Application of NFKBIA gene in identification of salt tolerance of fish

Abstract

The invention provides an application of an NFKBIA gene in identification of salt tolerance of fish. Through experiments, the inventor finds that the expression quantity of the NFKBIA gene in the grass carp group subjected to salinity stress is obviously higher than that of the grass carp group without salinity stress, and the relative expression quantity of the NFKBIA gene in the freshwater grass carp group and the relative expression quantity of the NFKBIA gene in the salinity training grass carp group are obviously different; the invention reveals that the NFKBIA gene can obviously influence the tolerance of the grass carp to the salt stress, and the NFKBIA gene has a negative regulation effect on the salt stress coping process of the grass carp, and the expression quantity of the NFKBIA gene is closely related to the salt tolerance of the grass carp. The invention discovers that the expression quantity of the NFKBIA gene has significant correlation with the salt tolerance of grass carp for the first time, provides a new target for the research of fish salt tolerance molecular mechanism, enriches the understanding of fish salt stress adaptation mechanism, and provides molecular biology basis for the breeding of fish salt tolerance varieties and the optimization of culture environment.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to the application of the NFKBIA gene in the identification of the salt tolerance ability of fish. Background Art

[0002] With the global climate change and the intensive development of the aquaculture industry, the development and utilization of saline-alkali water area resources have become the focus of the industry. As osmoregulating animals, fish have important value in the research of the molecular regulation mechanism of their salt tolerance ability for variety improvement. At present, the identification of fish salt tolerance traits mainly relies on the detection of physiological and biochemical indexes (such as the activity of gill tissue Na + / K + -ATPase, plasma osmotic pressure, etc.) and the observation of long-term salinity stress experiments. These methods have limitations such as long detection period, complex operation and difficulty in realizing early breeding.

[0003] The grass carp (Ctenopharyngodon idella) is one of the important freshwater cultured fish in China, with advantages such as fast growth and delicious meat. However, with the development of the aquaculture industry, the aquaculture environment faces many challenges, and salinity change is one of the important factors affecting the growth and health of grass carp. In some areas, due to the increase in the salinity of the water source or improper regulation of the salinity of the aquaculture water body, grass carp may face salt stress. Understanding the adaptation mechanism of grass carp to salinity and screening out genes related to the salt tolerance ability of grass carp are of great significance for improving the aquaculture performance of grass carp in different salinity environments. At present, the research on grass carp salt tolerance-related genes is still in its infancy, and there is a lack of effective molecular markers for identifying the salt tolerance ability of grass carp. Therefore, there is an urgent need to develop a gene and related application methods that can accurately identify the salt tolerance ability of grass carp. Summary of the Invention

[0004] The present invention provides the application of the NFKBIA gene in the identification of the salt tolerance ability of fish. The expression level of the NFKBIA gene is closely related to the salt tolerance ability of grass carp. Applying the NFKBIA gene in the identification of the salt tolerance ability of fish, detecting the relative expression level of the NFKBIA gene in the fish to be identified can quickly and accurately identify the salt tolerance ability of fish at an early stage, which has important guiding significance for the breeding of fish salt-tolerant varieties.

[0005] According to the first aspect of the present invention, there is provided the application of the NFKBIA gene in the identification of the salt tolerance ability of fish.

[0006] NFKBIA (Nuclear Factor Kappa B Inhibitor Alpha) is a key gene that regulates the NF-κB signaling pathway. The protein encoded by it plays an important role in cell signal transduction and gene expression regulation. NFKBIA is involved in stress response and inflammation regulation in different species. In mice, it participates in the hypoxia-induced inflammatory response by upregulating its expression; in cattle, it regulates the process of oocyte-to-embryo transition; in rainbow trout, it is involved in immune regulation; in rats, it is involved in a variety of inflammation-related processes. These studies indicate that NFKBIA has a wide range of biological functions in different species, especially its key role in stress and inflammatory responses. In addition, NFKBIA also has functions such as regulating apoptosis, being related to various diseases, participating in the cell's response to stimuli, and having potential salt tolerance regulation.

