Recombinant klebsiella pneumoniae with high yield of 3-hydroxypropionic acid as well as construction method and application of recombinant klebsiella pneumoniae
By introducing the kgsadh gene into Klebsiella pneumoniae and knocking out the relevant enzyme genes, combining with plasmid vector optimization, a recombinant strain with high yield of 3-hydroxypropionate was constructed, which solved the problem of 3-HPA accumulation and by-product effects in Klebsiella pneumoniae, and achieved a significant increase in 3-HP yield.
Patent Information
- Application Number
- CN202510514869.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-07-25
AI Technical Summary
In the prior art, Klebsiella pneumoniae has an imbalance in the activity of aldehyde dehydrogenase in the synthesis of 3-hydroxypropionic acid, resulting in the accumulation rate of 3-HPA faster than the consumption rate, affecting microbial activity. At the same time, the production of by-products such as lactic acid and 1,3-PDO seriously affects glycerol metabolic shunt, limiting the yield of 3-HP.
By introducing the kgsadh gene encoding α-ketoglutarate semialdehyde dehydrogenase, knocking out the dhaT gene of 1,3-propanediol dehydrogenase, the ldh gene of L-lactate dehydrogenase and the ldhA gene of 2-hydroxypropanate dehydrogenase, the recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropanoic acid, and optimizing the organic nitrogen source and glycerol concentration, a new recombinant plasmid vector p3tac-kgsadh was designed to enhance the expression level of aldehyde dehydrogenase.
The 3-hydroxypropionic acid yield of the recombinant strain was significantly improved. Especially when corn slurry was used as the organic nitrogen source and glycerol concentration was controlled at 15g/L-25g/L in a 5L bioreactor, the 3-HP yield reached 110.70g/L, solving the problem of insufficient yield in the prior art.
Smart Images

Figure CN120366356A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and particularly to a recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropionic acid, a construction method thereof and an application thereof. Background Art
[0002] 3-Hydroxypropionic acid (3-HP), scientific name: 3-hydroxypropionic acid, is an important compound in the C-3 platform. It is viscous, colorless and odorless, temperature-sensitive, and soluble in many organic substances such as water, ethanol, and ether. As an intermediate in the C-3 platform, 3-HP can be used to synthesize a variety of important bulk chemicals, such as malonic acid, 1,3-propanediol, acrylamide, propiolactone, and acrylic acid. Therefore, 3-HP can be used as a raw material for the development of a variety of important chemicals or biodegradable new materials (polytrimethylene terephthalate). Currently, 3-HP is industrially obtained by chemical synthesis methods, such as hydrolysis method, hydration method, and oxidation method, etc. As the main synthesis method of 3-HP, the chemical synthesis method has difficulties in separation and purification and serious environmental pollution, which hinders its large-scale production. On the contrary, biosynthesis of 3-HP has the characteristics of low cost, easy conversion, and environmental friendliness. Klebsiella pneumoniae can utilize glycerol to enter the non-CoA-dependent pathway to directly synthesize 3-hydroxypropionic acid, and has the ability to autonomously synthesize coenzyme B 12 Therefore, Klebsiella pneumoniae is a natural dominant strain for synthesizing 3-HP.
[0003] Klebsiella pneumoniae uses glycerol as the sole carbon source, and uses glycerol dehydratase GDHt (encoded by dhaB) to catalyze the synthesis of 3-hydroxypropanal (3-HPA). 3-HPA uses aldehyde dehydrogenase ALDH (encoded by puuC) to catalyze the synthesis of 3-HP. Since the activity of GDHt in Klebsiella pneumoniae is higher than that of ALDH, the accumulation rate of 3-HPA is faster than the consumption rate, and 3-HPA is toxic to microorganisms, so it will affect the microbial activity. To improve the yield of 3-HP, it is necessary to increase the expression level of aldehyde dehydrogenase. Exogenous introduction of aldehyde dehydrogenase can efficiently improve the ability of Klebsiella pneumoniae to synthesize 3-hydroxypropionic acid. Promoters and ribosome binding sites are responsible for transcription and translation respectively. By optimization, the transcription and translation levels of plasmid vectors can be improved, thereby increasing the expression level of aldehyde dehydrogenase. During the synthesis of 3-hydroxypropionic acid by Klebsiella pneumoniae, many by-products will be produced. These by-products mainly come from the oxidation pathway and reduction pathway in the glycerol pathway. A large amount of lactic acid will be produced in the oxidation pathway, and a large amount of 1,3-PDO will be produced in the reduction pathway, seriously affecting the glycerol metabolism shunt. Therefore, the present invention provides a new method for constructing a recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropionic acid. Summary of the Invention
[0004] The object of the present invention is to provide a recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropionic acid, its construction method and application, so as to solve the problems existing in the above-mentioned prior art. The ability of the recombinant Klebsiella pneumoniae constructed by the present invention to ferment and produce 3-hydroxypropionic acid is significantly improved. By using it for the fermentation production of 3-hydroxypropionic acid, the yield of 3-hydroxypropionic acid can be greatly increased.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides a method for constructing a recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropionic acid, including using Klebsiella pneumoniae as the starting strain, introducing the kgsadh gene encoding α-ketoglutaric semialdehyde dehydrogenase and knocking out one or more of the dhaT gene encoding 1,3-propanediol dehydrogenase, the ldh gene encoding L-lactic acid dehydrogenase, the ldhA gene encoding 2-hydroxypropionic acid dehydrogenase, and the yqhD gene encoding alcohol dehydrogenase to construct a recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropionic acid.
