SNP marker combinations, probe sets and their applications for assisted selection of resistance to apple stem ring rot

By developing SNP marker combinations and probe sets for auxiliary selection of apple stem ring rot resistance, the problem of inaccurate SSR markers in the existing technology has been solved, and accurate judgment of the resistance and susceptibility of apple plants has been achieved, thereby improving breeding efficiency and the accuracy of parent selection.

CN120366512BActive Publication Date: 2025-09-26CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510825536.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2025-09-26
Estimated Expiration
2045-06-19

AI Technical Summary

Technical Problem

Existing SSR markers are not accurate enough in the development and application of molecular markers for apple resistance to branch ring rot, and are unable to accurately determine the plant's resistance to branch ring rot, resulting in low breeding efficiency.

Method used

A set of SNP marker combinations for assisted selection of apple stem ring rot resistance, including SNP1 to SNP4, was developed, and corresponding GenoBaits DNA probes were designed for marker-assisted selection of hybrid offspring seedlings at the seedling stage to improve breeding efficiency.

Benefits of technology

Through the application of SNP marker combinations and probe groups, the susceptibility of apple trees to branch ring rot can be determined simply and quickly, and the prediction results are extremely accurate, which improves the efficiency of breeding and parent selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366512B_ABST
    Figure CN120366512B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of plant molecular breeding, and specifically relates to a SNP marker combination, a probe set, and their applications for assisted selection of resistance to apple stem ring rot. The SNP marker combination consists of SNPs SNP1 to SNP4; the nucleotide sequences of SNPs SNP1 to SNP4 are shown as SEQ ID NO.1 to SEQ ID NO.4, respectively. The present invention provides a SNP marker combination for resistance to apple stem ring rot. The SNP marker combination for resistance to apple stem ring rot is suitable for molecular-assisted evaluation of apple stem ring rot resistance in apple germplasm resources, as well as for screening excellent disease-resistant germplasm and designing breeding programs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding, and in particular relates to a SNP marker combination, a probe set and applications thereof for assisted selection of apple branch ring rot resistance. Background Art

[0002] Apple trunk ring rot, Botryosphearia canke r Bot canker is one of the three major diseases that currently harm China's main apple production areas. The main pathogen of apple ring rot is Botrytis cinerea ( Botryosphaeria dothidea ). This disease harms branches and trunks and is sometimes called dry rot or rough bark disease. In severe cases, it can even cause the death of branches and trunks, seriously restricting the development of my country's apple industry. At present, the occurrence of apple ring rot can be controlled to a certain extent through a combination of chemical control and agricultural measures. For chemical control, lime sulfur mixture can be used as an orchard management agent in early spring. Carbendazim and dicyanoanthraquinone are also commonly used agents by fruit farmers. Agricultural measures for management and control, such as clearing the orchard in winter, thoroughly removing diseased leaves in the orchard, increasing the application of organic fertilizers, appropriately reducing the use of nitrogen fertilizers, focusing on pruning, and improving ventilation and light conditions in the orchard. However, existing prevention and control methods have disadvantages such as high cost and unstable effects. Therefore, improving the disease resistance of cultivated varieties and breeding resistant varieties are the most effective prevention and control methods.

[0003] Traditional apple breeding methods typically require significant time and resources, and it's difficult to accurately predict the performance of new varieties. However, molecular marker-assisted breeding can improve breeding efficiency, shorten breeding cycles, reduce costs, and enhance the accuracy and stability of varieties. Therefore, the development of relevant molecular markers is crucial for breeding apple varieties for disease resistance.

[0004] Resistance to apple stem ring rot is a quantitative trait controlled by multiple genes with minor effects, including major genes with significant effects. In this study, genetic analysis and molecular markers for apple stem ring rot were used to investigate field inoculation data from a 'Hongyu' × 'Jinguan' hybrid population infected with five different stem ring pathogens. Segregation analysis using SSR primers identified 14 pairs of SSR markers associated with stem ring rot resistance. Fruits from 1,733 F1 progeny lines from the 'Hongyu' × 'Jinguan' hybrid population were inoculated with four stem ring pathogen strains, Zz26, Ls1, Lw023, and Lw048. Using BSA-seq, a total of 46 resistance QTLs were detected. Combined with biparental resequencing and transcriptome analysis, 57 candidate genes for fruit ring rot resistance / susceptibility were predicted. However, these SSR markers are currently insufficient for the development and application of molecular markers for apple stem ring rot resistance, and cannot accurately determine the plant's resistance or susceptibility to stem ring rot. Summary of the Invention