[0007] The inventors of this application performed acute salinity stress treatment (salinity stress) on a grass carp population, collected gill tissues from the grass carp population after acute salinity stress treatment, and extracted total RNA from the gill tissues. Using the cDNA obtained by reverse transcription of the total RNA as a template, primers were designed and the NFKBIA gene was amplified using fluorescence quantitative PCR technology. Based on the amplification results, the relative expression level of the NFKBIA gene was calculated using the 2 -ΔΔCt -method. It was found that the relative expression level of the NFKBIA gene in the grass carp population after acute salinity stress treatment was significantly higher than that in the grass carp population without salinity stress treatment. Moreover, as the duration of salinity stress treatment increased, the relative expression level of the NFKBIA gene in the grass carp population showed a downward trend. Further, by detecting the relative expression levels of the NFKBIA gene in the freshwater grass carp population and the salinity-acclimated grass carp population, it was found that there were significant differences in the expression levels of the NFKBIA gene between these two populations, revealing that the NFKBIA gene can significantly affect the salt tolerance of grass carp and has a negative regulatory effect on the process of grass carp coping with salt stress. The expression level of the NFKBIA gene is closely related to the salt tolerance ability of grass carp. Therefore, the NFKBIA gene can be applied to the identification of the salt tolerance ability of fish.

[0008] The NFKBIA gene is applied to the identification of the salt tolerance ability of fish to detect the relative expression level of the NFKBIA gene in the fish to be identified, and the relative expression level of the NFKBIA gene in the fish population to be identified is compared with the expression levels of the NFKBIA gene in known salt-tolerant and salt-intolerant fish populations. If the relative expression level of the NFKBIA gene in the fish population to be identified is similar to that in the known salt-tolerant fish population, then the fish population to be identified has a strong salt tolerance ability; if the relative expression level of the NFKBIA gene in the fish population to be identified is similar to that in the known salt-intolerant fish population, then the fish population to be identified has a weak salt tolerance ability.

[0009] Moreover, the NFKBIA gene plays a key role in the salt tolerance process of fish. By regulating related physiological processes, it can effectively enhance the adaptability of fish to saline-alkali environments, which is of great significance for the breeding of salt-tolerant fish varieties.

[0010] The present invention first discovers that there is a significant correlation between the expression level of the NFKBIA gene and the salt tolerance ability of grass carp, provides a new target for the study of the molecular mechanism of fish salt tolerance, enriches the understanding of the salt stress adaptation mechanism of fish, and provides a molecular biological basis for the breeding of salt-tolerant fish varieties and the optimization of the aquaculture environment.

[0011] Preferably, the nucleotide sequence of the above-mentioned NFKBIA gene is as shown in SEQ ID NO: 1.

[0012] The protein encoded by the NFKBIA gene has a unique domain and has a certain homology with the known protein family involved in stress response regulation. The NFKBIA gene can significantly affect the tolerance of grass carp to salt stress. Therefore, applying the NFKBIA gene to the identification of the salt tolerance ability of fish and detecting the relative expression level of the NFKBIA gene in the fish to be identified can quickly and accurately identify the salt tolerance ability of fish at an early stage, greatly improving the breeding efficiency of salt-tolerant fish varieties and reducing the breeding cost of salt-tolerant fish varieties, which has important guiding significance for the breeding of salt-tolerant fish varieties.

[0013] Preferably, the above-mentioned fish includes grass carp.

[0014] According to the second aspect of the present invention, there is provided the application of a primer pair for amplifying the NFKBIA gene in the identification of the salt tolerance ability of fish. The primer pair for amplifying the NFKBIA gene includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is as shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO: 3.

[0015] According to the third aspect of the present invention, there is provided a method for identifying the salt tolerance ability of fish, including the following steps:

[0016] S1. Extract total RNA from the gill tissues of the fish to be tested;

[0017] S2. Reverse transcribe the extracted total RNA to obtain cDNA;

[0018] S3. Using the cDNA obtained by reverse transcription as a template, perform fluorescence quantitative PCR amplification on the template with a primer pair for amplifying the NFKBIA gene, calculate the expression level of the NFKBIA gene based on the amplification result, and evaluate the salt tolerance of the fish to be tested according to the expression level of the NFKBIA gene. Among them, the primer pair for amplifying the NFKBIA gene includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 3.