[0007] Optionally, the NCBI accession number of the kgsadh gene is AB241137.1, the nucleotide sequence of the dhaT gene is as shown in SEQ ID NO.49, the nucleotide sequence of the ldh gene is as shown in SEQ ID NO.50, the nucleotide sequence of the ldhA gene is as shown in SEQ ID NO.51, and the nucleotide sequence of the yqhD gene is as shown in SEQ ID NO.52.
[0008] Optionally, the kgsadh gene is introduced through a recombinant plasmid;
[0009] The recombinant plasmid is constructed by using pET28a as the backbone, replacing the original promoter with 3 tac promoters, replacing the original RBS sequence with the RBSIII sequence, and replacing the monoclonal site MCS with the kgsadh gene;
[0010] The RBSIII sequence is TAAGGAGG.
[0011] The present invention also provides a recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropionic acid obtained according to the above construction method.
[0012] The present invention also provides the application of the above recombinant Klebsiella pneumoniae in the production of 3-hydroxypropionic acid.
[0013] The present invention also provides a method for producing 3-hydroxypropionic acid, including the step of fermenting and producing by using the above recombinant Klebsiella pneumoniae.
[0014] Optionally, the organic nitrogen source for the fermentation is corn steep liquor.
[0015] Optionally, the concentration of the corn steep liquor is 3 g / L.
[0016] Optionally, during the fermentation process, the glycerol concentration is controlled to be 15 g / L - 25 g / L.
[0017] The present invention discloses the following technical effects:
[0018] By changing the promoter and ribosome binding site on the pET28a plasmid vector, the present invention designed and constructed a new recombinant plasmid vector p3tac. The expression vector p3tac-kgsadh carrying the kgsadh gene was transferred into wild-type Klebsiella pneumoniae to obtain the recombinant strain Kp2. By analyzing the metabolic principle of Klebsiella pneumoniae, the key metabolic pathways of the lactic acid synthesis pathway and the 1,3-propanediol synthesis pathway were inhibited, and the expression vector p3tac-kgsadh carrying the kgsadh gene was transferred into the gene knockout Klebsiella pneumoniae, and four recombinant strains, Kp3, Kp4, Kp5, and Kp6, were designed and constructed. Among them, Kp3 knocked out dhaT, Kp4 knocked out dhaT and ldh, Kp5 knocked out dhaT, ldh, and ldhA, and Kp6 knocked out dhaT, ldh, ldhA, and yqhD. Compared with the initial strain Kp, the 3-HP of the recombinant strains was significantly improved, and the 3-HP yield of the recombinant strain Kp6 reached 6.77 g / L. By controlling the organic nitrogen source and the glycerol concentration during the fermentation process, it was determined that when the organic nitrogen source was 3 g / L corn steep liquor or the glycerol concentration was 15 g / L - 25 g / L, the 3-HP yield of the recombinant strain Kp4 was the highest in a 5 L bioreactor. Especially when the glycerol concentration was controlled to be 15 g / L - 25 g / L, the yield reached 110.70 g / L. The present invention provides a new strain selection for high-yield 3-hydroxypropionic acid. Brief Description of the Drawings
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0020] Figure 1 Schematic diagram of the p3tac-kgsadh expression cassette;
[0021] Figure 2 Schematic diagram of Klebsiella pneumoniae;
[0022] Figure 3 Plasmid map of pTargetF;
[0023] Figure 4 Fermentation results of 3-HP produced by the recombinant bacterium after 2 days of fermentation;
[0024] Figure 5 3-HP production of different recombinant strains;
[0025] Figure 6 Results of 3-HP production by recombinant bacterium Kp4 at the 5 L tank level under different organic nitrogen source conditions;
[0026] Figure 7 Results of 3-HP production by recombinant bacterium Kp4 at the 5 L tank level under different glycerol concentration conditions during the fermentation process. Detailed implementation manners
[0027] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0028] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0029] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0030] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.
[0031] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.
[0032] By changing the promoter and ribosome binding site on the pET28a plasmid vector, the present invention designed and constructed two new recombinant plasmid vectors, p1tac-kgsadh and p3tac-kgsadh. The expression vector p3tac-kgsadh ( Figure 1 ) carrying the kgsadh gene was transferred into wild-type Klebsiella pneumoniae to obtain the recombinant strain Kp2. The metabolic principle of Klebsiella pneumoniae was analyzed ( Figure 2 ), the key metabolic pathways of the lactic acid synthesis pathway and the 1,3-propanediol synthesis pathway were inhibited, and the expression vector p3tac-kgsadh carrying the kgsadh gene was transferred into the gene-knocked-out Klebsiella pneumoniae. Four recombinant strains were designed and constructed to improve the yield of 3-HP produced by Klebsiella pneumoniae through fermentation. After optimizing the fermentation method, replacing the organic nitrogen source with 3 g / L corn steep liquor and controlling the glycerol concentration in the fermentation process at 15 g / L - 25 g / L, the yield of 3-HP produced by Klebsiella pneumoniae fermentation was further increased. The specific operation is shown in the following examples.
[0033] The present invention relates to the following media:
[0034] Screening medium: 50 μg / mL kanamycin sulfate, 50 μg / mL streptomycin sulfate, 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, 20 g / L agar powder.