[0005] To address the problem in the prior art that SSR markers are not sufficiently accurate for the development and application of molecular markers for apple resistance to stem ring rot, and thus cannot accurately determine the plant's susceptibility to stem ring rot, the present invention aims to develop a set of molecular markers suitable for marker-assisted selection of apple stem ring rot resistance, so that marker-assisted selection for apple stem ring rot resistance can be performed during the seedling stage of hybrid offspring seedlings, thereby improving breeding efficiency. To achieve the above objectives, the present invention adopts the following technical solutions.

[0006] One of the objectives of the present invention is to provide a SNP marker for auxiliary selection of apple branch ring rot resistance, wherein the SNP markers include SNP1 to SNP4.

[0007] The SNP1 is Chr00_23716755 C / T, and the nucleotide sequence of Chr00_23716755 C / T is shown in SEQ ID NO. 1, wherein there is a mutation from C to T at bp 201. The T allele of Chr00_23716755 C / T is a genotype resistant to branch ring rot.

[0008] The SNP1 is a C to T mutation at position 23716755 of apple chromosome 0.

[0009] The SNP2 is Chr02_20663119 A / C, and the nucleotide sequence of Chr02_20663119 A / C is shown in SEQ ID NO. 2, wherein there is a mutation from A to C at bp 201. The C allele of Chr02_20663119 A / C is a genotype resistant to branch ring rot.

[0010] The SNP2 is a mutation from A to C at position 20663119 of apple chromosome 2.

[0011] The SNP3 is Chr14_24248741 A / C, and the nucleotide sequence of Chr14_24248741 A / C is shown in SEQ ID NO. 3, wherein there is a mutation from A to C at bp 198. The C allele of Chr14_24248741 A / C is a genotype resistant to branch ring rot.

[0012] The SNP3 is a mutation from A to C at position 24248741 on chromosome 14 of apple.

[0013] The SNP4 is Chr14_29982606 A / G, and the nucleotide sequence of Chr14_29982606 A / G is shown in SEQ ID NO. 4, wherein there is a mutation from A to G at bp 201. The G allele of Chr14_29982606 A / G is a genotype resistant to branch ring rot.

[0014] The SNP4 is a mutation from A to G at position 29982606 of apple chromosome 14.

[0015] The SNP marker combination provided by the present invention has the advantage of being able to simply and quickly determine the susceptibility of a certain apple tree plant to branch ring rot, and the prediction result has extremely high accuracy. It can solve the problem that the current SSR markers are not accurate enough for the development and application of molecular markers for apple resistance to branch ring rot, and cannot accurately determine the susceptibility of the plant to branch ring rot.

[0016] A second object of the present invention is to provide a probe set for detecting the SNP marker combination for auxiliary selection of apple branch ring rot resistance, including GenoBaits DNA probes for detecting SNP1 to SNP4.

[0017] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP1 is shown in SEQ ID NO.5.

[0018] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP2 is shown in SEQ ID NO.6.

[0019] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP3 is shown in SEQ ID NO.7.

[0020] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP4 is shown in SEQ ID NO.8.

[0021] The third purpose of the present invention is to use this group of SNP marker combinations selected for apple stem ring rot resistance to identify the disease resistance of apple germplasm resources, explore excellent disease-resistant germplasms, create new disease-resistant materials, and at the same time improve the work efficiency of parent selection and combination matching, thereby further improving breeding efficiency.

[0022] A fourth object of the present invention is to provide a use of the SNP marker combination or the probe group in preparing a kit for determining resistance to apple stem ring rot.

[0023] Preferably, the kit comprises the SNP marker combination or the probe set.

[0024] A fifth object of the present invention is to provide the use of the SNP marker combination, the probe group or the kit in determining resistance to apple stem ring rot.

[0025] Preferably, the method comprises the following steps:

[0026] Extract genomic DNA from the tested Malus plants.

[0027] The genomic DNA of the tested Malus plant is used as a template and the probe set is used to perform PCR amplification to obtain a PCR amplification product.

