Primer pair for detecting parabacteroides didysonii and application of primer pair

By designing specific primer pairs and primer combinations, combining PCR and qPCR technology, the problem of detecting Parabens Diet in complex environments is solved, and high sensitivity and specificity detection is achieved, supporting the evaluation of intestinal microbiota and the formulation of personalized treatment plans.

CN120366292APending Publication Date: 2025-07-25SICHUAN ANAEROBIC BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311641428.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-04
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently and accurately detect Parabacteroides Diet in complex environments, especially in fecal samples, resulting in insufficient sensitivity and accuracy of intestinal flora detection, which affects the evaluation of tumor treatment-related diarrhea and the formulation of personalized treatment plans.

Method used

A specific primer pair and primer combination was designed, and Pdist-1, which can be specifically amplified in fecal samples by PCR, combined with qPCR technology, can achieve efficient and accurate detection of this strain.

Benefits of technology

High sensitivity and specificity detection of Parabens Diet in complex environments is achieved, supporting the accurate assessment of intestinal flora, helping to evaluate subjects' tolerance to anti-tumor treatment-related diarrhea and formulating personalized treatment plans.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366292A_ABST
    Figure CN120366292A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of microbiological detection, and relates to a primer pair and application thereof. The primer pair is used for detecting the parabacteroides didysonii of which the microbial preservation number is CCTCC (China Center For Type Culture Collection) NO: M20222033. The invention further discloses a kit based on the primer pair and the primer combination and application of the kit. The primer pair has good specificity and high accuracy on the bacteria, and can detect the bacteria in a complex environment and evaluate the physiological status of a subject.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial detection, and relates to a primer pair and its application, in particular to a specific primer pair for detecting Parabacteroides distasonis and its application in preparing preparations for detecting the tolerance of a subject to several types of diarrhea and the like. Background Art

[0002] In recent years, research on the relationship between the gut microbiota and human health has emerged in an endless stream and has become a major focus of microbial research. Probiotics are live beneficial microorganisms that colonize the human body, animal intestines, and reproductive systems and can produce definite health effects, thereby improving the host's microecological balance and exerting beneficial effects. Colonization is a prerequisite for probiotics to function in the body. Therefore, understanding the colonization of probiotics in the body can assist in evaluating their effectiveness and help guide medication. The qPCR technique can be used to determine the number of bacterial cells of a strain in a sample.

[0003] Currently, the common methods for detecting the colonization ability of strains are as follows: A. Fluorescence imaging: By feeding a strain labeled with a fluorescent protein, the position and number of the target strain in the intestine are detected; B. Metagenomic sequencing: By metagenomic sequencing, the relative abundance of the target strain is detected; C. Viable cell counting: By using a selective medium to perform viable cell counting on the target strain; D. qPCR detection: Using a universal primer pair to perform quantitative detection of strains at the phylum / family / genus / species level. For qPCR detection of the colonization ability of strains, a universal primer is mostly used to detect the content of strains at the phylum / family / genus / species level. It is difficult to design specific primers, and in the context of a complex microbial community, there are technical challenges in tracking a single strain, and it is difficult to achieve accurate quantification of the strain.

[0004] There has been no clinical application report on treating anti-tumor therapy-related diarrhea with gut probiotics (especially Parabacteroides distasonis). If such probiotics can be prepared, it may reduce side effects during the treatment process, and the cost of culturing microorganisms is low. Of course, detecting whether there are such active bacteria in the gut microbiota of a subject is also helpful for evaluating the subject's own ability to resist anti-tumor therapy-related diarrhea or related symptoms, and is helpful for guiding personalized treatment plans for cancer patients. Summary of the Invention

[0005] The purpose of the present invention is to provide a specific primer for detecting Parabacteroides distasonis Pdist-1 in complex environmental samples such as feces and its application.

[0006] To screen for primers that can specifically amplify the target strain in feces, PCR was used to amplify the feces of normal mice. After screening out the specific primers, it is necessary to detect the background amplification of the strain-specific primers in mouse feces. If the viable bacteria count of the background amplification is greater than the animal dosing dose, the method sensitivity is insufficient and the primers need to be re-screened. Therefore, using the primers that passed the re-screening, with feces and DNA of feces plus different concentrations of plasmids as templates, the sensitivity of the method was detected, and finally the primers were determined.

[0007] The present invention aims to screen specific genes, design specific primers, amplify mouse feces, screen for specific primers that can specifically amplify the target strain in feces, and establish a method for a mixture of mouse feces DNA and different concentrations of plasmids, to obtain primers that can specifically amplify the target strain in feces, and to provide an efficient and accurate identification method for detecting Parabacteroides distasonis Pdist-1, so as to solve problems such as colonization detection and strain identification faced in the process of animal efficacy experiments.

[0008] The specific primers provided by the present invention satisfy that there is no band in the negative control (no DNA template), there is a single band in the positive control (single-bacterium DNA), and there is no band in the feces DNA sample, indicating that the primers can be used for the detection of the content of Parabacteroides distasonis Pdist-1.

[0009] More specifically, to solve the problems existing in the prior art, the first aspect of the present invention provides a primer pair that can amplify a genomic fragment as shown in SEQ ID NO.15 or a sub-fragment with a length greater than 50 nt thereof.

[0010] Obviously, the sub-fragments of the genomic fragment shown in SEQ ID NO.15 can still be used as templates for detecting this fragment.

[0011] In some embodiments, in the primer pair, the sequences complementary to the template at the downstream of the primers are respectively as shown in SEQ ID NO.11 and SEQ ID NO.12.

[0012] When there are several unpaired bases (tails) or molecular markers (such as fluorescent molecules) at the upstream of a primer, it does not affect the amplification effect of this pair of primers, and at least gel electrophoresis can be used to characterize the amplification products.

[0013] In some embodiments, in the primer pair, the primer sequences are respectively as shown in SEQ ID NO.11 and SEQ ID NO.12.

[0014] The second aspect of the present invention provides a primer combination, which is a combination of any one, any two of the primer pair described in the first aspect of the present invention and a second primer pair, a third primer pair;

[0015] In the second primer pair, the sequences complementary to the template at the downstream of the primers are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively; and

[0016] In the third primer pair, the sequences complementary to the template at the downstream of the primers are shown as SEQ ID NO.9 and SEQ ID NO.10 respectively.

[0017] Obviously, when two or more kinds of primers are used for parallel detection, the detection accuracy will be improved.

[0018] In some embodiments, in the second primer pair, the primer sequences are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively; and

[0019] In the third primer pair, the primer sequences are shown as SEQ ID NO.9 and SEQ ID NO.10 respectively.

[0020] The third aspect of the present invention provides a kit, which contains the primer pair described in the first aspect of the present invention or the primer combination described in the second aspect of the present invention.

[0021] The fourth aspect of the present invention provides a method for detecting Parabacteroides distasonis with the preservation number of CCTCC NO:M20222033 for non-diagnostic purposes;

[0022] The method is as follows: using the primer pair described in the first aspect of the present invention, the primer combination described in the second aspect of the present invention or the kit described in the third aspect of the present invention to detect the genomic template in the sample to be detected.