[0035] LB liquid medium: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride. Kanamycin sulfate or streptomycin sulfate was added to the resistance medium as needed to a final concentration of 50 μg / mL.
[0036] Klebsiella pneumoniae seed medium: 20 g / L glycerol, 3 g / L yeast extract, 4 g / L (NH4)2SO4, 3 g / L K2HPO4, 1 g / L KH2PO4, 0.5 g / L MgSO4, 0.1 g / L CaCO3, and 1.25 mL trace elements, with a final concentration of 50 μg / mL kanamycin sulfate.
[0037] Klebsiella pneumoniae fermentation medium: 40 g / L glycerol, 3 g / L yeast extract, 4 g / L (NH4)2SO4, 3 g / L K2HPO4, 1 g / L KH2PO4, 0.5 g / L MgSO4, 0.1 g / L CaCO3, and 1.25 mL trace elements, with a final concentration of 50 μg / mL kanamycin sulfate and a final concentration of 96 μg / mL IPTG.
[0038] Trace elements: 0.7 g / L ZnCl2, 10 g / L FeSO4·7H2O, 1 g / L MnCl2·4H2O, 0.2 g / L CuCl2·2H2O, 2 g / L CoCl2·6H2O, 0.6 g / L H3BO3, 0.3 g / L NiCl2·6H2O, 0.4 g / L Na2MoO4·2H2O.
[0039] Construction of the recombinant plasmid in Example 1
[0040] In this example, the NCBI accession number of the α-ketoglutaric semialdehyde dehydrogenase encoding gene kgsadh is AB241137.1. The nucleotide sequence of the 1,3-propanediol dehydrogenase encoding gene dhaT is as shown in SEQ ID NO.49. The nucleotide sequence of the L-lactate dehydrogenase encoding gene ldh is as shown in SEQ ID NO.50. The nucleotide sequence of the 2-hydroxypropionate dehydrogenase encoding gene ldhA is as shown in SEQ ID NO.51. The nucleotide sequence of the alcohol dehydrogenase encoding gene yqhD is as shown in SEQ ID NO.52.
[0041] 1. Construction of the recombinant plasmid p1tac-kgsadh
[0042] The recombinant plasmid p1tac-kgsadh uses pET28a as the backbone, replaces the original promoter with the tac promoter and the original RBS sequence with the RBSIII sequence. The multiple cloning site MCS is replaced with the kgsadh gene.
[0043] Using tac-1-F / tac-1-F2 / tac-1-F3 and tac-1-R as primers, and kgsadh (gene synthesis by Sangon Biotech (Shanghai) Co., Ltd.) as the template, kgsadh was amplified. Using tac-1-GJ-F and tac-1-GJ-R as primers, and pET28a as the template, the pET28a backbone was amplified.
[0044] Using the -Basic Seamless Cloning and Assembly Kit of TransGen Biotech Co., Ltd., the linearized pET28a plasmid and the kgsadh expression cassette were subjected to seamless cloning to obtain the recombinant vector, which was then transformed into Escherichia coli DH5α competent cells. Screening was performed through a kanamycin-resistant plate, and verification was carried out through colony PCR and sequencing to obtain the recombinant plasmid p1tac-kgsadh.
[0045] 2. Construction of the recombinant plasmid p3tac-kgsadh
[0046] The recombinant plasmid p3tac-kgsadh uses p1tac-kgsadh as the backbone and increases the number of tac promoters to 3.
[0047] Using tac-3-F / tac-3-F1 / tac-3-F2 and tac-1-R as primers and p1tac-kgsadh as the template, the kgsadh expression cassette was amplified. Using tac-3-GJ-F and tac-3-GJ-R as primers and p1tac-kgsadh as the template, the p1tac-kgsadh backbone was amplified.
[0048] Using the -Basic Seamless Cloning and Assembly Kit from TransGen Biotech Co., Ltd., Beijing, the linearized p1tac-kgsadh plasmid and the kgsadh expression cassette were seamlessly cloned to obtain a recombinant vector, which was then transformed into Escherichia coli DH5α competent cells. Screening was performed using a kanamycin-resistant plate, and verification was carried out by colony PCR and sequencing to obtain the recombinant plasmid p3tac-kgsadh.
[0049] 3. Recombinant plasmid pTarget-dhaT
[0050] The recombinant plasmid pTarget-dhaT uses pTargetF (plasmid map as Figure 3 shown, nucleotide sequence as shown in SEQ ID NO.48) as the backbone and inserts the upstream and downstream homologous arm genes of dhaT by homologous recombination.
[0051] Using dhaT-UHA-F1 and dhaT-UHA-R1 as primers and the genomic DNA of Klebsiella pneumoniae (Kp) (NZ_JYBC00000000.1) as the template, the upstream homologous arm gene of dhaT was amplified. Using dhaT-DHA-F1 and dhaT-DHA-R1 / dhaT-DHA-R2 / dhaT-DHA-R3 as primers and the Kp genomic DNA (NZ_JYBC00000000.1) as the template, the downstream homologous arm gene of dhaT was amplified. Using Target-GJ-F1 and Target-GJ-R1 as primers and pTargetF as the template, the pTargetF backbone was amplified.
