase mutant gene, including but not limited to any that replace one or several amino acids in the above - shown amino acid sequence and have catalytic activity towards the substrate L - ascorbic acid, are the key contents protected by the present invention. In addition, the expression cassette, vector, or recombinant bacterium containing the said gene also falls within the technical scope protected by the present invention.

[0025] Similarly, the catalyst containing the above - mentioned sucrose phosphorylase mutant is also the technical content protected by the present invention.

[0026] Furthermore, the application of the above - mentioned sucrose phosphorylase mutant provided by the present invention or the catalyst containing the above - mentioned sucrose phosphorylase mutant in the preparation of AA - 2G using sucrose and L - ascorbic acid as the initial substrates, specifically using sucrose and L - ascorbic acid as substrates and adding sucrose phosphorylase to carry out a catalytic reaction to synthesize AA - 2G, is also the technical content protected by the present invention.

[0027] The present invention has the following advantages and effects compared with the prior art:

[0028] (1) By modifying sucrose phosphorylase SkSP, highly active sucrose phosphorylase mutants R134A, V325I, M329H, and G338F were obtained. Compared with the wild-type sucrose phosphorylase SkSP, the catalytic efficiency of the sucrose phosphorylase mutants was increased by 2.3 - 7.2 times; moreover, this enzyme has high thermal stability and can catalyze reactions at 50°C.

[0029] (2) The sucrose phosphorylase mutants screened in the present invention have good catalytic activity in the reaction of catalyzing the synthesis of AA-2G from sucrose and L-ascorbic acid, significantly improving the production efficiency of AA-2G, with a yield of up to 140.4 g / L and a conversion rate of 83%. Brief Description of the Drawings

[0030] Figure 1 Protein electrophoresis diagrams of wild-type sucrose phosphorylase SkSP and sucrose phosphorylase mutants R134A, V325I, M329H, and G338F;

[0031] Figure 2 High-performance liquid chromatography diagram of the catalytic product AA-2G of the sucrose phosphorylase mutant preparation reaction. Detailed Embodiments

[0032] To enable those skilled in the art to better understand the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0033] The main reagents and consumables used in the present invention:

[0034] Phanta Max Ultra-High Fidelity DNA Polymerase P520 was purchased from Nanjing Novozymes Biotech Co., Ltd.;

[0035] Fast DpnI DNA Endonuclease was purchased from Thermo Fisher Scientific;

[0036] The pET28(a) plasmid is a known Escherichia coli expression vector with a vector size of 5369 bp, a T7 promoter, a vector tag N-6×His, and a vector resistance to Kanamycin. It was purchased from Novogen;

[0037] E. coli DH5α competent cells and E. coli BL21(DE3) competent cells were both purchased from Angyu Biotech Co., Ltd.;

[0038] Agar powder was purchased from Solarbio;

[0039] Tryptophan and yeast extract were both purchased from OXOID.

[0040] LB medium

[0041] Each 100 mL of LB medium contains: 1 g of tryptone, 0.5 g of yeast extract, and 1 g of NaCl, with a pH of 7.0 - 7.2.

[0042] Preparation method: Dissolve 10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl in 1 L of distilled water without adjusting the pH value, and sterilize by autoclaving at 121 °C for 20 min. If preparing solid medium, add 1.5 g of agar powder to 100 mL of the medium.

[0043] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, which can be commercially obtained or prepared according to the conventional methods in the art, and the specification is laboratory pure grade. Unless otherwise specified, the methods used in the following examples are all conventional methods in the art, and the experimental conditions used are all conventional experimental conditions in the art, and relevant experimental manuals or manufacturer's instructions can be referred to.

[0044] In the present invention, amino acids are represented by single-letter or three-letter codes and have the following meanings:

[0045] A: Ala (alanine); R: Arg (arginine); N: Asn (asparagine); D: Asp (aspartic acid); C: Cys (cysteine); Q: Gln (glutamine); E: Glu (glutamic acid); G: Gly (glycine); H: His (histidine); I: Ile (isoleucine); L: Leu (leucine); K: Lys (lysine); M: Met (methionine); F: Phe (phenylalanine); P: Pro (proline); S: Ser (serine); T: Thr (threonine); W: Trp (tryptophan); Y: Tyr (tyrosine); V: Val (valine).

[0046] Example 1 Construction of a prokaryotic expression system for sucrose phosphorylase

[0047] Through gene mining, the sucrose phosphorylase gene (SkSP) derived from Salipaludibacillus keqinensis was screened from the NCBI database, and the Genbank ID is WP_110608025.1. The full length of the open reading frame of this gene is 1458 bp, and the sucrose phosphorylase encoded by it consists of 486 amino acids, and its amino acid sequence is as shown in SEQ ID NO: 1; the nucleotide sequence encoding this sucrose phosphorylase is as shown in SEQ ID NO: 2.