[0023] An application scenario of the method for detecting Parabacteroides distasonis with the preservation number of CCTCC NO:M20222033 for non-diagnostic purposes is: in order to study the competitive advantage of Pdist-1 and other bacteria, the two are mixed and cultured, and then the absolute or relative content of Pdist-1 in the culture is detected, so as to know the competitive advantage in the co-ecological environment of the two bacteria and understand the competition mechanism between the two bacteria.

[0024] In some embodiments, by PCR method, the electrophoresis picture of the amplification product is detected to judge the microorganism contained in the sample to be detected; or

[0025] By qPCR method, judge the microorganism contained in the sample to be detected.

[0026] The fifth aspect of the present invention provides a use of a biological material in medical-related operations, and the use is as follows U1, U2 or U3:

[0027] U1: The genomic fragment shown in SEQ ID NO.15 or its sub-fragment with a length greater than 50 nt, the primer pair described in the first aspect of the present invention, the primer combination described in the second aspect of the present invention, or the kit described in the third aspect of the present invention is used in the preparation of a preparation for evaluating the ability or state of a subject to tolerate, resist, prevent or relieve a disease or sub-health;

[0028] The subject is selected from the group consisting of humans, dogs and mice;

[0029] The ability or state of tolerating, resisting, preventing or relieving a disease or sub-health is selected from any one, any two, any three or all four of the following four aspects:

[0030] The ability or state of tolerating, resisting, preventing or relieving diarrhea;

[0031] The ability or state of improving the antioxidant capacity in the intestine;

[0032] Reducing intestinal damage caused by chemotherapeutic drugs;

[0033] The ability or state of tolerating, resisting, preventing or relieving a disease or sub-health by reducing the gene expression levels of IL-6 and / or TNF-α;

[0034] U2: The primer pair described in the first aspect of the present invention, the primer combination described in the second aspect of the present invention, or the kit described in the third aspect of the present invention is used in the preparation of a preparation for evaluating the therapeutic effect of a probiotic, wherein the active bacteria in the probiotic are Parabacteroides distasonis with the microorganism deposit number CCTCC NO:M20222033; and

[0035] U3: The primer pair described in the first aspect of the present invention, the primer combination described in the second aspect of the present invention, or the kit described in the third aspect of the present invention is used in the preparation of a preparation for formulating or adjusting a treatment plan for cancer patients.

[0036] In some embodiments, in U1, the diarrhea is diarrhea caused by chemotherapeutic drugs; or

[0037] The diarrhea is diarrhea caused by any one, any two, any three or all four of Salmonella paratyphi B, Staphylococcus aureus, Yersinia enterocolitica, and Clostridium difficile; or

[0038] In U1, the method for realizing the use is: qualitatively or quantitatively detecting Parabacteroides distasonis with the microorganism deposit number CCTCC NO:M20222033 in the intestinal contents or feces of the subject; or

[0039] In U2, the implementation method of the use is: qualitatively or quantitatively detecting Bacteroides parapseudotetrahedralis with the preservation number of CCTCC NO: M20222033 in the intestinal contents or feces of a subject; or

[0040] In U3, the implementation method of the use is: qualitatively or quantitatively detecting Bacteroides parapseudotetrahedralis with the preservation number of CCTCC NO: M20222033 in the intestinal contents or feces of a subject.

[0041] In some embodiments, in U1, the chemotherapeutic drug is selected from 5-fluorouracil, capecitabine, gemcitabine, methotrexate, pemetrexed, cytarabine, doxorubicin, epirubicin, actinomycin D, doxorubicin, daunorubicin, paclitaxel, docetaxel, albumin-bound paclitaxel, cisplatin, carboplatin, nedaplatin, oxaliplatin, lobaplatin, cyclophosphamide, nitrogen mustard, carmustine, camptothecin, hydroxycamptothecin, topotecan, irinotecan and their derivatives.

[0042] Obviously, when the intestine of a subject (such as a human) contains Bacteroides parapseudotetrahedralis (Pdist-1) with the preservation number of CCTCC NO: M20222033, it can better antioxidant in the intestine, is less likely to have diarrhea or has milder diarrhea symptoms, and the inflammation manifested as an increase in the gene expression level of IL-6 and / or TNF-α will be milder. The primer pair described in the first aspect of the present invention, the primer combination described in the second aspect of the present invention or the kit described in the third aspect of the present invention can be used to detect whether Pdist-1 is contained in the intestinal contents or feces, so as to evaluate the relative strength of the subject's ability to tolerate, resist, prevent or relieve the diseases or sub-health conditions corresponding to the foregoing indicators. For the genomic fragment shown in SEQ ID NO.15, it can be used as the basis for designing PCR primers, and its sub-fragments with a length greater than 50 nt can also be amplified. When designing detection techniques based on nucleic acid hybridization such as gene chip probes, its full length or sub-fragments can be applied. Therefore, use U1 is a use based on the actual contribution of the present invention.

[0043] Pdist-1 itself is derived from the feces of human volunteers, does not cause red blood cell hemolysis, has the ability to resist gastric acid, and has at least the foregoing use of improving health conditions. When using Pdist-1 as a probiotic to regulate human health conditions, the absolute or relative content of Pdist-1 in the intestinal contents or feces after administering Pdist-1 can be detected at least by the primer pair described in the first aspect, the primer combination described in the second aspect of the present invention or the kit described in the third aspect of the present invention to evaluate the actual or approximate action state of Pdist-1. Therefore, use U2 is a use based on the actual contribution of the present invention.

[0044] Pdist-1 can reduce diarrhea and intestinal damage caused by chemotherapeutic drugs (such as 5-fluorouracil). Therefore, for patients with Pdist-1 in the intestine, it can be considered to appropriately reduce the types or doses of anti-cancer drugs, while for patients without Pdist-1 in the intestine, relatively increase the types or doses of anti-cancer drugs. By using the primer pair described in the first aspect of the present invention, the primer combination described in the second aspect of the present invention or the kit described in the third aspect of the present invention to detect Pdist-1 in intestinal contents or feces, it can provide reference data for formulating or adjusting treatment plans for cancer patients. Therefore, Use U3 is a use based on the actual contribution of the present invention.

[0045] The technical key points of the present invention are: 1. Screening and obtaining a specific primer for Parabacteroides distasonis; 2. This specific primer can have high precision under complex environmental samples; 3. Screening and obtaining specific primers in complex environmental samples. Brief Description of the Drawings

[0046] Figure 1 Shows the front photo of the colony morphology of Parabacteroides distasonis Pdist-1 of the present invention.

[0047] Figure 2 Shows the results of in vitro antioxidant tests of Parabacteroides distasonis Pdist-1 and Lactobacillus rhamnosus.

[0048] Figure 3 Shows the antibacterial test results of Parabacteroides distasonis Pdist-1 against various pathogenic bacteria.

[0049] Figure 4 Shows the treatment effects of each experimental group on 5-fluorouracil-induced diarrhea mice. A shows the diarrhea score curves of each group on the 1st - 9th days; B shows the total diarrhea score chart of each group.

[0050] Figure 5 Shows the influence of each experimental group on the colonic pathological damage of 5-fluorouracil-induced diarrhea mice. A shows the HE staining results of each group; B shows the total pathological score of each group.

[0051] Figure 6 Shows the influence of each experimental group on the expression of TNF-α gene in the colon of 5-fluorouracil-induced diarrhea mice.

[0052] Figure 7 Shows the detection results of specific primers (n = 2).