[0052] Using the -Basic Seamless Cloning and Assembly Kit was used to perform seamless cloning on the linearized pTargetF plasmid and the upstream and downstream homologous arm genes of dhaT. The resulting recombinant vector was then transformed into competent Escherichia coli DH5α cells. The recombinant plasmid pTarget-dhaT was obtained through screening on a kanamycin-resistant plate and verified by colony PCR and sequencing.
[0053] 4. Recombinant plasmid pTarget-ldh
[0054] The recombinant plasmid pTarget-ldh uses pTargetF as the backbone and inserts the upstream and downstream homologous arm genes of ldh through homologous recombination.
[0055] Using ldh-UHA-F1 and ldh-UHA-R1 as primers and the DNA of Kp genome (NZ_JYBC00000000.1) as the template, the upstream homologous arm gene of ldh was amplified. Using ldh-DHA-F1 and ldh-DHA-R1 / ldh-DHA-R2 / ldh-DHA-R3 as primers and the DNA of Kp genome (NZ_JYBC00000000.1) as the template, the downstream homologous arm gene of ldh was amplified. Using Target-GJ-F1 and Target-GJ-R1 as primers and pTargetF as the template, the pTargetF backbone was amplified.
[0056] Using the -Basic Seamless Cloning and Assembly Kit, seamless cloning was performed on the linearized pTargetF plasmid and the upstream and downstream homologous arm genes of ldh. The resulting recombinant vector was then transformed into competent Escherichia coli DH5α cells. The recombinant plasmid pTarget-ldh was obtained through screening on a kanamycin-resistant plate and verified by colony PCR and sequencing.
[0057] 5. Recombinant plasmid pTarget-ldhA
[0058] The recombinant plasmid pTarget-ldhA uses pTargetF as the backbone and inserts the upstream and downstream homologous arm genes of ldhA through homologous recombination.
[0059] Using ldhA-UHA-F1 and ldhA-UHA-R1 as primers and the DNA of Kp genome (NZ_JYBC00000000.1) as a template, the homologous arm gene on ldhA was amplified. Using ldhA-DHA-F1 and ldhA-DHA-R1 / ldhA-DHA-R2 / ldhA-DHA-R3 as primers and the DNA of Kp genome (NZ_JYBC00000000.1) as a template, the homologous arm gene below ldhA was amplified. Using Target-GJ-F1 and Target-GJ-R1 as primers and pTargetF as a template, the pTargetF backbone was amplified.
[0060] Using the -Basic Seamless Cloning and Assembly Kit of TransGen Biotech Co., Ltd., Beijing, the linearized pTargetF plasmid and the homologous arm genes above and below ldhA were subjected to seamless cloning to obtain a recombinant vector, which was then transformed into competent Escherichia coli DH5α cells. Screening was carried out through a kanamycin-resistant plate, and verification was performed through colony PCR and sequencing to obtain the recombinant plasmid pTarget-ldhA.
[0061] 6. Recombinant plasmid pTarget-yqhD
[0062] The recombinant plasmid pTarget-yqhD uses pTargetF as the backbone and inserts the homologous arm genes upstream and downstream of yqhD by homologous recombination.
[0063] Using yqhD-UHA-F1 and yqhD-UHA-R1 as primers and the DNA of Kp genome (NZ_JYBC00000000.1) as a template, the homologous arm gene on yqhD was amplified. Using yqhD-DHA-F1 and yqhD-DHA-R1 / yqhD-DHA-R2 / yqhD-DHA-R3 as primers and the DNA of Kp genome (NZ_JYBC00000000.1) as a template, the homologous arm gene below yqhD was amplified. Using Target-GJ-F1 and Target-GJ-R1 as primers and pTargetF as a template, the pTargetF backbone was amplified.
[0064] Using the - Basic Seamless Cloning and Assembly Kit, which seamlessly clones the linearized pTarget plasmid and the upstream and downstream homologous arm genes of yqhD to obtain a recombinant vector. Then, it transforms Escherichia coli DH5α competent cells, screens through a kanamycin-resistant plate, and verifies by colony PCR and sequencing to obtain the recombinant plasmid pTarget-yqhD.
[0065] In this example, the PCR amplification system during the construction of each recombinant plasmid is shown in Table 1, and the seamless cloning system is shown in Table 2. The reaction procedure for PCR amplification is as follows: pre-denaturation at 95°C for 5 min - 10 min; denaturation at 95°C for 15 s - 20 s; annealing at 60°C for 15 s - 20 s; extension at 72°C for 1 min / kb; 5 cycles; denaturation at 95°C for 15 s - 20 s; annealing at 57°C for 15 - 20 s; extension at 72°C for 1 min / kb; 15 cycles; denaturation at 95°C for 15 s - 20 s; annealing at 55°C for 15 - 20 s; extension at 72°C for 1 min / kb; 11 cycles; finally, extension at 72°C for 5 min - 10 min; cool and store at 10°C or 20°C for 5 min.
[0066] Table 1 PCR Amplification System
[0067] Component Volume Phanta Max Super-Fidelity DNA Polymeras 1 μL 2x Phanta Max Buffer 25 μL dNTP Mix 1 μL Primer F 2 μL Primer R 2 μL Gene template 2 μL Ultra-pure water 17 μL
[0068] Table 2 Seamless Cloning System
[0069] Component Volume 2×Basic Assembly Mix 5 μL Linearized plasmid backbone 1 μL Inserted gene fragment 4 μL
[0070] In this example, the primers used in the construction process are shown in Table 3, and the gene insertion situations of each recombinant plasmid are shown in Table 4.