[0019] The method for identifying the salt tolerance of fish established based on the NFKBIA gene has the advantages of high accuracy, strong specificity, and simple operation. Compared with the traditional method of evaluating salt tolerance by observing the growth performance and survival rate of fish in different salinity environments, the molecular biology method provided by this scheme can quickly and accurately identify the salt tolerance of fish at an early stage, greatly improving the breeding efficiency of salt-tolerant fish varieties and reducing the breeding cost of salt-tolerant fish varieties, which has important guiding significance for the breeding of salt-tolerant fish varieties.

[0020] By screening fish individuals carrying low-expression NFKBIA genes for breeding, new fish varieties with strong salt tolerance can be gradually cultivated, expanding the breeding range of fish and improving the economic benefits and sustainable development ability of the aquaculture industry.

[0021] Preferably, the above fish include grass carp.

[0022] Preferably, in S3, the reaction conditions for fluorescence quantitative PCR amplification are as follows: denaturation at 94°C for 60 s, annealing at 56°C for 60 s, extension at 72°C for 60 s, for a total of 40 cycles.

[0023] Preferably, in S3, during the fluorescence quantitative PCR amplification process, an operation of correcting the difference in the amount of template used with an internal reference gene is also included. The internal reference gene includes the β-actin gene.

[0024] Preferably, the primer pair for amplifying the above internal reference gene includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 5.

[0025] In the method for identifying the salt tolerance ability of fish, when detecting the expression level of the NFKBIA gene, an internal reference gene is set, and the internal reference gene and the primer pair for amplifying the internal reference gene are added to the fluorescence quantitative PCR amplification system, which can correct the difference in the amount of template used, further improve the accuracy of the detection result of the expression level of the NFKBIA gene, and thus make the identification result of the salt tolerance ability of fish more accurate.

[0026] Preferably, in S3, 2 -ΔΔCt methods are used to calculate the expression level of the NFKBIA gene.

[0027] According to the fourth aspect of the present invention, there is provided an application of the above method for identifying the salt tolerance ability of fish in the breeding of fish salt tolerance traits.

[0028] Applying the above method for identifying the salt tolerance ability of fish to the breeding of fish salt tolerance traits can greatly improve the breeding efficiency of fish salt tolerance varieties and reduce the breeding cost of fish salt tolerance varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is a diagram showing the transcriptomics results and fluorescence quantitative PCR verification results of the NFKBIA gene in the grass carp population under acute salinity stress provided in Example 1.

[0030] Figure 2 It is a diagram showing the fluorescence quantitative PCR verification results of the NFKBIA gene in the salinity-acclimated group and freshwater group of grass carp provided in Example 2. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The technical features in the technical solutions provided by the present invention will be further clearly and completely described below in conjunction with the specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts shall fall within the protection scope of the present invention.

[0032] Example 1 Identification of the Salt Tolerance Ability of the NFKBIA Gene in the Grass Carp Population under Acute Salinity Stress

[0033] This example aims to study the expression of the NFKBIA gene in the grass carp population under acute salinity stress. The experimental materials and specific experimental operation steps are as follows:

[0034] 1. Experimental Materials

[0035] (1) Experimental Fish and Temporary Rearing Conditions

[0036] The grass carp used in the experiment was from Guangdong Liangshi Aquatic Seed Co., Ltd. The grass carp fry with a size of (5±1.5) g were weighed at 50 ind. / m 3 The fish were temporarily cultured at a density of 300 L in a polyethylene water tank for subsequent experiments, where the daily water exchange rate was 30%, the breeding water was filtered tap water that was aerated for 24 hours, the temporary water temperature was (22±1)°C, the dissolved oxygen was (7.0±0.5) mg / L, the ammonia nitrogen concentration was (0.15±0.02) mg / L, and the nitrite nitrogen concentration was (0.03±0.01) mg / L. No feeding was carried out during the temporary culture period, and the experiment was started after 3 days of temporary culture.

[0037] The experimental fish were obtained according to the above-mentioned temporary rearing conditions and cultured in freshwater with a salinity of 0‰ until they weighed 10 g for subsequent acute salinity stress experiments (ie, salinity stress experiments).