[0028] The PCR amplification products are subjected to typing detection.

[0029] The disease resistance of the tested Malus plant to branch and trunk ring rot is determined.

[0030] Preferably, resistance allele variation can occur at SNP1 to SNP4: wherein the resistance in the resistance allele variation refers to resistance to branch ring rot.

[0031] The resistance allele variation at the SNP1 is a T allele variation; when the T allele variation occurs at the SNP1, it is a genotype resistant to branch ring rot.

[0032] The resistance allele variation at the SNP2 is a C allele variation; when the C allele variation occurs at the SNP2, it is a genotype resistant to branch ring rot.

[0033] The resistance allele variation at the SNP3 is a C allele variation; when the C allele variation occurs at the SNP3, it is a genotype resistant to branch ring rot.

[0034] The resistance allele variation at the SNP4 is a G allele variation. When the G allele variation occurs at the SNP4, the genotype is resistant to branch ring rot.

[0035] When the number of resistance alleles at the SNP1 to SNP4 is 7 or 8, the tested Malus plant is highly resistant to branch ring rot.

[0036] After excluding the above-mentioned individual plants with high resistance to branch ring rot, if the number of resistance alleles at the SNP1 to the SNP4 is 4 to 6, the tested Malus plant is resistant to branch ring rot.

[0037] After excluding the above-mentioned individual plants with high resistance to branch ring rot and branch ring rot resistance, if the number of resistance alleles at the SNP1 to SNP4 is 1 to 3, the tested Malus plant is susceptible to branch ring rot.

[0038] When the number of resistance alleles at the SNP1 to SNP4 is 0, the tested Malus plant is highly susceptible to branch ring rot.

[0039] Preferably, the reaction conditions for the PCR amplification are 98° C. for 2 min; 7 cycles of 98° C. for 30 s, 65° C. for 30 s, and 72° C. for 40 s; and 72° C. for 4 min.

[0040] Preferably, the reaction system during PCR amplification is 10 μL of GenoBaits PCR Master Mix, 1 μL of GenoBaits Uni_oligo, 5 μL of GenoBaits DNA index, and 4 μL of Nuclease-free water.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] 1. The present invention provides a SNP marker combination for auxiliary selection of apple branch ring rot resistance, the SNP marker combination includes 4 main effect SNP markers related to apple branch ring rot resistance, that is, 4 SNP markers; the 4 SNP markers include SNP1 to SNP4. The nucleotide sequences of SNP1 to SNP4 are shown in SEQ ID NO.1 to SEQ ID NO.4 respectively. The SNP marker combination is suitable for molecular-assisted evaluation, screening and breeding program design of Malus germplasm resources. The SNP marker combination provided by the present invention has the advantages of simply and quickly determining the resistance of a certain apple fruit tree plant to branch ring rot, and the prediction result has extremely high accuracy, which can solve the problem that the current SSR markers are not accurate enough for the development and application of molecular markers for apple resistance to branch ring rot, and cannot accurately determine the resistance of the plant to branch ring rot.

[0043] 2. The present invention has developed four major SNP markers related to apple stem ring rot resistance, which are suitable for marker-assisted selection of apple stem ring rot resistance in breeding materials at the seedling stage.

[0044] 3. The present invention has developed four major SNP markers related to apple stem ring rot resistance, which are suitable for molecular-assisted evaluation of apple tree germplasm resources for apple stem ring rot resistance, as well as for screening excellent disease-resistant germplasm and designing breeding programs.

[0045] 4. This study developed four major SNP markers associated with resistance to apple stem ring rot, demonstrating low cost and high accuracy. Using these four major SNP markers, the severity of apple stem ring rot was predicted for 1,506 hybrids and germplasm samples from the genus Malus. The Pearson correlation coefficient between the number of resistance alleles and severity was r = 0.925 (n = 1,055). BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 This is the linear relationship between the number of resistance alleles and the severity of branch ring rot in the present invention. DETAILED DESCRIPTION

[0047] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0048] Example 1

[0049] 1. Phenotypic identification of resistance to apple stem ring rot

[0050] The resistance to apple stem ring rot was assessed using 361 Malus germplasm resources and 280 offspring lines of the 'Red Jade' x 'Golden Crown' hybrid population. Zz26, Ls1, LW048, and LW023 strains were used for inoculation for two consecutive years. The incidence of stem ring rot and the diameter of the lesions were used as disease resistance indicators for inoculation assessment.