[0071] Table 3 Primer Names
[0072]
[0073]
[0074]
[0075] Table 4 Inserted Sequences in Each Recombinant Plasmid
[0076]
[0077]
[0078]
[0079] SEQ ID NO.48 (Nucleotide Sequence of pTargetF):
[0080]
[0081] SEQ ID NO.49 (Nucleotide sequence of the 1,3 - propanediol dehydrogenase - encoding gene dhaT):
[0082]
[0083] SEQ ID NO. 50 (Nucleotide sequence of the L-lactate dehydrogenase-encoding gene ldh):
[0084] ATGCACACCAAAGCCCGTAAAGTGATGATTATTGGCGCCGGCAATGTCGGCGCGTCGGCGGCCTACGCCCTGCTCAACCAGAGCATTTGCGAGGAGCTGATCCTCGTCGACCTTAACCAACAGCGCGCTGAGGCCCACGCTCAGGACCTGAGCGACGCCGCGGCCTACCTGCCGGGGATGATGACCATCTCCACCCGCGAGGCCAGCGACTGCGCCGATGTCGATATCGCGGTGATCACCGTCTCCGGCGGCGCGCTGCGCCCCGGCCAGAGCCGGCTGGATGAACTGACCTCCACCGCGAAGATTGTGAAGAGCATTGTGCCGACGATGATGGCCAACGGATTTAACGGCATCTTTCTGGTGGCCACCAACCCCTGCGACATCATCACCTGGCAGGTATGGCAGCTTTCCGGCCTGCCGCGCAGCCAGGTGCTGGGCACCGGCGTCTGGCTGGATACCACCCGCCTGCGTCGCCTGCTGGCGCAGGAACTGGAGATTGGCGCCCAGAGCATCGACGCCTTTATCCTCGGCGAGCATGGCGATACCCAGTTTCCGGTGTGGTCGCACTCCTCGGTATATGGCACGCCAATCGCCGACCTCTACCAGCAGCGCACCGGCCTGCCGCTCGATCGCGAGGCGATGGCTGACAAAGTGCGCAAGCTGGGATTTGAGATCTACGCCGGCAAAGGCTGCACCGAATATGGCGTGGCAGGGACCATCGCCGAGATCTGCCGCAATATCTTCACCGGCAGCCACCGCGCGCTGGCGGTCTCCTGCATTCTTGACGGCGAGTACGGGGTCAGCGGCGCGGCGGCTGGGGTGCCGGCGGTGCTGGCCCAGGGTGGCGTGAAGCAGATCATTGAACTGCAGCTGGCCGGCGAAGAGCAGGCGAAGTTCAGCCAGTCGATCGAGGTGATCAAGGCCAATATCGCCCGTCTGCCCTGA;
[0085] SEQ ID NO.51 (Nucleotide sequence of the ldhA gene encoding 2-hydroxypropionate dehydrogenase):
[0086] ATGAAAATCGCGGTTTATAGTACGAAGCAGTACGATAAAAAGTACCTGCAGCACGTTAATGATGCATACGGCTTTGAACTGGAATTCTTCGATTTCCTGCTGACAGCGAAGACTGCCAAAACCGCCAACGGTTGCGAAGCGGTATGTATCTTCGTCAATGACGACGGCAGCCGCCCGGTGCTGGAAGAGCTGAAGGCCCACGGGGTGAAATATATCGCCCTGCGCTGCGCCGGGTTTAACAACGTCGACCTTGAGGCGGCAAAGGAGCTTGGCCTGCGCGTCGTGCGCGTTCCAGCTTACTCTCCGGAAGCGGTCGCTGAGCATGCGATCGGTATGATGATGTCGCTCAACCGCCGCATCCACCGCGCTTACCAGCGTACCCGCGATGCCAATTTCTCCCTCGAAGGCCTCACCGGCTTCACCATGTACGGCAAAACCGCCGGGGTGATCGGCACCGGGAAAATTGGCGTAGCGATGTTGCGGATCCTTAAAGGCTTCGGCATGCGCCTGCTGGCGTTCGACCCGTACCCAAGCGCCGCCGCGCTGGAGCTGGGGGTAGAATATGTTGACCTCGCCACGCTGTACAAGGAATCGGACGTGATCTCCCTGCACTGTCCGCTGACCGACGAAAACTACCACCTGCTCAATCGCGAAGCCTTCGATCAGATGAAAGACGGGGTGATGGTGATCAACACCAGCCGCGGCGCCCTGATCGACTCTCAGGCGGCCATCGACGCCCTGAAGCACCAGAAAATTGGCGCGCTGGGGCTGGACGTTTATGAGAACGAACGCGATCTGTTCTTTGAAGACAAATCCAACGACGTGATCCAGGACGATGTCTTCCGCCGCCTCTCCGCCTGCCATAACGTACTGTTTACCGGCCACCAGGCGTTCCTCACCGCCGAGGCGCTGATCAGCATTTCGGAGACCACTCTGGGTAACCTGCAGCAGGTCGCCAACGGCGAAACCTGTCCGAACGCCATCGTCTAA;
[0087] SEQ ID NO. 52 (Nucleotide sequence of alcohol dehydrogenase-encoding gene yqhD):
[0088]
[0089] Construction of Recombinant Bacteria in Example 2
[0090] Table 5 Competent Cells and Recombinant Plasmids Corresponding to Each Recombinant Bacteria
[0091] Name of recombinant bacterium Competent cells Imported recombinant plasmid Kp2 Kp p3tac-kgsadh Kp3-1 Kp pCas9; pTarget-dhaT Kp4-1 Kp3-1 pCas9; pTarget-ldh Kp5-1 Kp4-1 pCas9; pTarget-ldhA Kp6-1 Kp5-1 pCas9; pTarget-yqhD Kp3 Kp3-1 p3tac-kgsadh Kp4 Kp4-1 p3tac-kgsadh Kp5 Kp5-1 p3tac-kgsadh Kp6 Kp6-1 p3tac-kgsadh
[0092] 1. Construction of Recombinant Bacteria Kp2
[0093] As shown in Table 5, the p3tac-kgsadh constructed in Example 1 was introduced into Kp to obtain recombinant bacteria Kp2. The specific method is as follows.