[0048] The sucrose phosphorylase gene has been synthesized in our laboratory. The above gene was synthesized by GenScript Biotech Corporation and cloned into the BamHI and XhoI restriction sites of the pET28a(+) plasmid, with a 6×His tag added at the N-terminus. The obtained recombinant plasmid pET28a(+)-SkSP was transformed into the expression host Escherichia coli E. coli BL21(DE3), resulting in recombinant E. coli expressing the wild enzyme.

[0049] Example 2 Design and Construction of Sucrose Phosphorylase Mutants

[0050] (1) By multiple sequence alignment and three-dimensional structure analysis, the similarities and differences between the sucrose phosphorylase with the ID of WP_110608025.1 in Genbank (amino acid sequence shown in SEQ ID NO: 1) and homologous enzyme proteins of the family were compared, and the key amino acid mutations affecting the enzymatic properties of sucrose phosphorylase were determined: R134A, V325I, M329H, G338F, and their amino acid sequences are shown in SEQ ID NOs: 3 - 6 in sequence.

[0051] (2) Using the recombinant plasmid pET28a(+)-SkSP as a template, the primers for each mutant were designed as shown in Table 1 below:

[0052] Table 1 Primer Design for Mutants

[0053] Primer Sequence (5‘-3’) R134A-F ATCTACAAAGCTAAACCGCGTGCTCCGTAC R134A-R ACGCGGTTTAGCTTTGTAGATTTTGTCGAT V325I-F GTTAAACGTATCTACAACACCATGGAATAC V325I-R GGTGTTGTAGATACGTTTAACGTTAGCACC M329H-F TACAACACCCACGAATACAACAACCTGGAC M329H-R GTTGTATTCGTGGGTGTTGTAAACACGTTT G338F-F GACATCTACTTCCTGAACTGCACCTACTAC G338F-R GCAGTTCAGGAAGTAGATGTCCAGGTTGTT

[0054] (3) Using the recombinant plasmid pET28a(+)-SkSP as a template, with the above upstream and downstream primers, high-fidelity enzyme was used for whole plasmid PCR amplification to obtain recombinant plasmids with specified mutation sites. The PCR system and procedure are as follows:

[0055] PCR System: Phanta Max Ultra-High Fidelity DNA Polymerase P520 20 μL, template plasmid 1 μL, upstream primer -F (10 μM) 1 μL, downstream primer -R (10 μM) 1 μL, ddH2O 2 μL.

[0056] PCR Procedure: a. Pre-denaturation at 98°C for 30 s; b. Denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 72°C for 40 s, 35 cycles; c. Extension at 72°C for 5 min, cooling to 4°C.

[0057] (4) The amplified product was digested with DpnI enzyme at 37 °C for 2 h to degrade the initial template. The digested product was transformed into DH5α competent cells. The DH5α competent cells were placed on ice. After the cells melted, 15 μL of plasmid solution was added, and the mixture was placed on ice for 30 min, heat-shocked at 42 °C for 45 s, then left standing on ice for 2 min, 700 μL of sterile LB liquid medium was added, and the cells were cultured in a shaker at 37 °C and 200 rpm for 1 h, centrifuged at 4000 rpm for 1 min, 600 μL of the supernatant was discarded, and the remaining supernatant was used to resuspend the precipitated bacteria, which were then spread evenly on an LB plate medium containing kanamycin resistance (50 μg / mL) and cultured upside down at 37 °C overnight. After the transformants grew out, single colonies on the LB plate were picked and inoculated into an LB liquid medium containing Kana resistance (50 μg / mL), cultured overnight at 37 °C and 200 rpm in a shaker, and then sent to Genewiz for sequencing to identify whether the sucrose phosphorylase mutation was successful. The plasmid of the bacteria with correct mutation verified by sequencing was extracted and transformed into E. coli BL21(DE3) competent cells, and thus the recombinant strain of the sucrose phosphorylase mutant was obtained.

[0058] Example 3 Expression and Activity Analysis of Sucrose Phosphorylase

[0059] (1) Protein Expression and Purification

[0060] The obtained wild-type strain SkSP-pET28a(BL21) and the recombinant strain of the sucrose phosphorylase mutant were inoculated into a test tube containing 5 mL of liquid LB medium for overnight activation to obtain a seed solution, which was transferred to a liquid LB medium at an inoculation amount of 1%, and cultured at 37 °C until OD 600 = 0.6 - 0.8, and isopropyl-β-D-thiogalactopyranoside (IPTG) with a final concentration of 0.1 mM was added for heterologous protein induction expression. The strains were collected by centrifugation, the cells were suspended with MES buffer, and then ultrasonic disruption was performed. The strains were collected by centrifugation again, the cells were suspended with 50 mM MES (pH = 6.5) buffer, and then ultrasonic disruption was performed. The supernatant after disruption was obtained by centrifugation at 14000 rpm for 30 min, purified by nickel column affinity chromatography, and further ultrafiltered with a 30 kDa ultrafiltration tube to obtain concentrated and purified wild-type and mutant pure enzymes of sucrose phosphorylase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed for verification, as shown in the appendix Figure 1 as follows.