[0038] (2) The experimental water was fully aerated tap water with a dissolved oxygen content of 5.6-6.0 mg / L and a pH of 7.8. The experimental brine was prepared using sea crystal (Haibao, purchased from Jiangxi Yantong Technology Co., Ltd.) and aerated for 24 h before use to prepare an experimental brine with a salinity of 9‰ for the acute stress experiment on grass carp. The experimental container was a polyethylene water tank with a capacity of 300 L and a water temperature of 23.5-25.0℃.

[0039] 2. Experimental Methods

[0040] (1) Sample collection: Grass carp grown to 10 g were subjected to acute stress treatment using experimental saline with a salinity of 9‰ and cultured for a period of time. Four grass carp juveniles that were cultured in the water with a salinity of 9‰ for 0 h, 6 h, 24 h, and 96 h and had good growth conditions and high survival rates were selected.

[0041] (2) Total RNA extraction: Total RNA was extracted from the gill tissue of selected grass carp fry using the Animal Total RNA Lsolation Kit.

[0042] (3) Reverse transcription: Using the total RNA extracted from the gill tissue of grass carp fry as a template, a reverse transcription kit was used to reverse transcribe the RNA into cDNA, wherein the reverse transcription reaction system included an appropriate amount of total RNA, reverse transcription primers, dNTPs, reverse transcriptase and buffer, etc., and the reaction conditions were optimized according to the instructions of the kit.

[0043] Table 1 Primer pairs for fluorescence quantitative PCR amplification

[0044]

[0045] (4) Fluorescent quantitative PCR amplification: Using the cDNA obtained by reverse transcription as a template, perform fluorescent quantitative PCR amplification. At the same time, set the β-actin gene as an internal reference gene. The nucleotide sequences of the primer pair for amplifying the NFKBIA gene and the primer pair for amplifying the internal reference gene are shown in Table 1;

[0046] Among them, the reaction system for fluorescent quantitative PCR amplification includes cDNA template, primer pair for amplifying the NFKBIA gene, primer pair for amplifying the internal reference gene, SYBR Green fluorescent dye, dNTPs, Taq enzyme, buffer, etc.;

[0047] The reaction conditions for fluorescent quantitative PCR amplification are: pre-denaturation at 94°C for 120 s; denaturation at 94°C for 60 s, annealing at 56°C for 60 s, extension at 72°C for 60 s, for a total of 40 cycles; melting curve: 95°C for 45 s, 60°C for 45 s, 95°C for 45 s, 33°C for 45 s.

[0048] In order to screen out candidate genes related to the salt tolerance ability of grass carp, the total RNA extracted from the gill tissues of juvenile grass carp was sequenced, and at the same time, the above steps were referred to for fluorescence quantitative PCR analysis. The transcriptomics results and fluorescence quantitative PCR amplification results of the NFKBIA gene in the grass carp population under acute salinity stress are as Figure 1 shown. Among them, the vertical axis (left) represents the TPM (Transcripts Per Kilobase of exon model per Million mapped reads) of transcriptomics RNA-Seq, which is an index for normalizing the expression level of genes or transcripts. The vertical axis (right) represents the relative expression level of the NFKBIA gene. In the horizontal axis, A represents the grass carp population test sample at 0 h of salinity stress (Group A), S6 represents the grass carp population test sample at 6 h of salinity stress (Group S6), S24 represents the grass carp population test sample at 24 h of salinity stress (Group S24), and S96 represents the grass carp population test sample at 96 h of salinity stress (Group S96).

[0049] From Figure 1It can be seen that by calculating the relative expression of the NFKBIA gene, it was found that the relative expression of the NFKBIA gene in the grass carp populations in the S6 group, S24 group, and S96 group was significantly higher than the relative expression of the NFKBIA gene in the grass carp population in the A group that was not subjected to salinity stress for 6h, 24h, and 96h, and as the salinity stress treatment time increased, the relative expression level of the NFKBIA gene in the grass carp population showed a downward trend. The above results show that the expression of the NFKBIA gene is closely related to the salt tolerance of grass carp, and the NFKBIA gene can significantly affect the tolerance of grass carp to salt stress. Therefore, the NFKBIA gene can be used in the identification of fish salt tolerance.