[0094] (1) Kp was cultured in LB liquid medium for 3 h and then used to prepare competent cells.
[0095] (2) Ice bath for 15 min. The above-mentioned bacterial cells were centrifuged at 4°C and 5000 rpm. The bacterial cells were resuspended with sterile water, and the centrifugation operation was repeated. The bacterial cells were resuspended with 10% glycerol, and the centrifugation operation was repeated. The bacterial cells were resuspended with 10% glycerol to obtain Kp competent cells.
[0096] (3) The above recombinant plasmid was electrotransformed into Kp competent cells (conditions: 2 kv; 1 ms). After culturing in LB liquid medium at 37°C for 1 h, it was spread on a kanamycin sulfate resistance plate with a final concentration of 50 μg / mL for screening. The positive clones identified correctly by PCR were named recombinant bacteria Kp2.
[0097] 2. Construction of Recombinant Bacteria Kp3-1 and Kp3
[0098] As shown in Table 5, pCas9 and pTarget-dhaT constructed in Example 1 were introduced into recombinant bacteria Kp competent cells to obtain recombinant bacteria Kp3-1. And p3tac-kgsadh was introduced into Kp3-1 competent cells to obtain Kp3. The specific method is as follows.
[0099] (1) pCas9 was electrotransformed into recombinant bacteria Kp competent cells. After culturing in LB liquid medium at 30°C for 2 h, it was spread on a kanamycin sulfate resistance plate with a final concentration of 50 μg / mL for screening.
[0100] (2) The positive clones identified correctly by PCR were inoculated into LB liquid medium (containing a final concentration of 50 μg / mL kanamycin sulfate and a final concentration of 0.4 M arabinose) and cultured at 30°C for 5 h. The steps for preparing competent cells were the same as those in the construction of recombinant bacteria Kp2. Kp competent cells containing pCas9 were obtained.
[0101] (3) pTarget-dhaT was electrotransformed into the above-mentioned competent cells. After culturing in LB liquid medium at 30°C for 2 h, it was spread on a screening medium plate for screening.
[0102] (4) The positive clones identified by PCR were inoculated into LB liquid culture medium (containing isopropyl thiogalactoside at a final concentration of 96 μg / mL) and cultured at 30°C for 12 h. The bacterial solution was diluted 10% with sterile water. 6 The clones were plated on a plate containing 50 μg / mL streptomycin sulfate resistance plate and cultured at 30°C for 12 h. The clones on the resistance plate were copied to a kanamycin sulfate resistance plate, and the clones that successfully lost pTarget-dhaT were selected and inoculated into LB liquid medium and cultured at 37°C for 12 h. The bacterial solution was diluted 10 times with sterile water. 6 The clones were plated on non-resistant plates and cultured at 37°C for 12 h. The clones on the non-resistant plates were copied onto resistance plates containing kanamycin sulfate at a final concentration of 50 μg / mL to screen for clones that successfully lost pCas9, which were named Kp3-1.
[0103] (5) Preparation of Kp3-1 competent cells (the steps are consistent with steps (1) and (2) in the construction of recombinant bacteria Kp2).
[0104] (6) The recombinant plasmid p3tac-kgsadh was electroporated into Kp3-1 competent cells (conditions: 2 kV; 1 ms), cultured in LB liquid medium at 37°C for 1 h, and then plated on a plate containing a final concentration of 50 μg / mL kanamycin sulfate for screening. The positive clone identified by PCR was named the recombinant bacterium Kp3.
[0105] 3. Construction of recombinant bacteria Kp4-1 and Kp4
[0106] As shown in Table 5, pCas9 and pTarget-ldh constructed in Example 1 were introduced into the competent cells of the recombinant bacteria Kp3-1 to obtain the recombinant bacteria Kp4-1. And p3tac-kgsadh was introduced into the competent cells of Kp4-1 to obtain the recombinant bacteria Kp4. The construction steps were consistent with the construction of the above-mentioned recombinant bacteria Kp3-1 and Kp3.
[0107] 4. Construction of recombinant bacteria Kp5-1 and Kp5
[0108] As shown in Table 5, pCas9 and pTarget-ldhA constructed in Example 1 were introduced into the competent cells of the recombinant bacteria Kp4-1 to obtain the recombinant bacteria Kp5-1. And p3tac-kgsadh was introduced into the competent cells of Kp5-1 to obtain the recombinant bacteria Kp5. The construction steps were consistent with the construction of the above-mentioned recombinant bacteria Kp3-1 and Kp3.