[0053] Figure 8 Shows the detection results of specific primers (n = 10).

[0054] Figure 9 Shows the PCR detection results.

[0055] Figure 10 The qPCR detection results of Parabacteroides distasonis Pdist-1 in feces are shown. Specific implementation manners

[0056] To make the objectives, technical solutions and advantages of the present invention clearer, the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0057] Preparation of triple-mixed liquid medium (BHI + MRS + modified GAM): Weigh 19.25 g of BHI broth powder (Qingdao Haibo Biotechnology Co., Ltd., HB8297-5), 13.5 g of MRS broth powder (Guangdong Huankai Microbiological Co., Ltd., 027312), and 15 g of modified GAM broth powder (Qingdao Haibo Biotechnology Co., Ltd., HB8518-3), dissolve them in 1 L of distilled water, displace oxygen with N2 and dispense, sterilize at 121 °C under high-temperature and high-humidity conditions for 30 min, and store in a cool and dry place.

[0058] Preparation of triple-mixed solid medium (BHI + MRS + modified GAM): Add 5 g of agar powder on the basis of the triple-mixed liquid medium, and the other steps are the same.

[0059] Preparation of double-mixed liquid medium (BHI + MRS): Weigh 19.25 g of BHI broth powder, 27.0 g of MRS broth powder, and 0.5 g of cysteine hydrochloride monohydrate (Emeishan Longteng Biotechnology Co., Ltd.), dissolve them in 1 L of distilled water, remove oxygen and dispense, sterilize at 121 °C under high-temperature and high-humidity conditions for 15 min, and store in a cool and dry place.

[0060] Preparation of YCFA liquid medium: Weigh 10.0 g of peptone, 2.5 g of yeast extract, 0.45 mL of MgSO4·7H2O (10% mother liquor), 0.45 mL of CaCl2 (10% mother liquor), 10 mL of TE1411, 0.45 g of K2HPO4, 0.45 g of KH2PO4, 0.90 g of NaCl, and 3.2 mL of VFA-mix, dissolve them in 1 L of distilled water, displace oxygen with N2 and dispense, sterilize at 121 °C under high-temperature and high-humidity conditions for 30 min, and store in a cool and dry place for standby.

[0061] Preparation of TE141: Weigh 1.50 g of Nitrilotriacetic acid and add it to 200 mL of pure water. Add an appropriate amount of NaOH until the solution becomes clear. Then add 800 mL of water and adjust the pH value to 5.5 with 50% HCl. Subsequently, weigh 3.00 g of MgSO4·7H2O, 0.50 g of MnSO4·H2O, 1.00 g of NaCl, 0.10 g of FeSO4·7H2O, 0.18 g of CoSO4·7H2O, 0.10 g of CaCl2·2H2O, 0.18 g of ZnSO4·7H2O, 0.006 g of CuSO4·5H2O, 0.02 g of KAl(SO4)2·12H2O, 0.01 g of H3BO3, 0.01 g of Na2MoO4·2H2O, 0.03 g of NiCl2·6H2O, 0.03 mL (10 mg / mL stock solution) of Na2SeO3·5H2O, and 0.03 mL (10 mg / mL stock solution) of Na2WO4·2H2O and add them to the above test solution. Stir continuously during the addition process to keep the solution clear for standby.

[0062] Preparation of VFA-mix: Measure 90 mL of acetic acid, 30 mL of propionic acid, 10 mL of n-valeric acid, 10 mL of isobutyric acid, and 10 mL of butyric acid, mix them well for standby, and adjust to neutral with 5M NaOH before use.

[0063] Preparation of BF839 medium: Weigh 6.0 g of potato powder (Beijing Solarbio Science & Technology Co., Ltd., FA0270), 10.0 g of multivalent peptone (Beijing Solarbio Science & Technology Co., Ltd., P8950-250), 5.0 g of peptone (Qingdao Hi-Tech Industrial Park Haibo Biotechnology Co., Ltd., HB8277), 0.3 g of sodium thioglycollate (Shanghai Aladdin Biochemical Technology Co., Ltd., S105664-25G), 5.0 g of yeast extract powder (Thermo Fisher Oxoid, LP0021B), 1.5 g of glucose (Chengdu Kelong Chemical Co., Ltd., 50-99-7), and 4.0 g of disodium hydrogen phosphate (Chengdu Kelong Chemical Co., Ltd., 7558-79-4), dissolve them in 1 L of distilled water, displace oxygen with N2 and dispense, sterilize at 121 °C under high-temperature and high-humidity conditions for 30 min, and store in a cool and dry place.

[0064] Preparation of medium for bacterial powder preparation: Weigh 6 g of anhydrous glucose, 15 g of soy peptone, 10 g of yeast extract powder, 10 g of yeast peptone, 2 g of potassium dihydrogen phosphate, 2 g of disodium hydrogen phosphate, 0.2 g of magnesium sulfate, 0.01 g of manganese sulfate, 0.2 g of calcium chloride, 1 mL of Tween 80, and 0.5 g of cysteine hydrochloride monohydrate, dissolve them in 1 L of distilled water, displace oxygen with N2, dispense, and sterilize at 121 °C for 15 min. Store in a cool and dry place.

[0065] The media of TSB (tryptone soya broth, Qingdao Haibo Biotechnology Co., Ltd., HB4114) and TSA (tryptone soya agar, Qingdao Haibo Biotechnology Co., Ltd., HB4138) were prepared by weighing and dissolving according to the instructions, sterilized at 121 °C by high-temperature and moist heat for 30 min, and stored in a cool and dry place.

[0066] Example 1: Isolation and identification of a new strain

[0067] The screening and isolation method of Parabacteroides distasonis Pdist-1 is as follows:

[0068] Collect fresh fecal samples from healthy volunteers, add an appropriate amount of anaerobic PBS for resuspension, and shake until the samples are fully resuspended. Under the protection of N2, after filtering twice through gauze, the filtrate was dispensed into 50 mL centrifuge tubes, centrifuged at 10000 rpm for 20 min, and the supernatant was discarded. Add an appropriate amount of anaerobic PBS to resuspend the cells, then add an equal volume of 50% anaerobic glycerol and mix well, dispense into 2 mL screw-cap tubes, 0.5 mL per tube. After dispensing, put the tubes in a bag and evacuate to vacuum, and store at -80 °C in the refrigerator for later use.

[0069] When isolating, take 1 frozen sample tube, resuspend 0.5 mL of the thawed sample in 4.5 mL of anaerobic PBS, vortex for 5 min, then transfer it into an anaerobic glove box. Take 0.5 mL of the bacterial suspension and mix it evenly with 4.5 mL of anaerobic PBS, and dilute it by ten-fold gradient to 10 -6 , take an appropriate gradient of the bacterial solution, mix it with YCFA medium, and dispense it into a 384-well plate, and culture it anaerobically at 37 °C for one week. Pick the bacterial solution from the grown wells for subculture. After culturing for 48 h, one part was detected by MALDI-TOF-MS to preliminarily classify the isolated strains, and the other part was subcultured into a 96-well plate again according to the mass spectrometry results, in duplicate. After culturing for 48 h, 16S rDNA gene amplification was performed on one plate and sequenced by Beijing Tsingke Biotechnology Co., Ltd., Chengdu Branch, and the other plate was mixed evenly with 50% glycerol at a ratio of 1:1 for temporary preservation, temporarily named strain a, and used after the PCR results were confirmed.