[0061] (2) Determination of Pure Enzyme Activity

[0062] The enzyme activity definition of sucrose phosphorylase is as follows: The amount of enzyme required to produce 1 μmol of AA-2G in 1 minute is defined as 1 U. The enzyme activity assay system is 1 mL, containing 50 mM sucrose, 50 mM L-ascorbic acid, 100 μg / mL sucrose phosphorylase, 50 mM MES buffer (pH = 6.5). After reacting at 50 °C for 10 minutes, immediately terminate the reaction by boiling water bath for 10 minutes.

[0063] Perform pretreatment on the sample to be tested: Take 50 μL of the reaction solution, add it to 950 μL of 0.01 mol / L dilute hydrochloric acid, filter it with a 0.22 μm filter membrane, and add the filtrate to a liquid phase sample bottle; and perform determination using high performance liquid chromatography.

[0064] The high performance liquid chromatography analysis is carried out under the following conditions: The instrument is Agilent high performance liquid chromatograph 1200, the chromatographic column is a C18 column, 250×4.6 mm, column temperature: 30 °C, K2HPO4·3H2O: 0.57 g / L, adjust the pH = 2.00 with phosphoric acid; flow rate: 1 mL / min, sample injection volume is 20 μL, and the ultraviolet detector is used for detection at 240 nm.

[0065] Example 4 Obtain a sucrose phosphorylase mutant with enhanced activity

[0066] The relative activities of the mutants are shown in Table 2. The relative activity refers to the multiple of the catalytic activity of the mutant in catalyzing the same substrate under the same conditions relative to the SkSP wild-type enzyme protein (WT) when the relative activity of the SkSP wild-type enzyme protein (WT) is defined as 1.

[0067] Table 2 Mutation sites and relative activities of mutants with enhanced activity

[0068]

[0069]

[0070] Table 2 shows the mutants obtained by single mutation using the wild-type SkSP as a template and the corresponding mutant activities. From the results in Table 2, it can be seen that the activities of the mutants obtained by mutating the 134th, 325th, 329th, and 338th sites are 2.3 - 7.2 times higher than that of the wild-type SkSP. In particular, the mutation at site V325I shows relatively high catalytic activity, which is 7.2 times higher than that of the wild-type.

[0071] The sucrose phosphorylase SkSP gene with the amino acid sequence shown in SEQ ID NO: 1, the nucleotide sequence corresponding to R134 is the codons at positions 400-402, the nucleotide sequence corresponding to V325 is the codons at positions 973-975, the nucleotide sequence corresponding to M329 is the codons at positions 985-987, and the nucleotide sequence corresponding to Q338 is the codons at positions 1012-1014.

[0072] The mutant R134A is based on the gene of sucrose phosphorylase with the amino acid sequence shown in SEQ ID NO: 1. The 134th codon is mutated from CGT to GCT, that is, the codons at positions 400-402 in the nucleotide sequence shown in SEQ ID NO: 2 are mutated from CGT to GCT. The nucleotide sequence corresponding to V325I is that the codons at positions 973-975 are mutated from GTT to ATC, the nucleotide sequence corresponding to M329H is that the codons at positions 985-987 are mutated from ATG to CAC, and the nucleotide sequence corresponding to Q338F is that the codons at positions 1012-1014 are mutated from CAG to TTC. The obtained enzyme mutant has the amino acid sequences shown in SEQ ID NOs: 3-6, and the nucleotide sequences of its encoding genes are shown in SEQ ID NOs: 7-10.

[0073] Example 5 Synthesis of AA-2G using sucrose phosphorylase mutants

[0074] This example mainly uses the sucrose phosphorylase mutants R134A, V325I, M329H, and Q338F obtained in the present invention to convert sucrose and L-ascorbic acid to synthesize AA-2G.

[0075] The cell precipitate of the sucrose phosphorylase fermentation broth is collected after centrifugation. After being broken and centrifuged, the supernatant is collected as the crude enzyme solution, and the crude enzyme solution is used for the catalytic reaction to convert sucrose and L-ascorbic acid to synthesize AA-2G.