[0109] 5. Construction of recombinant bacteria Kp6-1 and Kp6
[0110] As shown in Table 5, pCas9 and pTarget-ldh constructed in Example 1 were introduced into the competent cells of recombinant bacterium Kp5-1 to obtain recombinant bacterium Kp6-1. Then, p3tac-kgsadh was introduced into the competent cells of Kp6-1 to obtain recombinant bacterium Kp6. The construction steps were the same as those of the above-mentioned recombinant bacteria Kp3-1 and Kp3.
[0111] Example 3 Shake Flask Fermentation of Klebsiella pneumoniae Engineering Bacteria
[0112] The recombinant bacteria Kp2, Kp3, Kp4, Kp5, Kp6 constructed in Example 2 and the original strain Kp were respectively used for the fermentation production of 3-hydroxypropionic acid. The specific method was as follows: Activate the recombinant bacteria, streak them on a plate containing kanamycin sulfate with a final concentration of 50 μg / mL, and culture them at 37 °C for 12 h to obtain single colonies. Pick a single colony and inoculate it into 5 mL of LB liquid medium (containing kanamycin sulfate with a final concentration of 50 μg / mL) and culture for 12 h to obtain a seed solution, and then inoculate it into 50 mL of Klebsiella pneumoniae fermentation medium at an initial OD 600 = 0.1 inoculation amount and culture at 37 °C and 220 rpm for 48 h.
[0113] Activate the original strain, streak it on a non-resistant plate, and culture it at 37 °C for 12 h to obtain single colonies. Pick a single colony and inoculate it into 5 mL of LB liquid medium and culture for 12 h to obtain a seed solution, and then inoculate it into 50 mL of Klebsiella pneumoniae fermentation medium at an initial OD 600 = 0.1 inoculation amount and culture at 37 °C and 220 rpm for 48 h.
[0114] After the shake flask fermentation was completed, 1.5 mL of the fermentation broth was taken into a 2 mL centrifuge tube, centrifuged at 12000 rpm for 5 min, and the uppermost supernatant was collected for standby.
[0115] 3-HP detection: Pass the fermentation products of each recombinant bacterium through a water-based nylon filter membrane (0.22 μm), and detect them with a high performance liquid chromatography instrument (HPLC).
[0116] HPLC detection conditions: Injection volume 10 μL, 5 mM dilute sulfuric acid, flow rate 1 mL / min, differential refractive index detector; Chromatographic column: AQ-C18 (250 mm × 2.1 μm). The entire liquid phase program was 15 minutes in total, and the standard product of 3-hydroxypropionic acid was used for qualitative and quantitative analysis.
[0117] The results of the HPLC detection of the shake flask fermentation samples are shown in Table 6 and Figure 5 , among which the 3-HP yield of recombinant bacterium Kp6 was the highest, reaching 6.77 g / L, that is, 6.77 g of 3-HP was produced per liter of the fermentation broth. The content of 3-HP produced by each recombinant bacterium after 48 hours of fermentation is shown inFigure 4 The results showed that the ability of strain Kp6 to produce 3-HP was significantly improved. By replacing the RBS and promoter, introducing the exogenous enzyme KGSADH, and inhibiting the 1,3-propanediol pathway and lactic acid pathway, the yield could be significantly increased.
[0118] Table 6 Yields of 3-HP of different strains
[0119] Name of strain 3-HP production (g / L) Kp 0.08 Kp2 4.24 Kp3 4.71 Kp4 5.14 Kp5 5.70 Kp6 6.77
[0120] Example 4 Fed-batch fermentation of engineered Klebsiella pneumoniae
[0121] The recombinant bacterium Kp4 constructed in Example 2 was used for fermentative production of 3-hydroxypropionic acid. The specific method was as follows: The recombinant bacterium was activated, and then streaked on a plate containing kanamycin sulfate with a final concentration of 50 μg / mL at 37 °C for 12 h to obtain single colonies. A single colony was picked and inoculated into 50 mL of Klebsiella pneumoniae seed medium and cultured at 37 °C and 220 rpm for 12 h to obtain the first-stage seed solution. 1 mL of the first-stage seed solution was inoculated into 100 mL of Klebsiella pneumoniae seed medium and cultured at 37 °C and 220 rpm for 12 h to obtain the second-stage seed solution.
[0122] 300 mL of the second-stage seed solution was inoculated into a 5 L bioreactor (Baoxing) and fermented for 96 h. The liquid loading was 3 L (including 2.7 L of Klebsiella pneumoniae fermentation medium). The temperature was maintained at 37 °C, and 5 M sodium hydroxide was automatically added dropwise to control the pH value at 7.0 all the time. The aeration rate was 1.5 vvm, the stirring speed was 400 rpm, and the glycerol concentration was maintained at 20 g / L. Samples were taken every 3 h to measure the biomass, residual glycerol, 3-hydroxypropionic acid, and other metabolites.
[0123] Optimization of fed-batch fermentation conditions:
[0124] (1) Optimization of organic nitrogen source
[0125] Only the organic nitrogen source (yeast extract) in the Klebsiella pneumoniae fermentation medium was changed. The main components were LB, 3 g / L yeast extract, 30 g / L yeast extract, and 3 g / L corn steep liquor (Shanghai Haohong Biopharmaceutical Technology Co., Ltd. (Leyan Reagent), product number: 1268845, CAS number: 66071-94-1). The fed-batch fermentation steps were the same as those described above.