[0070] The 16S rDNA gene sequencing results were analyzed, and the sequences were compared with the NCBI Nucleotide database. The results showed that the highest sequence similarity was with a strain of Parabacteroides distasonis (>99%). Thus, strain a was preliminarily identified as Parabacteroides distasonis, and strain a was officially named Parabacteroides distasonis Pdist-1. After culturing with BF839 medium, its colony morphology was white, opaque, round colonies, convex in the middle, smooth and moist on the surface. The front photo is shown in Figure 1 .

[0071] Example 2: Whole-genome analysis and identification of a new strain

[0072] Parabacteroides distasonis Pdist-1 was inoculated into 5 mL of anaerobic triple-mixed liquid medium at an inoculation amount of 2%, and cultured until the late logarithmic growth phase. The whole-genome DNA of the strain was extracted, and whole-genome sequencing was performed using the Illumina high-throughput sequencing platform NovaSeq 6000. After assembly and annotation, the protein sequences were input into the Virulence Factor Databases (VFDB) for virulence factor analysis. The results showed that the bacterium did not have virulence factors.

[0073] The novelty of the strain was analyzed using Average Nucleotide Identity (ANI). By searching in Genbank, 269 publicly available whole genomes of Parabacteroides distasonis were found. Through comparison with fastANI (v1.33), the two strains closest to the whole genome of Parabacteroides distasonis Pdist-1 were GCA_003462945.1 (ANI = 98.26%) and GCA_003459965.1 (ANI = 98.20%), both of which were lower than 99.9%. Therefore, Parabacteroides distasonis Pdist-1 can be considered a new strain, and its 16S rDNA sequence is shown in SEQ ID NO.16.

[0074] The whole genome sequence was annotated by emapper-2.1.9, and further found that Parabacteroides distasonis Pdist-1 has genes encoding a protein for producing isomeric bile acids with an amino acid sequence shown in SEQ ID NO.17, two enzymes related to acetic acid production with amino acid sequences shown in SEQ ID NO.18 and SEQ ID NO.19 respectively, three enzymes related to propionic acid production with amino acid sequences shown in SEQ ID NO.20, SEQ ID NO.21 and SEQ ID NO.22 respectively, an enzyme related to CAT (catalase) production with an amino acid sequence shown in SEQ ID NO.23, and an enzyme related to SOD (superoxide dismutase) production with an amino acid sequence shown in SEQ ID NO.24.

[0075] This strain was deposited at the China Center for Type Culture Collection (CCTCC, the preservation center of Wuhan University) on December 23, 2022. The center address is Wuhan University, Wuhan, China. The deposit number of this strain is: CCTCC NO: M 20222033. Its taxonomic name is Parabacteroides distasonis, and the corresponding Chinese name is Parabacteroides distasonis. The name of the culture is Parabacteroides distasonis Pdist-1, and the identification survival date is: December 30, 2022.

[0076] Example 3: Hemolysis test of Parabacteroides distasonis Pdist-1

[0077] The preserved Parabacteroides distasonis Pdist-1 was inoculated into 5 mL of anaerobic triple-mixed liquid medium at an inoculation amount of 2%, and anaerobically cultured at 37 °C until the late logarithmic growth phase to obtain an activated strain. A liquid contact method was used to detect a bacterial suspension obtained by resuspending 2 mL of 2% fresh rabbit red blood cell suspension (Beijing Borsi Technology Co., Ltd.) and 2 mL of 0.9% sterile physiological saline (Shandong Qidu Pharmaceutical Co., Ltd.). Sterile water of equal volume was used as a positive control (hemoglobin was released after red blood cells swelled and burst), and 0.9% sterile physiological saline of equal volume was used as a negative control. Three parallels were set for each group. After standing for 24 h, each sample was photographed. The results showed that there was no hemolysis phenomenon in the bacterial suspension of Parabacteroides distasonis Pdist-1. Therefore, there is no hemolysis risk for human administration.

[0078] Example 4: Antibiotic sensitivity test of Parabacteroides distasonis Pdist-1

[0079] According to the requirements of the anaerobic bacteria antibiotic susceptibility test in the "Technical Requirements for Antimicrobial Susceptibility Testing" (WS / T 639-2018) of the Health Industry Standards of the People's Republic of China, the broth dilution method was used to determine the susceptibility of the strain to antibiotics, and the susceptibility level of the strain to antibiotics was judged according to the MIC value (the lowest concentration of antibiotics that inhibits the visible growth of bacteria with the naked eye).

[0080] Activation and streaking of the strain: Bacteroides paratheniformis Pdist-1 was activated in a triple mixed liquid medium (BHI + MRS + modified GAM), anaerobically cultured at 37 °C for 24 h, and a loop of bacterial liquid was picked and streaked on the triple mixed solid medium, and then anaerobically cultured at 37 °C.

[0081] Gradient dilution of antimicrobial agents: The prepared drug was diluted to 512 μg / mL and serially diluted to 256, 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25 μg / mL (a total of 11 concentrations) in a 12-well dilution trough, and the antimicrobial agent solutions of each gradient were dispensed into a 96-well plate at 0.1 mL / well.

[0082] Preparation of bacterial suspension: Several single colonies were picked from the cultured solid plate and inoculated into normal saline to prepare a bacterial suspension, and the turbidity of the suspension was adjusted to 0.5 McFarland concentration. The initial inoculum was diluted 1:100 with Brucella broth, mixed evenly, and the bacterial liquid concentration was about 1×10 6 CFU / mL.

[0083] Inoculation of bacterial suspension: 0.1 mL of the prepared bacterial suspension was sequentially pipetted into the prepared 96-well microplate containing equal amounts of antimicrobial agents in order, so that the final inoculum concentration was 5×10 5 CFU / mL, and the drug concentrations were 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125 μg / mL.

[0084] Incubation: The above-mentioned 96-well microplate was placed in an anaerobic incubator at 37 °C and incubated for 46 h to 48 h.

[0085] Result interpretation: The lowest antibiotic concentration that inhibits the visible growth of bacteria with the naked eye was taken as the MIC (μg / mL).

[0086] Experimental results: The MIC values of Bacteroides paratheniformis Pdist-1 against 12 antibiotics are shown in Table 1.

[0087] Table 1 MIC values of Bacteroides paratheniformis Pdist-1 against 12 antibiotics

[0088] Antibiotic MIC (μg / mL) Penicillin 8 Ampicillin 8 Imipenem 16 Vancomycin 8 Ceftriaxone 16 Tetracycline 8 Erythromycin 32 Clindamycin 16 Levofloxacin 8 High-concentration Gentamicin <0.125 Streptomycin <0.125 Rifampicin <0.125

[0089] Example 5: Antioxidant experiment of Bacteroides paratheniformis Pdist-1

[0090] After activating the preserved Parabacteroides distasonis Pdist-1, inoculate it into 5 mL of anaerobic BF839 medium at an inoculation amount of 2%. Use Lactobacillus rhamnosus GG (LGG, CICC6141, China Center for Industrial Culture Collection) as a positive control. All strains are anaerobically cultured in anaerobic BF839 medium at 37°C for 24 h.