[0050] Example 2 Analysis of differential expression of NFKBIA gene in salinity-conditioned and freshwater grass carp populations

[0051] In order to further verify whether the NFKBIA gene can be used in the identification of fish salt tolerance, this example uses commercially available common freshwater grass carp and salinity-acclimated grass carp as experimental subjects, extracts total RNA from the gill tissue of the grass carp and reverse transcribes it to obtain cDNA, uses the cDNA as a template, and uses fluorescent quantitative PCR amplification to amplify the template, and then analyzes the amplification results to screen out candidate genes related to the salt tolerance of grass carp. The experimental materials and specific experimental operation steps used are as follows:

[0052] 1. Experimental Materials

[0053] (1) Freshwater grass carp population (freshwater group): 15 grass carp individuals weighing 10 g, with good growth and high survival rate, were selected and cultured in freshwater with a salinity of 0‰.

[0054] Experimental fish and temporary rearing conditions of freshwater grass carp populations: The grass carp used in the experiment came from Guangdong Liangshi Aquatic Seed Co., Ltd. The grass carp fry with a size of (5±1.5) g were temporarily reared in a polyethylene water tank with a capacity of 300 L at a density of 50 ind. / m3 for subsequent growth comparison experiments. The daily water exchange rate was 30%, and the breeding water was filtered tap water with aeration for 24 hours. The temporary rearing water temperature was (22±1)℃, the dissolved oxygen was (7.0±0.5) mg / L, the ammonia nitrogen concentration was (0.15±0.02) mg / L, and the nitrite nitrogen concentration was (0.03±0.01) mg / L. No feeding was carried out during the temporary rearing period, and the experiment was started after 3 days of temporary rearing.

[0055] (2) Salinity-trained grass carp population (salinity acclimation group): 15 grass carp individuals weighing 10 g, with good growth and high survival rate, were selected and cultured in water with a salinity of 7‰.

[0056] The experimental fish and acute stress treatment conditions for the freshwater grass carp population are as follows: After culturing the grass carp according to the experimental fish and temporary culturing conditions of the freshwater grass carp population in step (1), fertilized eggs are obtained after natural spawning and fertilization of the grass carp. After the grass carp larvae hatch, they are fed Toyotemia four times a day. During the culturing process, the residual waste at the bottom is sucked out every day. The grass carp is domesticated with experimental brine with a salinity of 7‰ and cultured to (6±1.5) g for the growth comparison test. Among them, the test water is fully aerated tap water with a dissolved oxygen content of 5.6 - 6.0 mg / L and a pH of 7.8. The experimental brine is prepared using seawater crystals (Haibao, purchased from Jiangxi Yantong Technology Co., Ltd.), aerated for 24 hours before use, and configured to a salinity of 7‰; the experimental container is a polyethylene water tank with a capacity of 300 L, and 30% of the new water is replaced every 8 hours, and the water temperature is 23.5 - 25.0 °C.

[0057] 2. Experimental methods

[0058] (1) Sample collection: Each of the salinity domestication group and the freshwater group contains 15 juvenile grass carp. For each group, the gill tissues of 10 juvenile grass carp are placed into 1.5 mL EP tubes containing RNA protective solution and stored at -80 °C for a long time for detecting gene expression.

[0059] (2) Total RNA extraction: The Animal Total RNA Lsolation Kit (Animal Total RNA Rapid Extraction Kit) is used to extract total RNA from the gill tissues of grass carp; the integrity of the RNA is detected by agarose gel electrophoresis. The results show that the bands of 28S and 18S rRNA are clear and there is no obvious degradation; the concentration and purity of the RNA are measured using a spectrophotometer. The absorbance of the RNA at a wavelength of 260 nm (A260) and its absorbance at a wavelength of 280 nm (A280) are tested, and the A260 / A280 ratio is between 1.8 and 2.0, indicating that the quality of the extracted total RNA is good.

[0060] (3) Reverse transcription: Using the total RNA extracted from the gill tissues of grass carp as a template, the RNA is reverse transcribed into cDNA using a reverse transcription kit. Among them, the reverse transcription reaction system includes appropriate total RNA, reverse transcription primers, dNTPs, reverse transcriptase, and buffer, etc. The reaction conditions are optimized according to the kit instructions. (4) Fluorescent quantitative PCR amplification (the experimental operation steps are the same as in Example 1): Using the cDNA obtained by reverse transcription as a template, fluorescent quantitative PCR amplification is carried out. At the same time, the β-actin gene is set as an internal reference gene. The nucleotide sequences of the primer pairs for amplifying the NFKBIA gene and the primer pairs for amplifying the internal reference gene are shown in Table 1;

