Preparation method and application of organic electrochemical transistor biosensor based on optical gain

Abstract

The invention belongs to the technical field of biosensors, and particularly relates to a preparation method and application of an organic electrochemical transistor biosensor based on optical gain. According to the invention, photoelectric active materials CdS QDs and MB are integrated as grid components, so that the ion mobility in an electrolyte solution is enhanced; the electrochemical sensor and the OECT are integrated, and the OECT biosensor based on optical gain is constructed. Under light stimulation, the OECT can convert light energy into current modulation. Compared with the dark condition, the current modulation is increased by 2.72 times, and good redox potential distinguishability is shown. Besides, the OECT sensor can be applied to FB1 detection, the signal change of the biosensor reaches the mA order of magnitude through OECT signal transduction, and the OECT sensor has high sensitivity and good selectivity, can be widely applied to biomolecule detection and has wide application prospects in the fields of food safety, environmental pollutant detection and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of biosensors, and particularly relates to a preparation method and application of an organic electrochemical transistor biosensor based on optical gain. Background Art

[0002] With the continuous growth of the demand for biological detection, electrochemical biosensors have become a research hotspot due to their advantages such as high sensitivity, low cost, and easy integration. Electrochemical biosensors usually rely on an indirect electrochemical conversion mechanism to accurately convert the recognition event of biomolecules into an electrical signal. During operation, when the target molecule binds to the biorecognition element, it triggers a change in the electron transfer between the electrode and the redox probe molecule, which in turn leads to a change in the current or potential of the working electrode, thereby realizing the detection of the target molecule. However, the signal magnitude of traditional electrochemical biosensors is limited by the surface area of the electrode, which to some extent restricts the further improvement of their performance.

[0003] To solve this problem, organic electrochemical transistors (OECTs) have emerged as an ideal alternative to traditional electrode systems in sensing applications, capable of providing in-situ signal transduction and electrochemical amplification functions. In an OECT-based electrochemical biosensor, the interaction between the target molecule and the interface of the gate electrode (i.e., the working electrode) induces ion migration in the electrolyte, which in turn triggers the doping and dedoping processes of the OECT channel material, ultimately manifested as a change in the modulation of the source-drain current (I DS ). Improving the ion mobility of OECTs is the key to enhancing I DS , which usually requires the preparation of special materials and the optimization of electrode structures. Although the development of new materials has brought opportunities for improving the performance of OECTs, it has also introduced challenges in terms of preparation complexity and stability. Therefore, it is crucial to explore new methods to improve the analytical performance of OECTs. Summary of the Invention

[0004] The present invention aims to achieve dual modulation of ion migration by integrating a bifunctional optoelectroactive layer composed of cadmium sulfide quantum dots (CdS QDs) and methylene blue (MB), and by applying voltage and light; the redox reaction occurring at the gate interface promotes the ion migration of the electrolyte solution, affects the channel carrier density, and thus affects the modulation of I DS ; further, the light excites electrons in the optoelectroactive layer, resulting in the generation of additional carriers in the gate, further promoting ion migration, and thus amplifying the modulation of I DS ; integrating an electrochemical sensor with an OECT to construct an OECT biosensor based on optical gain, and ultimately achieving highly sensitive, highly accurate, and highly selective detection of fumonisin B1 (FB1).

[0005] A preparation method of an organic electrochemical transistor biosensor based on optical gain, comprising the following steps:

[0006] (1) Preparation of cadmium sulfide quantum dot solution:

[0007] S1. First, deionized water is degassed with nitrogen, then cadmium chloride solid and mercaptoacetic acid are added to obtain a mixed solution. Subsequently, the pH is adjusted with sodium hydroxide and stirred at a certain temperature for a period of time, denoted as solution A;

[0008] Furthermore, in S1 of step (1), the dosage relationship of the deionized water, cadmium chloride solid, and mercaptoacetic acid is 50 mL: 0.0917 g: 250 μL; the pH is adjusted to 11, the certain temperature is 45 °C, and the stirring time is 30 min;

[0009] S2. Sodium sulfide solution is added to solution A, and reacted at a certain temperature under a nitrogen atmosphere for a period of time to obtain a pale yellow cadmium sulfide quantum dot stock solution; after centrifugation, washing, and drying, a dry product is obtained, and the dry product is redissolved in deionized water to obtain a cadmium sulfide quantum dot solution, denoted as CdS QDs solution;