[0091] Sample treatment: Take 0.5 mL of the cultured bacterial solution, centrifuge it at 12000 rpm for 20 min, discard the supernatant, and resuspend it with 0.5 mL of the extraction solution (pre-cooled) in the total antioxidant capacity detection kit (the kit is purchased from Beijing Solarbio Science & Technology Co., Ltd., BC1315); transfer it to a sterilized screw-cap tube containing beads (Sigma-Aldrich Company, G4649-1KG), and use a rapid sample preparation instrument to oscillate and break the cell wall once (parameter settings: 4.5 m / s, 30 s), then centrifuge it at 12000 rpm at 4°C for 10 min, and take the supernatant and place it on ice for further measurement.

[0092] Use a BCA protein concentration assay kit (the kit is purchased from Beijing Solarbio Science & Technology Co., Ltd., PC0020), and draw a standard curve and detect the protein content in the sample according to the instructions of the kit.

[0093] Use a total antioxidant capacity detection kit for strains (the kit is purchased from Beijing Solarbio Science & Technology Co., Ltd., BC1315), and measure the antioxidant capacity of the sample according to the instructions of the kit in combination with the standard curve. Calculate the total antioxidant capacity per unit sample according to the protein concentration, with the unit of μmol / mg prot. The results of the total antioxidant capacity of the control bacteria and the test bacteria are shown in Figure 2 .

[0094] As Figure 2 can be seen, the total antioxidant capacity of strain Pdist-1 reaches 0.27 μmol / mg prot, which is equivalent to that of the positive control strain Lactobacillus rhamnosus GG, indicating that Pdist-1 has antioxidant capacity in vitro.

[0095] Example 6: Antibacterial ability test of Parabacteroides distasonis Pdist-1 against pathogenic bacteria

[0096] Select 5 common pathogenic bacteria that can cause diarrhea for antibacterial ability detection. The source information of the pathogenic strains is shown in Table 2.

[0097] Table 2 Source information of pathogenic bacteria

[0098] Strain Name Strain Preservation Number Strain Preservation Institution Pseudomonas aeruginosa CMCC(B)10104 National Institutes for Food and Drug Control Salmonella paratyphi B CMCC(B)50094 National Institutes for Food and Drug Control Yersinia enterocolitica CMCC(B)52204 National Institutes for Food and Drug Control Staphylococcus aureus CMCC(B)26003 National Institutes for Food and Drug Control Vibrio parahaemolyticus ATCC17802 American Type Culture Collection

[0099] Preparation of fermentation broth of Parabacteroides distasonis Pdist-1: After activating Parabacteroides distasonis Pdist-1, inoculate it into an anaerobic three-component liquid medium (BHI + MRS + modified GAM) at an inoculation amount of 2%, and anaerobically culture it at 37°C for 48 h to obtain the fermentation broth.

[0100] Preparation and coating of pathogenic bacteria: Pseudomonas aeruginosa, Salmonella paratyphi B, Yersinia enterocolitica, Staphylococcus aureus, and Vibrio parahaemolyticus are aerobic bacteria. After activation in TSB broth medium, dilute them 50 times in TSB broth medium to reach the appropriate concentration, and take 0.2 mL of the diluted bacterial solution and coat it on TSA solid medium.

[0101] Co-culture of Parabacteroides distasonis Pdist-1 and pathogenic bacteria: Place 3 sterilized Oxford cups on the plate coated with pathogenic bacteria, and add 0.2 mL of the fermentation broth of Parabacteroides distasonis Pdist-1 into the Oxford cups. Put it into an anaerobic culture box, incubate the petri dish upright for 24 h, measure the size of the inhibition zone with a vernier caliper, and calculate the average size of the inhibition zone.

[0102] Experimental results: As Figure 3 shown, Parabacteroides distasonis Pdist-1 has inhibitory ability against Pseudomonas aeruginosa, Salmonella paratyphi B, Yersinia enterocolitica, Staphylococcus aureus, and Vibrio parahaemolyticus.

[0103] Example 7: Therapeutic effect of Parabacteroides distasonis Pdist-1 on 5-FU-induced diarrhea mice

[0104] Preparation of freeze-drying protectant:

[0105] Solution A: 6 g of sucrose, 6 g of trehalose, 2 g of xylitol, 2 g of sorbitol, 44 g of purified water;

[0106] Solution B: 5 g of sodium glutamate, 15 g of purified water; Sterilize at 115°C for 20 min.

[0107] Solution C: 4 g of sodium ascorbate, 16 g of purified water. Filter and sterilize for later use.

[0108] When using, mix according to the volume ratio A:B:C = 6:2:2.

[0109] Preparation of bacterial powder: Inoculate the preserved Parabacteroides distasonis Pdist-1 into the bacterial powder preparation medium at an inoculation amount of 10%, and anaerobically culture it at 37°C and 90 rpm for 16 - 24 h to obtain the first-stage seed liquid (OD 600 value ≥ 0.8). Subsequently, transfer it to the bacterial powder preparation medium at an inoculation amount of 3.0%, and anaerobically culture it at 37°C and 90 rpm for 10 - 15 h to obtain the second-stage seed liquid (OD 600Value ≥ 0.8). The secondary seed liquid was pumped into the fermenter by a peristaltic pump at an inoculation amount of 3.0%, and the fermentation parameters (37 °C, pH 6.0, 100 rpm, 0.06 MPa) were set for fermentation culture. The OD of the fermented bacterial liquid 600 value ≥ 1.5 or when the increase in OD 600 value ≤ 0.1, fermentation was stopped. The fermentation temperature was set at 20 °C, and the bacterial cells were collected by centrifugation. The lyophilization protectant was added at a weight ratio of bacterial sludge to lyophilization protectant of 1:1 - 1:2, and the bacterial sludge was mixed and emulsified. The emulsified bacterial suspension was placed on the shelves of a freeze dryer cooled to -40 °C for lyophilization. After the lyophilization program was completed, the bacterial cake was taken out and pulverized to obtain the bacterial powder. Before animal administration, Bacteroides paraputrificus Pdist-1 was prepared into a bacterial suspension of 5×10 9 CFU / mL with normal saline.

[0110] Experimental animals: 20 SPF-grade male Balb / c mice, weighing 18 - 22 g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and were housed in an SPF-grade animal house. According to the initial body weight of the mice, they were randomly divided into 4 groups, with 5 mice in each group. The 4 groups were the normal control group, the model control group, the positive control loperamide group, and the Bacteroides paraputrificus Pdist-1 group.

[0111] Experimental design: A 5-FU (purchased from Tianjin KingYork Pharmaceutical Co., Ltd., specification 10 mL / ampoule, 0.25 g / 10 mL) solution was used to induce a chemotherapy-induced diarrhea model in mice. Except for the normal control group which was intraperitoneally injected with normal saline, the other groups were treated with a single intraperitoneal injection of 5-FU for model establishment, and the dosing amount for model establishment was 350 mg / kg. The administration method for all groups was gavage. The normal control group and the model control group were gavaged with the lyophilization protectant; the positive control loperamide group was gavaged with 20 mg / kg loperamide (purchased from Janssen-Cilag Pharmaceutical Co., Ltd.); the Pdist-1 group was gavaged with the Bacteroides paraputrificus Pdist-1 bacterial suspension at a dose of 1×10 9 CFU / mouse. The overall experimental period was 9 days, denoted as D1 - D9. Continuous gavage administration was carried out for 5 days from D1 - D5, and a single 5-FU model establishment treatment was performed on D3. After the administration ended on D5, continuous observation was carried out for 4 days. The specific experimental grouping and dosing regimen are shown in Table 3.