[0051] 2. Discovery of resistance variation points for apple stem ring rot

[0052] BSA-seq was used to explore QTLs associated with branch ring rot resistance in the hybrid offspring population of 'Hongyu' × 'Jinguan'. A genome-wide association analysis was performed on apple branch ring rot resistance in 253 Malus germplasm resources, and a total of 40 significant association intervals associated with apple branch ring rot resistance were located.

[0053] Among them, the full English name of BSA-seq is bulked segregant analysis sequencing, which means bulked segregant group mixed analysis method.

[0054] The English abbreviation for genome-wide association study is GWAS, and its full English name is Genome Wide Association Study.

[0055] 3. Development of molecular markers for resistance to apple stem ring rot

[0056] Based on the variation type, gene expression level and functional annotation, the variation sites of candidate genes were selected in each QTL and GWAS interval related to apple stem ring rot resistance to develop molecular markers. A total of 40 SNP and InDel molecular markers were designed and distributed on 8 chromosomes, namely Chr00_11231274, Chr00_11240324, Chr00_23716755, Chr00_45990013, Chr02_13403916, Chr02_13473882, Chr02_16535802, Chr02_17279645Chr02_17693842, Chr02_18601387, Chr02_1865736 2. Chr02_20663119, Chr02_21547202, Chr02_21856203, Chr02_22956039, Chr02_23603449, Chr02_2535 0300, Chr02_28342525, Chr04_28954120, Chr05_5094005, Chr05_47489677, Chr10_24655771, Chr10_27 164253, Chr10_27354881, Chr10_27706538, Chr10_28057784, Chr10_29638773, Chr10_30268315, Chr10 _31603916, Chr10_34064311, Chr13_2622717, Chr14_24248741, Chr14_27043108, Chr14_29624750, Chr14_29833236, Chr14_29982606, Chr14_29996846, Chr14_30317685, Chr14_31432200, and Chr17_22317354. The markers were identified using the GenoBaits strategy, with target sequences captured using DNA probes, followed by marker genotyping using Illumina second-generation sequencing.

[0057] 4. Estimation of genotype effect values ​​of apple stem ring rot resistance markers and screening of major effect markers

[0058] A training population was constructed using 128 Malus germplasm resources and 208 hybrid lines of 'Hongyu' x 'Jinguan'. Genotyping for the aforementioned 40 molecular markers was performed using the GenoBaits strategy. The genotypic and marker effects of each marker on resistance to apple stem ring rot in the training population were estimated by comparing the phenotypic mean of the training population with the phenotypic mean of the entire training population at a specific locus. Markers with large marker effects were selected, and a total of four SNP markers were identified as major markers for resistance to apple stem ring rot.

[0059] Among them, the main effect markers of apple branch ring rot resistance are Chr00_23716755 C / T, Chr02_20663119 A / C, Chr14_24248741 A / C and Chr14_29982606 A / G.

[0060] Chr00_23716755 C / T is SNP1, and its nucleotide sequence is shown in SEQ ID NO.1:

[0061] TTTTTTAGTTGAATATAATATATAAATTGGATTCTCTACAAATCCTAAAAATAAGAGCTAATTCCATTTTACATGATTTAAGTTTGAGGTAATTCTTAAAATGGGTATGAACTTAAATTTTCCCACATTTGATGTTTTGATTTTTTTTATTATTTTATATATATTTGTCTCAGGCCCTGTTTGATATTATTTTTTCTCAT[C / T]AAAAACTACTTCACTTTACTGCCGCAACCATCTCTACCACTGCTGTCATTGTCACCACCCCCACTACAATGTCCACTTTTGTCACTATATACAATTATATCACTTTCACATTAAAATTTACCGAACACTGCTTTTCATACTTGCAACACTATTAAAAATACATTTTATCAAACGCTCAATTGCTTTATTTTACAAATGATT; wherein, there is a C to T mutation at the 201st bp position. The T allele variation of Chr00_23716755 C / T is a genotype resistant to branch ring rot.

[0062] SNP1 is a C to T mutation at position 23716755 on apple chromosome 0.