[0126] (2) Control of glycerol concentration during fermentation
[0127] Only change the glycerol concentration control conditions during the top-fermentation process to no glycerol concentration control (during the fermentation process from 0 to 24 h, the remaining glycerol concentration ranges from 0 to 80 g / L; during the fermentation process from 24 h to 96 h, the remaining glycerol concentration is between 30 and 80 g / L. During the whole process from 0 to 96 h, the glycerol concentration is not deliberately controlled below 25 g / L or 15 g / L), the glycerol concentration is 15 g / L - 25 g / L, and the glycerol concentration is 0 g / L - 15 g / L. The top-fermentation steps are the same as the above top-fermentation content.
[0128] During the fermentation process in the fermenter, take 1 mL of the fermentation broth to measure the biomass (OD 600 representation), take 1.5 mL of the fermentation broth into a 2 mL centrifuge tube, centrifuge at 12000 rpm for 5 min, collect the supernatant on the top layer, dilute it 10 times with ultrapure water and reserve it for use.
[0129] Glycerol detection: Dilute the fermentation supernatant 1000 times with ultrapure water and then use a glycerol detection kit (Nanjing Jiancheng) for detection.
[0130] 3-HP detection: Pass the fermentation products of each recombinant strain through a water-based nylon filter membrane (0.22 μm), and detect them with a high-performance liquid chromatography instrument (HPLC).
[0131] HPLC detection conditions: Injection volume 10 μL, 5 mM dilute sulfuric acid, flow rate 1 mL / min, differential refractive index detector; chromatographic column: AQ-C18 (250 mm × 2.1 μm). The entire liquid phase program takes 15 minutes in total, and the standard product of 3-hydroxypropionic acid is used for qualitative and quantitative analysis.
[0132] The results of HPLC detection of the fermentation samples in the 5 L bioreactor are shown in Table 7 - Table 8, Figure 6 - Figure 7 , among which when the organic nitrogen source is 3 g / L corn steep liquor, the yield is the highest, reaching 102.6 g / L, that is, 102.6 g of 3-HP is produced per liter of the fermentation broth, while when containing the LB component, the yield is the lowest, only 15.27 g / L.
[0133] When controlling the glycerol concentration to be 15 g / L - 25 g / L during the fermentation process, the yield is the highest, reaching 110.7 g / L, that is, 110.7 g of 3-HP is produced per liter of the fermentation broth. The above results show that the optimization of the organic nitrogen source and the control of the glycerol concentration during the fermentation process can significantly improve the ability of the strain to produce 3-HP. The reasonable control of the appropriate concentration of the organic nitrogen source and the glycerol concentration can significantly increase the yield.
[0134] Table 7 Tank yields of 3-HP under different organic nitrogen source conditions
[0135] Organic nitrogen source 3-HP production (g / L) LB 15.27 3 g / L yeast extract 86.80 30 g / L yeast extract 59.77 3 g / L corn steep liquor 102.70
[0136] Table 8 Tank yields of 3-HP under different glycerol concentration conditions during the top-fermentation process
[0137] Glycerol concentration 3-HP production (g / L) Uncontrolled 71.06 15 - 25 g / L 110.70 0 - 15 g / L 87.70
[0138] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the spirit of the design of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. Method for constructing recombinant Klebsiella pneumoniae with high yield of 3-hydroxypropionic acid, characterized in that, Steps of constructing recombinant Klebsiella pneumoniae with high 3-hydroxypropionic acid production, including using Klebsiella pneumoniae as the starting strain, introducing the kgsadh gene encoding α-ketoglutaric semialdehyde dehydrogenase and knocking out one or more genes among the dhaT gene encoding 1,3-propanediol dehydrogenase, the ldh gene encoding L-lactate dehydrogenase, the ldhA gene encoding 2-hydroxypropionate dehydrogenase, and the yqhD gene encoding alcohol dehydrogenase.
2. The construction method according to claim 1, characterized in that The NCBI accession number of the kgsadh gene is AB241137.
1. The nucleotide sequence of the dhaT gene is as shown in SEQ ID NO.
49. The nucleotide sequence of the ldh gene is as shown in SEQ ID NO.
50. The nucleotide sequence of the ldhA gene is as shown in SEQ ID NO.
51. The nucleotide sequence of the yqhD gene is as shown in SEQ ID NO.
52.
3. The construction method according to claim 1, characterized in that The kgsadh gene is introduced by a recombinant plasmid. The recombinant plasmid is constructed by using pET28a as the backbone, replacing the original promoter with 3 tac promoters, replacing the original RBS sequence with the RBSIII sequence, and replacing the multiple cloning site MCS with the kgsadh gene. The RBSIII sequence is TAAGGAGG. The recombinant Klebsiella pneumoniae with high 3-hydroxypropionic acid production obtained by the construction method according to any one of claims 1-3.
5. Use of the recombinant Klebsiella pneumoniae according to claim 4 in the production of 3-hydroxypropionic acid.
6. A method for producing 3-hydroxypropionic acid, characterized in that, Including the step of fermentative production using the recombinant Klebsiella pneumoniae according to claim 4.
7. The method according to claim 6, wherein The organic nitrogen source for the fermentation is corn steep liquor.
8. The method according to claim 7, wherein The concentration of the corn steep liquor is 3 g / L.
9. The method according to claim 6, wherein During the fermentation process, the glycerol concentration is controlled to be 15 g / L - 25 g / L.