[0112] Table 3 Experimental grouping and dosing regimen for Bacteroides paraputrificus Pdist-1 in treating 5-FU-induced diarrhea in mice

[0113]

[0114] Note: 5-FU: 5-fluorouracil; CFU: colony forming unit; d: day

[0115] Diarrhea observation and scoring: The mice were placed in a mouse cage lined with a clean filter paper, one mouse per cage. Hard feces and normal feces were regarded as 0 points; mild, slightly wet or soft feces were regarded as 1 point; moderate, wet feces, unformed feces and unclean perianal area were regarded as 2 points; severe, loose feces and severely unclean perianal area were regarded as 3 points. During the experimental period, the feces of the mice were observed and scored every day. The total diarrhea score was the sum of the daily diarrhea scores.

[0116] Body weight detection and body weight change rate: During the experimental period, the body weight of the mice was weighed every day, and the body weight change rate was calculated. The body weight change rate = (detected body weight - initial body weight) / initial body weight × 100%.

[0117] After the experiment, all the mice were dissected, and the entire cecum and colorectum were dissected together with the anus. The length of the colorectum of the mice was measured with a ruler with the end of the cecum as the zero point and the end of the rectum as the end point.

[0118] Experimental results: As Figure 4 shown, compared with the model control group, Pdist-1 had a significant improvement effect on diarrhea caused by 5-FU ( Figure 4 A), and the total diarrhea score was significantly reduced (P < 0.05) ( Figure 4 B). From the second day of modeling, except for the continuous weight gain in the normal control group, the body weights of the other groups gradually decreased, but the weight loss rate of the Pdist-1 group on D9 was significantly lower than that of the model control group (P < 0.01) ( Figure 4 C), that is, Pdist-1 had a significant improvement effect on the weight loss caused by 5-FU. In addition, after administration of 5-FU, it would cause a shortening of the colorectum length. The colorectum length of the model control group was significantly lower than that of the normal control group, while the colorectum length of the Pdist-1 group was significantly higher than that of the model control group ( Figure 4 D).

[0119] The above results indicate that the Bacteroides paraputrificus Pdist-1 of the present invention can significantly improve the symptoms of diarrhea, weight loss and colorectum shortening caused by the chemotherapeutic drug 5-FU.

[0120] Example 8: Improvement of the pathological damage of the colon in 5-FU-induced diarrhea mice by Bacteroides paraputrificus Pdist-1

[0121] After the animal experiment in Example 7, the middle segment of the colon of the mice was collected and fixed in 4% paraformaldehyde for 24 h. The fixed colon tissue was dehydrated, cleared, infiltrated with wax and embedded in turn. The embedded colon tissue wax blocks were sectioned with a thickness of 5 μm, and then spread and baked. The dry sections were stained with routine HE staining ( Figure 5 A). Observe its pathological changes under an optical microscope, score it according to Table 4, and calculate the total score of the pathological score (the sum of the scores of each index). The results are shown in Figure 5 B.

[0122] Table 4 Histopathological Scoring Indexes and Descriptions of Colon Tissue

[0123]

[0124]

[0125] Experimental Results:

[0126] As Figure 5 shown in Figure A, the colon structure of the normal control group was intact, and the mucosal layer, submucosal layer, muscular layer, and serosa layer were clearly visible; in the model control group, intestinal gland necrosis and dissolution were visible in the lamina propria of the colon, the number of goblet cells decreased, lymphocyte infiltration was present, the connective tissue in the submucosal layer was loose, and blood vessels were dilated; in the loperamide group, the colon structure was relatively intact, no obvious necrosis was seen in the mucosal epithelial cells, the number of goblet cells increased significantly, and only a small amount of lymphocyte infiltration was seen in the lamina propria; in the Pdist-1 group, the mucosal layer structure of the colon was relatively intact, no obvious necrosis was seen in the mucosal epithelial cells, and the number of goblet cells increased significantly compared with the model control group.

[0127] As Figure 5 shown in Figure B, obvious damage occurred in the colon of mice after 5-FU induction. The total pathological score of the model control group was significantly higher than that of the normal control group (P<0.01). After administration of Bacteroides paravulgatus Pdist-1, the total pathological score of the colon could be significantly reduced (P<0.05), and the colon damage was improved.

[0128] The above results indicate that Bacteroides paravulgatus Pdist-1 of the present invention can significantly improve the colon pathological damage caused by the chemotherapeutic drug 5-FU.

[0129] Example 9: Improvement of the Relative Transcription Levels of mRNA of IL-1β, TNF-α, and AQP8 in the Colon of Mice with Diarrhea Induced by 5-Fluorouracil by Bacteroides paravulgatus Pdist-1

[0130] After the animal experiment in Example 7 was completed, the middle segment of the colon of the mice was collected and stored in a -80°C refrigerator. Total RNA of the colon tissues of each group of mice was extracted according to the instructions of the reagent (ThermoFisher Scientific, catalog number 15596026) and reverse transcribed into cDNA, which was stored at -20°C for later use. The relative transcription levels of mRNA of the pro-inflammatory factors IL-1β, TNF-α, and aquaporin 8 (AQP8) genes in the colon of each group of mice were detected by qRT-PCR (the primer sequences are shown in Table 5). Reaction program: 95°C for 3 min, 95°C for 20 s, 60°C for 45 s, 72°C for 20 s, for a total of 39 cycles. Using 2 -ΔΔCTAnalysis was carried out by the method, and significant analysis of the data was performed using SPSS 24.0 statistical software. Each group of data was detected by One-way ANOVA (Fisher LSD for multiple comparisons), "*" indicates p < 0.05, and "**" indicates p < 0.01.

[0131] Table 5 Information of qRT-PCR primers

[0132]

[0133]

[0134] Experimental results:

[0135] As Figure 6 shown in A, compared with the normal control group, the relative transcriptional level of IL-1β mRNA in the model control group was significantly increased (P < 0.05), and after administration of Pdist-1, the relative transcriptional level of IL-1β mRNA could be significantly decreased (P < 0.01).

[0136] As Figure 6 shown in B, compared with the normal control group, the relative transcriptional level of TNF-α mRNA in the model control group was extremely significantly increased (P < 0.01), and after administration of Pdist-1, the relative transcriptional level of TNF-α mRNA could be significantly decreased (P < 0.01).

[0137] As Figure 6 shown in C, compared with the normal control group, the relative transcriptional level of AQP8 mRNA in the model control group was significantly decreased (P < 0.05). After administration of Pdist-1, the relative transcriptional level of AQP8 mRNA could be significantly increased (P < 0.05).

[0138] Thus, it can be seen that Bacteroides paravulgatus Pdist-1 of the present invention can improve diarrhea symptoms by inhibiting the expression of pro-inflammatory factors IL-1β and TNF-α and increasing the expression of aquaporin AQP8, and has an obvious therapeutic effect on chemotherapy-related diarrhea.