[0063] Chr02_20663119 A / C is SNP2, and its nucleotide sequence is shown in SEQ ID NO.2:

[0064] TTGTTTTTCTCAACCGGGTTCTGACCCAACCGCTTGTAACCCGACCCTGGCTTGCTGCAGCACAAAGATTTAGCCCCAGCGGACAGCTTCCGACCCCAGGTGAGCAGCCTTGACATGGGTTTGTAGCTGCAAGCCGAGGGAGAACCCGGGTTGAGCCGGGCATATTCGGGTCGGGTTCGGGTCCCACGGACGAAGAACCA[A / C]CGGCTGA CCCGGCAAAGGCGCTTTCCGAGCTTGAATCCTCTGAACCTTGCCATTTTTAAGGGAAAAAGGAGGAAAATCTGTCTTGTGCGTTCTGAAATTTGGGTTGAGAAGTGAATGGATTTTCGTCAGAGATTGACTTGGTTCAAGAAAATGGCCACGGGTCGGCCTCGGACATGGTGAGACGAGAGAGAGTTAAGC; among them, there is a mutation from A to C at 201bp. The C allele variant of Chr02_20663119A / C is a genotype resistant to branch ring rot.

[0065] SNP2 is a mutation from A to C at position 20663119 on apple chromosome 2.

[0066] Chr14_24248741 A / C is SNP3, and its nucleotide sequence is shown in SEQ ID NO.3:

[0067] TTTTCTTGTTCGATCAGTTCCTCTCACTGAAACTTGCTTCTTTGAATCCAATGTTCTTTGACTTTGGAATGGACATGGGTGCTTTAGTGGTTAAACCAGAGGTACATAGTTAAAAAGTATCAGTTATGTTCAATCCCACTTCACAGCGTTTTCAAACACAGGAATGAAAATCTTCCGTCCGTTTCTAGTCGGAATAG[A / C]CGAGAGTTT CATTCTCAAAAAACCTAATTCATGAACCAAAAATTACTAATGTAATTACAATTTGGTTTTTATTTTTTGCCATGCAGAGATTGTGTAGCATGGAATCACCATATCCATCTGTGCAACAATGCAACCCAATACAGTCCACACCTTTTGCTGATACATCCACCAATATCACTGCCACCACTGCCGCTGCCACT; among them, there is a mutation from A to C at 198bp. The C allele variant of Chr14_24248741 A / C is a genotype resistant to branch ring rot.

[0068] SNP3 is a mutation from A to C at position 24248741 on chromosome 14 of apple.

[0069] Chr14_29982606 A / G is SNP4, and its nucleotide sequence is shown in SEQ ID NO.4:

[0070] AGATAGCAAATGTACTGTTAATGTGCATTATAGTTTACCTGAAAGAAAGCCTTGCCCTCCTCGATCTCTTCAAGGATTTCTTTCTTTTGCTGGTCTATAACTTTGTATTTCTCAGAATCTATTGATCGGATGCTTACTGAACGTGAAGGCATTTTCTAGAAAAATATGCACAAATAATGTCATGTTAAAAACCAAAGCCA[A / G]TCTTCCTT AAAATATATACACAGAGCTCACAGGAGCATATGCTACAAGAGGGAAAGAAACTATAACCAAAAGAACGGAAAAATCAACTCAGATAATGCAAAGAAATTGTGTACCTCTTGCCCAGTATAGTTCCAAATCTCGGCAGACGAATTACACGATGGATCAAGACTCAAATACCCTTTATTTTTAAGAGGTACTATG; among them, there is a mutation from A to G at 201bp. The G allele variant of Chr14_29982606 A / G is a genotype resistant to branch ring rot.

[0071] SNP4 is a mutation from A to G at position 29982606 on apple chromosome 14.

[0072] The flanking sequence information for the four major SNP markers associated with apple stem ring rot resistance is shown below. The non-variant base (before) and the variant base (after) are indicated in brackets "[ ]," separated by a " / ."

[0073] The GenoBaits DNA probe sequence information corresponding to the four major SNP markers related to apple stem ring rot resistance is as follows:

[0074] The nucleotide sequence of the DNA probe used to detect SNP1 is shown in SEQ ID NO.5:

[0075] GCCCTGTTTGATATTATTTTTTCTCATCAAAAACTACTTCACTTTACTGCCGCAACCATCTCTACCACTGCTGTCATTGTCACCACCCCCACTACAATGTCCACTTTTGT.