[0061] Among them, the reaction system for fluorescence quantitative PCR amplification includes cDNA template, primer pairs for amplifying the NFKBIA gene, primer pairs for amplifying the reference gene, SYBR Green fluorescent dye, dNTPs, Taq enzyme, buffer, etc.;

[0062] The reaction conditions for fluorescence quantitative PCR amplification are: pre-denaturation at 94°C for 120 s; denaturation at 94°C for 60 s, annealing at 56°C for 60 s, extension at 72°C for 60 s, for a total of 40 cycles; melting curve: 95°C for 45 s, 60°C for 45 s, 95°C for 45 s, 33°C for 45 s.

[0063] SEQ ID NO: 1

[0064] ATGGAGCTTTATCGAGGCAGCAACACCAACCAACTGGATTATAA

[0065] TGACGATGGCCGCGGACCCAAATCTGGGAAAATGCTTGCGAGC

[0066] AACGACGACCGTTTAGACAGCGGTTTGGATTCGCTTAAAGAGG

[0067] ATGAATACCCGGACGTGGTGTCTGATTTCAGGCGGATGAAAGTG

[0068] GACGAGCGGCAGGACGAGCCCTGGAGGAAAGAGCTCACCGAA

[0069] GACGGAGACACGTTTTTACATCTTGCCATTATTCACGAGGCCAA

[0070] AGATGCTGCATTAAAAATGATTGATTTATCCTATGGTGACCCCTT

[0071] CCTCAACATACAGAACAACCAGAGACAGACTGCCTTGCATTTG

[0072] GCCGTCATCACAGAGCAGCCTCATATAGTAGAGCAGTTACTAAA

[0073] GGCCGGCTGTGATGCTTCTCTGGTGGATGACTGTGGTAACACCG

[0074] CCCTCCATATCGCCTGCAGAAAAGGTTCAATGGCCTGCTTTGGC

[0075] CTTCTAACCCAGGGCTGTCCACAGCACCTCCCAGCCATCCTCCA

[0076] GACGTCAAACTATAACGGTCAGAAATGCATACACGTGGTCGCCA

[0077] TCCACGGCTACCTGTCGTTGTTGGAAAGTCTCATCCAGCTTGGC

[0078] GCAGACATCAACGCACAGGAGCAGTGTAATGGGCGAACCGCTC

[0079] TACACTTAGCAGTGGACCTTCAGAACTTTGAGCTGGTTAAACTT

[0080] CTAATCAGCAAAGGCGCTGATGTTCACAGCTTCACGTACGGCG

[0081] GTCACACGCCTTATCACCTGACCTATGGCCGGGCGAACACTGAC

[0082] ATCCAAAAAGTCCTGTATGAGCTCACGGCGCCACACCTAAGGG

[0083] AACTTCCAGATAGTGAGTCAGAGGATAGCGATGAGGATTATGAA

[0084] GACCAGTGTACATCTGATGATGAAGATATGTATGATGATATTAAA

[0085] ATGATGGGGCAGTAG

[0086] Using method 2 -ΔΔCt to calculate the relative expression level of the NFKBIA gene (whose nucleotide sequence is shown in SEQ ID NO: 1), the fluorescence quantitative PCR verification results of the NFKBIA gene in grass carp in the salinity acclimation group and the freshwater group are as Figure 2 shown, where the vertical axis represents the relative expression level (fold change) of the NFKBIA gene, and WT in the horizontal axis represents the freshwater grass carp population (freshwater group), and DT represents the salinity-acclimated grass carp population (salinity acclimation group) samples. According to Figure 2The results show that the relative expression level of the NFKBIA gene in the grass carp population of the salinity acclimated group (DT) was significantly lower than that in the grass carp population of the freshwater group (WT) (P<0.05). Compared with the expression level of the NFKBIA gene in the grass carp population treated with acute salinity stress in Example 1, it was found that the relative expression level of the NFKBIA gene in the grass carp population of the salinity acclimated group was similar to that of the grass carp population treated with acute salinity stress in Example 1, which indicates that the grass carp in the salinity acclimated group has a strong salt tolerance, and the expression level of the NFKBIA gene in the salt-tolerant grass carp population is relatively low, which further verifies the accuracy of identifying the salt tolerance of grass carp based on the NFKBIA gene.