[0139] Example 10: Design and synthesis of specific primers

[0140] According to the whole-genome analysis results of Bacteroides paravulgatus Pdist-1, specific genomic fragments based on this strain were searched, specific primers were designed using Primer Premier 5, and primer synthesis was entrusted to Beijing Tsingke Biotechnology Co., Ltd. The primer information is shown in Table 6.

[0141] The method for screening specific fragments is as follows:

[0142] 1) First, obtain the gene sequences through conventional quality control, assembly, and annotation of the original genomic data as the input file. 2) Align the sequences in the input file with the NCBI nt library by default to query whether these sequences match the data in the database. If a certain sequence has no match in the database, it indicates that this fragment has strong specificity and is used as the result.

[0143] Table 6 Primer Information Table

[0144]

[0145] Example 11: Single Bacterium Culture, Single Bacterium Whole Genome DNA Extraction, and Fecal Genome DNA Extraction

[0146] 1) Strain culture: For whole genome DNA extraction.

[0147] Inoculate the preserved Parabacteroides distasonis Pdist-1 at an inoculation amount of 2 v / v% into the three-component liquid medium and anaerobically culture at 37°C until the late logarithmic growth phase.

[0148] 2) Use a bacterial liquid DNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd., B518255) and operate according to the kit's instructions to extract the whole genome DNA of the bacterial liquid for specific primer screening.

[0149] 3) Use a fecal DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP328-02) and operate according to the kit's instructions to extract the fecal genome DNA for specific primer screening.

[0150] Example 12: Screening Specific Primers for Detecting Parabacteroides distasonis Pdist-1

[0151] To screen primers that can specifically amplify the target strain in feces, PCR was used to amplify normal mouse feces. Since there are individual differences in mice and the intestinal flora composition also varies, 10 normal mouse fecal samples were selected for specific screening of the designed primers to enhance reliability. To reduce the workload, 2 fecal DNA samples were randomly selected for preliminary screening of each primer. After no obvious background amplification, 10 fecal DNA samples were used for re-screening of each primer, and the primers with the strongest specificity were selected.

[0152] 1) Sample source: Single bacterium whole genome DNA extraction in Example 11 and 2 or 10 fecal genome DNA extractions.

[0153] 2) PCR detection:

[0154] ① The primer information is shown in Table 6 in detail, and the primer sequence information is shown in Table 7 in detail:

[0155] Table 7 Primer Sequence Information

[0156]

[0157]

[0158] ②PCR Amplification System (total volume is 25 μl): 1.1×T3 Super PCR Mix (Beijing Tsingke New Industry Biotechnology Co., Ltd., TSE030) 22 μl, 1 μl each of 10 μmol / L upstream and downstream primers, 1 μl of template DNA, which are added to the corresponding PCR tubes respectively.

[0159] ③PCR Reaction Program: Place the constructed reaction system on the PCR instrument and set the corresponding amplification program as follows: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 50 s, for a total of 39 cycles; 72°C for 2 min; store at 4°C.

[0160] 3) Results of Agarose Gel Electrophoresis:

[0161] As Figures 7 - 8 shown, in each gel photo, the primer numbers are marked above the photo. Among the sample numbers, M: Maker; NC: Negative Control (normal saline); PC: Positive Control (genomic DNA of single bacterium Pdist-1); 1 - 10 (fecal sample numbers): Total DNA extracted from feces. As Figure 7 , primers C and E meet the requirements that there is no band in NC, a single band in PC, and no bands in fecal DNA samples 1 and 6, and the verification is successful, so they are used for rescreening. The rescreening results are as Figure 8 shown. Primer C does not meet the requirement of a single band in PC. The specificity effects of primers E and F are better, and the specificity of primer F is the most significant, meeting the requirements that there is no band in NC, a single band in PC, and no bands in fecal DNA samples 1 - 10. Subsequently, primer F is used for the experiment (primer F was not screened initially and directly used 10 fecal samples for the experiment).

[0162] Example 13: PCR Identification and Plasmid Construction

[0163] 1) Sequence Sequencing Identification: Entrust the PCR product amplified from the target single bacterium DNA sample corresponding to primer F screened in Example 12 to Beijing Tsingke Biotechnology Co., Ltd. for sequencing, and compare the PCR sequencing results with the whole genome sequencing sequence. After determining that the results are consistent, plasmid construction is carried out, indicating that the amplification results meet the expectations.

[0164] 2) Plasmid Construction:

[0165] ①According to the primer sequence and the target fragment sequence (the sequence of the amplified fragment), Beijing Tsingke Biotechnology Co., Ltd. was commissioned to synthesize plasmids. The target vector was pMD-19T, Amp + resistance. The amplified fragment was inserted into the target vector to obtain a recombinant plasmid containing the target DNA fragment, and 4 μg plasmid samples were obtained for each recombinant plasmid.

[0166] ②Take 4 μg of the synthesized plasmid sample (=4000 ng, briefly centrifuge at low speed before use) and add 40 μl of sterile double-distilled water to prepare a 100 ng / μl plasmid (for plasmid information, see Table 8). Calculate the copy number. The copy number calculation method is as follows:

[0167]

[0168] Table 8 Plasmid and primary screening primer information

[0169]

[0170] 3) PCR identification:

[0171] ①Sample source: Single-bacterium whole-genome DNA extraction and synthesized plasmid in Example 12.

[0172] ②PCR detection: Primer information, PCR amplification system, and PCR reaction program are the same as in step 2) of Example 13.

[0173] ③Agarose gel electrophoresis results:

[0174] As Figure 9 shown, in each gel photo, the primer number is marked above the photo. Among the sample numbers, M: Maker; NC: negative control; PC: positive control (synthesized plasmid); 1: single-bacterium DNA. The band lengths of PC (synthesized plasmid) and the samples after amplification are the same, and there is no band in NC (negative control), indicating successful plasmid synthesis verification. Each sample was amplified with the universal primer G and subjected to 16S sequencing. The sequencing results showed that the target strain was obtained and the samples were free of contamination.

[0175] Example 14: qPCR detection of specific primers for Parabacteroides distasonis Pdist-1 in mouse feces

[0176] After screening out the specific primers, it is necessary to detect the background amplification of the strain-specific primers in mouse feces. If the viable cell count of the background amplification is greater than the animal dosing dose, the method sensitivity is insufficient and the primers need to be re-screened. Therefore, using the primers (primer F) passed through the re-screening in Example 12, the sensitivity of the method was detected with fecal DNA (negative control), fecal + DNA of different concentrations of plasmids (experimental group), and each single-bacterium plasmid (positive control group) as templates, and the primers were finally determined.

[0177] 1) Sample treatment:

[0178] ① Source of the sample: Extraction of fecal genomic DNA in Example 12.

[0179] ② Grouping and mixing of samples: Different concentrations of plasmids were added to the fecal DNA to verify the accuracy of the qPCR method. Each DNA / plasmid sample was grouped and combined according to Table 9 for qPCR detection.

[0180] Table 9 Experimental grouping for method establishment

[0181]

[0182] 2) qPCR detection:

[0183] ② Information on plasmids and primers is shown in Table 6.

[0184] ② qPCR amplification system (total volume is 10 μl): 5 μl of SsoFast Eva Green (Bio-Rad Laboratories (Shanghai) Co., Ltd., 1725201), 2.25 μl of ddH2O, 0.25 μl of BSA (Baori Biotechnology (Beijing) Co., Ltd., 2320), 0.25 μl each of 10 μmol / L upstream and downstream primers, 2 μl of template DNA, which were added to the corresponding qPCR tubes respectively.