[0076] The nucleotide sequence of the DNA probe used to detect SNP2 is shown in SEQ ID NO.6:

[0077] GGTGAGCAGCCTTGACATGGGTTTTGTAGCTGCAAGCCGAGGGAGAACCCGGGTTGAGCCGGGCATATTCGGGTCGGGTTCGGGTCCCACGGACGAAGAACCAACGGCTGA.

[0078] The nucleotide sequence of the DNA probe used to detect SNP3 is shown in SEQ ID NO.7:

[0079] ATCAGTTATGTTCAATCCACTTCACAGCGTTTTCAAACACAGGAATGAAAATCTTCCGTCCGTTTCTAGTCGGAATAGAGAAACGAGAGTTTCATTCTCAAAAAACCTA.

[0080] The nucleotide sequence of the DNA probe used to detect SNP4 is shown in SEQ ID NO.8:

[0081] CTATTGATCGGATGCTTACTGAACGTGAAGGCATTTTCTAGAAAAATATGCACAAATAATGTCATGTTAAAAACCAAAGCCAATCTTCCTTAAAATATATACACAGAGCT.

[0082] 5. Marker-assisted selection method for apple stem ring rot resistance

[0083] In the training population of this embodiment, the resistance allele variations of the four major SNP markers related to apple stem ring rot resistance are as follows:

[0084] The resistance allele variation at SNP1 is T allele variation; when T allele variation occurs at SNP1, it is a genotype resistant to branch ring rot.

[0085] The resistance allele variation at SNP2 is the C allele variation; when the C allele variation occurs at SNP2, it is a genotype resistant to branch ring rot.

[0086] The resistance allele variation at SNP3 is the C allele variation; when the C allele variation occurs at SNP3, it is a genotype resistant to branch ring rot.

[0087] The resistance allele at SNP4 is the G allele. When the G allele at SNP4 occurs, the plant will be resistant to branch ring rot.

[0088] The four major SNP markers associated with apple stem ring rot resistance exhibited additive effects. The following criteria were used to determine and select apple germplasm resources or hybrid progenies for stem ring rot resistance:

[0089] ① If the sum of the number of resistance alleles of the four major SNP markers related to apple branch ring rot resistance in the test sample is 7 or 8, the sample is determined to be highly resistant to apple branch ring rot.

[0090] ② If the sum of the number of resistance alleles of the four major SNP markers related to apple branch ring rot resistance in the sample to be tested is 4 to 6, the sample is determined to be resistant to apple branch ring rot.

[0091] ③ If the sum of the number of resistance alleles of the four major SNP markers related to apple branch ring rot resistance in the sample to be tested is 1 to 3, the sample is determined to be susceptible to apple branch ring rot.

[0092] ④ If the sum of the number of resistance alleles of the four major SNP markers related to apple branch ring rot resistance in the sample to be tested is 0, the sample is determined to be highly susceptible to apple branch ring rot.

[0093] From the above, we can see that the resistance of apple seedlings to apple branch ring rot can be predicted based on the four major SNP markers related to apple branch ring rot resistance, which greatly saves breeding time.

[0094] Example 2

[0095] In order to verify the feasibility of the four major SNP markers and probe sets related to apple stem ring rot resistance, the present invention conducted the following studies:

[0096] Based on the genotyping data of four major SNP markers related to apple stem ring rot resistance in 1506 apple accessions, the following were used to screen and judge the apple germplasm resources or hybrid offspring according to the complementary epistatic effects between the four major SNP markers related to apple stem ring rot resistance and the judgment and selection criteria for apple stem ring rot resistance:

[0097] like Figure 1As shown, 1506 apple materials were divided into 4 grades. Specifically, if the sum of the numbers of resistance alleles of the 4 major SNP markers related to the resistance to apple branch ring disease of the test sample is 7 or 8, the sample is judged to be highly resistant to apple branch ring disease; if the sum of the numbers of resistance alleles of the 4 major SNP markers related to the resistance to apple branch ring disease of the test sample is 4-6, the sample is judged to be resistant to apple branch ring disease; if the sum of the numbers of resistance alleles of the 4 major SNP markers related to the resistance to apple branch ring disease of the test sample is 1-3, the sample is judged to be susceptible to apple branch ring disease; if the sum of the numbers of resistance alleles of the 4 major SNP markers related to the resistance to apple branch ring disease of the test sample is 0, the sample is judged to be highly susceptible to apple branch ring disease.