[0087] The above results show that there is a significant difference in the expression of NFKBIA gene in the freshwater group and the salinity acclimated group, which reveals that NFKBIA gene can significantly affect the tolerance of grass carp to salt stress and that NFKBIA gene has a negative regulatory effect on the process of grass carp coping with salt stress. The expression of NFKBIA gene is closely related to the salt tolerance of grass carp. Therefore, by screening grass carp individuals carrying low expression of NFKBIA gene for breeding, new grass carp varieties with strong salt tolerance can be gradually cultivated, the breeding range of grass carp can be expanded, and the economic benefits and sustainable development capabilities of aquaculture can be improved.

[0088] In summary, the present invention has revealed through experiments that the NFKBIA gene can significantly affect the tolerance of grass carp to salt stress and that the NFKBIA gene has a negative regulatory effect on the grass carp's response to salt stress. The expression level of the NFKBIA gene is closely related to the salt tolerance of grass carp, and the NFKBIA gene plays a key role in the salt tolerance of fish. By regulating related physiological processes, the adaptability of fish to saline-alkali environments can be effectively enhanced. The NFKBIA gene is applied to the identification of the salt tolerance of fish. By detecting the relative expression level of the NFKBIA gene in the identified fish and comparing it with the NFKBIA gene expression level in the known salt-tolerant and salt-intolerant fish populations, the salt tolerance of fish can be quickly and accurately identified at an early stage, which greatly improves the breeding efficiency of salt-tolerant fish varieties and reduces the breeding cost of salt-tolerant fish varieties. This has important guiding significance for the breeding of salt-tolerant fish varieties.

[0089] The above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention is described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that the technical solutions of the present invention can be modified or equivalently replaced, but these modifications or replacements are all within the protection scope of the present invention.

Claims

1. Application of NFKBIA gene in the identification of salt tolerance ability of fish.

2. Use of the NFKBIA gene according to claim 1 in the identification of the salt tolerance ability of fish, characterized in that: The nucleotide sequence of the NFKBIA gene is shown as SEQ ID NO:

1.

3. Use of the NFKBIA gene as described in claim 1 in the identification of the salt tolerance ability of fish, characterized in that: The fish includes grass carp.

4. Use of a primer pair for amplifying the NFKBIA gene in the identification of the salt tolerance ability of fish, characterized in that: The primer pair for amplifying the NFKBIA gene includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown as SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO:

3.

5. A method for identifying the salt tolerance ability of fish, characterized in that, It includes the following steps: S1. Extract total RNA from the gill tissue of the fish to be tested; S2. Reverse transcribe the extracted total RNA to obtain cDNA; S3. Using the cDNA obtained by reverse transcription as a template, perform fluorescence quantitative PCR amplification on the template with the primer pair for amplifying the NFKBIA gene, calculate the expression level of the NFKBIA gene according to the amplification result, and evaluate the salt tolerance ability of the fish to be tested according to the expression level of the NFKBIA gene. Among them, the primer pair for amplifying the NFKBIA gene includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown as SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO:

3.

6. The method for identifying the salt tolerance ability of fish according to claim 5, characterized in that, In S3, the reaction conditions for the fluorescence quantitative PCR amplification are as follows: denaturation at 94°C for 60 s, annealing at 56°C for 60 s, extension at 72°C for 60 s, for a total of 40 cycles.

7. The method for identifying the salt tolerance ability of fish according to claim 5, characterized in that: In S3, during the fluorescence quantitative PCR amplification process, an operation of correcting the dosage difference of the template using an internal reference gene is also included. The internal reference gene includes the β-actin gene.

8. The method for identifying the salt tolerance ability of fish according to claim 7, characterized in that: The primer pair for amplifying the internal reference gene includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown as SEQ ID NO: 4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO:

5.

9. The method for identifying the salt tolerance ability of fish according to claim 5, characterized in that: In the step S3, 2 -ΔΔCt is used to calculate the expression level of the NFKBIA gene.

10. Application of the method for identifying the salt tolerance ability of fish according to any one of claims 5 to 9 in the breeding of fish salt tolerance traits.

Images