[0185] ③ qPCR reaction program: The constructed reaction system was placed on a qPCR instrument, and the corresponding amplification program was set as follows: 95°C for 2 min; 95°C for 15 s, 56°C for 15 s, 72°C for 10 s, for a total of 45 cycles; 72°C for 5 min; Melt Curve from 65°C to 95°C with an increment of 0.5°C, END.

[0186] ④ Standard curve establishment: The plasmid sample was taken and diluted 10-fold according to DNA:ddH2O = 5:45, so that the DNA was diluted to 10 10 、10 9 、10 8 、10 7 、10 6 、10 5 、10 4 、10 3 、10 2 copy / μl, and placed on ice for standby; loaded and detected according to the qPCR amplification system and qPCR reaction program.

[0187] ⑤ Sample detection: The samples in Table 6 were taken and loaded and detected according to the qPCR amplification system and qPCR reaction program.

[0188] Results: The results are as Figure 10 shown in A: R2 >0.99, 80% < E < 120%, the standard curve was successfully established. As Figure 10 shown in B, the background value of Parabacteroides distasonis Pdist-1 was relatively low, at 10 4 -10 6 copies / μl. The bacterial content amplified from the DNA of the experimental group (feces + plasmids at different concentrations) was basically the same as that amplified from the DNA of the positive control group (plasmids at different concentrations), indicating that the method was successfully established and this primer could be used to detect the content of Parabacteroides distasonis Pdist-1 in fecal samples.

[0189] Thus, it can be seen that the genomic fragment corresponding to primer F is a specific fragment of Parabacteroides distasonis Pdist-1 and can be used to distinguish and identify Parabacteroides distasonis Pdist-1.

[0190] The sequence of the genomic fragment corresponding to primer F is as follows (SEQ ID NO.15):

[0191] AGAGTCGTTGCTCCTGGTCTTTTTCAACAGTTGATTAAAAAATTTCAAAATTATGATGTCAAGGTGGATAAAATATTATCAGTGTTTACTCCTAAAACAAAAGAAGCACTTTACTCTTTATTGAACGAACCGCTGAACGAACAAATGCCAAATCA

[0192] As is known by common technical knowledge, the present invention can be implemented by other embodiments without departing from its spiritual essence or essential features. Therefore, the above-disclosed embodiments are illustrative in all aspects and not exclusive. All changes within the scope of the present invention or within the scope equivalent to the present invention are encompassed by the present invention.

Claims

1. A primer pair capable of amplifying a genomic fragment as shown in SEQ ID NO.15 or a sub-fragment thereof with a length greater than 50 nt.

2. The primer pair according to claim 1, wherein In the primer pair, the sequences of the downstream primers complementary to the template are as shown in SEQ ID NO.11 and SEQ ID NO.12 respectively; or In the primer pair, the primer sequences are as shown in SEQ ID NO.11 and SEQ ID NO.12 respectively.

3. A primer combination, which is a combination of any one, any two of the primer pairs described in any one of claims 1-2 and a second primer pair, a third primer pair; In the second primer pair, the sequences of the downstream primers complementary to the template are as shown in SEQ ID NO.5 and SEQ ID NO.6 respectively; and In the third primer pair, the sequences of the downstream primers complementary to the template are as shown in SEQ ID NO.9 and SEQ ID NO.10 respectively.

4. The primer combination according to claim 3, characterized in that, In the second primer pair, the primer sequences are as shown in SEQ ID NO.5 and SEQ ID NO.6 respectively; and In the third primer pair, the primer sequences are as shown in SEQ ID NO.9 and SEQ ID NO.10 respectively.

5. A kit containing the primer pair described in any one of claims 1 or 2 or the primer combination described in claims 3 or 4.

6. A method for non-diagnostic detection of Parabacteroides distasonis with the preservation number CCTCC NO: M20222033; The method is: using the primer pair described in claim 1 or 2, the primer combination described in claim 3 or 4, or the kit described in claim 5 to detect the genomic template in the sample to be tested.

7. The method according to claim 6, characterized in that, By PCR method, detecting the electrophoresis picture of the amplification product to judge the microorganism contained in the sample to be detected; or By qPCR method, judging the microorganism contained in the sample to be detected.

8. The use of a biological material in medical-related operations, and the use is as follows U1, U2 or U3: U1: The use of the genomic fragment as shown in SEQ ID NO.15 or a sub-fragment thereof with a length greater than 50 nt, the primer pair described in claim 1 or 2, the primer combination described in claim 3 or 4, or the kit described in claim 5 in the preparation of a preparation for evaluating the ability or state of a subject to tolerate, resist, prevent or relieve a disease or sub-health; The subject is selected from humans, dogs and mice; The ability or state of tolerating, resisting, preventing or relieving a disease or sub-health is selected from any one, any two, any three or all four of the following four aspects: The ability or state of tolerating, resisting, preventing or relieving diarrhea; The ability or state of improving intestinal antioxidant capacity; Reducing intestinal damage caused by chemotherapeutic drugs; The ability or state of tolerating, resisting, preventing or relieving a disease or sub-health by reducing the gene expression levels of IL-6 and / or TNF-α; U2: Use of the primer pair according to claim 1 or 2, the primer combination according to claim 3 or 4, or the kit according to claim 5 in the preparation of a preparation for evaluating the therapeutic effect of probiotics, wherein the active bacteria in the probiotics are Parabacteroides distasonis with the microbial deposit number CCTCC NO: M20222033; and U3: Use of the primer pair according to claim 1 or 2, the primer combination according to claim 3 or 4, or the kit according to claim 5 in the preparation of a preparation for formulating or adjusting a treatment plan for cancer patients.

9. The application according to claim 8, wherein In U1, the diarrhea is chemotherapy-induced diarrhea; or the diarrhea is caused by any one, any two, any three, or all four of Salmonella paratyphi B, Staphylococcus aureus, Yersinia enterocolitica, and Clostridium difficile; or In U1, the method for realizing the use is: qualitatively or quantitatively detecting Parabacteroides distasonis with the microbial deposit number CCTCC NO: M20222033 in the intestinal contents or feces of the subject; or In U2, the method for realizing the use is: qualitatively or quantitatively detecting Parabacteroides distasonis with the microbial deposit number CCTCC NO: M20222033 in the intestinal contents or feces of the subject; or In U3, the method for realizing the use is: qualitatively or quantitatively detecting Parabacteroides distasonis with the microbial deposit number CCTCC NO: M20222033 in the intestinal contents or feces of the subject.

10. The application according to claim 8 or 9, characterized in that In U1, the chemotherapy drugs are selected from 5-fluorouracil, capecitabine, gemcitabine, methotrexate, pemetrexed, cytarabine, doxorubicin, epirubicin, actinomycin D, doxorubicin, daunorubicin, paclitaxel, docetaxel, albumin-bound paclitaxel, cisplatin, carboplatin, nedaplatin, oxaliplatin, lobaplatin, cyclophosphamide, nitrogen mustard, carmustine, camptothecin, hydroxycamptothecin, topotecan, irinotecan, and their derivatives.