[0098] From the above experimental results, it can be seen that the SNP marker combination provided by the present invention has comprehensive excellent alleles related to branch ring rot in wild species and related species of the genus Malus, has accurate prediction, and covers multiple allele sites, and can integrate excellent alleles related to apple branch ring rot in wild species and related species of the genus Malus. It can solve the problem that the existing SNP marker combination has limited comprehensiveness and application effect in predicting the degree of apple branch ring rot in molecular assisted breeding, and is difficult to meet the needs of precise breeding.

[0099] It should be noted that when the present invention involves a numerical range, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes a preferred embodiment.

[0100] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once the basic inventive concepts become known, and all such changes and modifications fall within the scope of the present invention.

Claims

1. A probe set for detecting SNP marker combinations for assisted selection of apple stem ring rot resistance, characterized in that: The SNP marker combination includes SNP1 to SNP4; SNP1 is a C-to-T mutation at position 23716755 of apple chromosome 0, and its nucleotide sequence is shown in SEQ ID NO.1; SNP2 is a mutation from A to C at position 20663119 on apple chromosome 2, and its nucleotide sequence is shown in SEQ ID NO. 2; SNP3 is a mutation from A to C at position 24248741 on chromosome 14 of apple, and its nucleotide sequence is shown in SEQ ID NO. 3; SNP4 is an A to G mutation at position 29982606 of chromosome 14 of apple, and its nucleotide sequence is shown in SEQ ID NO. 4; The nucleotide sequences of the GenoBaits DNA probe for detecting SNP1 are shown in SEQ ID NO. 5; The nucleotide sequences of the GenoBaits DNA probe for detecting SNP2 are shown in SEQ ID NO. 6; The nucleotide sequences of the GenoBaits DNA probe for detecting SNP3 are shown in SEQ ID NO. 7; The nucleotide sequence of the GenoBaits DNA probe for detecting SNP4 is shown in SEQ ID NO.

8.

2. Use of the probe set according to claim 1 in preparing a kit for determining resistance to apple stem ring rot.

3. Use of the probe set according to claim 1 in determining resistance to apple stem ring rot, characterized in that: Resistance allele variation can occur at SNP1 to SNP4: the resistance in the resistance allele variation refers to the resistance to branch ring rot; The resistance allele variation at SNP1 is the T allele variation; the resistance allele variation at SNP2 is the C allele variation; the resistance allele variation at SNP3 is the C allele variation; the resistance allele variation at SNP4 is the G allele variation; When the number of resistance alleles at SNP1 to SNP4 is 7 or 8, the tested apple plant is highly resistant to branch ring rot; After excluding the above-mentioned plants with high resistance to branch ring rot, if the number of resistance alleles at SNP1 to SNP4 is 4 to 6, the tested Malus plants are resistant to branch ring rot; After excluding the above-mentioned plants with high resistance to branch ring rot and those resistant to branch ring rot, if the number of resistance alleles at SNP1 to SNP4 is 1 to 3, the tested Malus plants are susceptible to branch ring rot; When the number of resistance alleles at SNP1 to SNP4 is 0, the tested Malus plant is highly susceptible to branch ring rot.

4. The use according to claim 3, characterized in that The method for determining resistance to apple stem ring rot includes the following steps: extracting genomic DNA from the tested Malus plant; Using the genomic DNA of the tested Malus plant as a template, performing PCR amplification using the probe set to obtain a PCR amplification product; Performing typing detection on the PCR amplification product; The disease resistance of the tested Malus plant to branch and trunk ring rot is determined.

5. The use according to claim 4, characterized in that The reaction conditions for the PCR amplification were 98° C. for 2 min; 7 cycles of 98° C. for 30 s, 65° C. for 30 s, and 72° C. for 40 s; and 72° C. for 4 min.

Citation Information

Patent Citations

  • SCAR molecule marking method for detecting apple tree trunk ring spot resistance gene

    CN101864481A