[0076] The catalytic reaction system is as follows: the concentration of the crude enzyme solution is 20 g / L, the added concentration of sucrose is 0.7 M, the added concentration of L-ascorbic acid is 0.5 M, and MES buffer solution (50 mM, pH = 6.5). Among them, L-ascorbic acid is added in 5 batches, and the reaction is carried out at 50 °C for 8 h. After the reaction, the concentrations of various substances in the obtained reaction solution are detected by high performance liquid chromatography, and the content of AA-2G in the sample is determined according to the peak area. The high performance liquid chromatography analysis is carried out under the following conditions: the instrument is Agilent high performance liquid chromatograph 1200, the chromatographic column is C18 column, 250×4.6 mm, the column temperature: 30 °C, K2HPO4·3H2O: 0.57 g / L, the pH is adjusted to 2.00 with phosphoric acid; the flow rate: 1 mL / min, the sample loading volume is 20 μL, and the ultraviolet detector is used for detection at 240 nm. The content and conversion rate of the HPLC-detected product AA-2G are shown in Table 3 and Figure 2 . Among them, the mutant V325I has the highest yield of AA-2G produced by the catalytic reaction, which can reach 140.9 g / L.

[0077] Table 3 Comparison of catalytic effects of different mutants

[0078] Mutant Conversion rate (%) AA-2G yield (g / L) SkSP-WT 42 71.0 R134A 62 104.9 V325I 83 140.4 M329H 67 113.3 G338F 55 93.0

[0079] In summary, in the present invention, by modifying sucrose phosphorylase SkSP, a plurality of sucrose phosphorylase mutants with high activity (R134A, V325I, M329H, G338F) are successfully obtained. Compared with the wild-type enzyme, the catalytic efficiency of these mutants is increased by 2.3-7.2 times, and they have high thermal stability and can catalyze the reaction at 50 °C. In the reaction of catalyzing the synthesis of AA-2G from sucrose and L-ascorbic acid, these mutants show good catalytic activity, significantly improve the production efficiency of AA-2G, the yield is as high as 140.4 g / L, and the conversion rate is 83%.

[0080] The above is only the preferred embodiment of the present invention, and it does not limit the patent scope of the present invention. All equivalent changes and modifications made according to the scope of the present invention should still fall within the scope covered by the present invention.

Claims

1. A sucrose phosphorylase mutant, characterized in that, The mutant was obtained by site-directed modification of the amino acid sequence of wild-type sucrose phosphorylase shown in SEQ ID NO: 1, and at least any one of the following single-site mutations exists at positions 134, 325, 329, and 338: (1) replacing arginine at position 134 of the amino acid sequence shown in SEQ ID NO: 1 with alanine; (2) replacing valine at position 325 of the amino acid sequence shown in SEQ ID NO: 1 with isoleucine; (3) replacing methionine at position 329 of the amino acid sequence shown in SEQ ID NO: 1 with histidine; (4) replacing glutamine at position 338 of the amino acid sequence shown in SEQ ID NO: 1 with phenylalanine; The amino acid sequence of the mutant is shown in SEQ ID NOs: 3-6.

2. The sucrose phosphorylase mutant according to claim 1, characterized in that, The wild-type sucrose phosphorylase is derived from Salipaludibacillus keqinensis sucrose phosphorylase.

3. The sucrose phosphorylase mutant according to claim 2, wherein The sucrose phosphorylase derived from Salipaludibacillus keqinensis has a gene as shown in SEQ ID NO:

2.

4. The gene of the sucrose phosphorylase mutant according to claim 1.

5. A recombinant expression vector, characterized in that, The recombinant expression vector contains the gene encoding the sucrose phosphorylase mutant in claim 4, and the nucleotide sequence of the gene is shown in SEQ ID NOs: 7-10.

6. A recombinant engineering bacterium, characterized in that, The recombinant engineered bacterium was obtained by transforming the recombinant expression vector according to claim 5 into a host microorganism.

7. Use of the sucrose phosphorylase mutant described in claim 1 or the recombinant engineered bacterium described in claim 6 in the preparation of L-ascorbic acid glucoside, characterized in that, The preparation uses sucrose and L-ascorbic acid as substrates to catalytically synthesize L-ascorbic acid glucoside.

8. A method for preparing L-ascorbic acid glucoside, characterized in that, It includes the following steps: (1) Ferment and culture the recombinant engineered bacterium in claim 6, then break the cell wall to obtain a crude enzyme solution; (2) Add 20-30 g / L of the crude enzyme solution, 0.5-1.0 M sucrose, and 0.2-0.8 M L-ascorbic acid to the reaction system, adjust the pH to 6-7 using MES buffer at a concentration of 50 mM, and react at 50 °C for 8-12 hours, where the L-ascorbic acid is added in 3-6 portions.