[0010] Furthermore, in S2 of step (1), the volume ratio of the sodium sulfide solution to solution A is 1: 10 - 11 mL, where the concentration of the sodium sulfide solution is 0.1 M; the certain temperature condition is 110 °C, and the reaction time is 4 h; the concentration of the CdS QDs solution is 0.3 mg mL -1 。

[0011] (2) Preparation of complementary DNA - DNA tetrahedron composite structure solution:

[0012] Take five single - stranded DNA solids, denoted as S1, S2, S3, Apt, and cDNA, and dissolve them in TE buffer respectively to obtain five TE dissolution solutions; subsequently, the five TE dissolution solutions are mixed in equal proportions to obtain a DNA mixed solution; finally, tris(2 - carboxyethyl)phosphine is added to the DNA mixed solution and diluted with TM buffer to obtain a dilution solution, and a heating reaction is carried out. After the heating reaction, a cooling reaction is carried out, and a complementary DNA - DNA tetrahedron composite structure solution, denoted as cDNA - TDN solution, is obtained after the reaction.

[0013] In step (2), the concentration of each of the five TE dissolution solutions is 100 μM; the concentration of the dilution solution after dilution with TM buffer is 2 μM; the final concentration of TCEP in the cDNA - TDN solution is 3 mM; the temperature of the heating reaction is 95 °C, and the reaction duration is 2 min; the cooling reaction is to cool to 4 °C, and the cooling reaction time is 10 min;

[0014] The sequences of S1, S2, S3, Apt, and the 5' to 3' end of cDNA are as follows:

[0015] S1,

[0016] TATCACCAGGCAGTTGATCATGGTATAAGGTAATGCGAAGATGCGAGGGTCCAATACG;

[0017] S2,

[0018] ATCAACTGCCTGGTGATAAAACGACACTACGTGGGAACTCGCAGACGTAATTGAATAA;

[0019] S3,

[0020] AATTGAATAAGCTGGTATAAGTTCCCACGTAGTGTCGTTTCGTATTGGACCCTCGCAT;

[0021] Apt,

[0022] ATACCAGCTTATTCAATTAATCGCATTACCTTATACCAGCTTATTCAATTACGTCTGCACAT ACCAGCTTATTCAATTAGATAGTAAGTGCAATCT;

[0023] cDNA, SH-AGATTGCACGGACTATCTAATTGAATAAGC.

[0024] (3) Pretreatment of indium tin oxide electrode: First, boil the indium tin oxide (ITO) electrode in NaOH solution for a period of time, and then ultrasonically treat it in ethanol and distilled water for a period of time respectively; Subsequently, dry the electrode at room temperature to obtain the pretreated ITO electrode;

[0025] Furthermore, the concentration of the NaOH solution in step (3) is 1M, and the boiling time for a period of time is 1h; The ultrasonic treatment time for a period of time is 15min.

[0026] (4) Preparation of channel semiconductor solution:

[0027] Mix OE-000 type PEDOT:PSS, APY-30 type PEDOT:PSS, ethylene glycol and silane coupling agent in proportion, and after ultrasonic treatment, the obtained mixture is the channel semiconductor solution;

[0028] Further, the volume ratio of the OE-000 type PEDOT:PSS, APY-30 type PEDOT:PSS, ethylene glycol, and silane coupling agent in step (4) is 100:10:5:4; the time for ultrasonic treatment is 30 min.

[0029] (5) Preparation of organic electrochemical transistor:

[0030] First, use computer drawing software to design the shape of the organic electrochemical transistor as required. Select ITO as the substrate and perform laser etching on the ITO according to the designed shape by laser etching method to prepare an ITO substrate; the ITO substrate includes a channel region.

[0031] Then, pre-treat the ITO substrate according to the operation in step (3). After pre-treatment, dry the ITO substrate in an N2 atmosphere to obtain a dried ITO substrate; then clean the dried ITO substrate to obtain a processed ITO substrate; spin-coat the channel semiconductor solution prepared in step (4) on the channel region of the processed ITO substrate at a low rotation speed not higher than 500 rpm for a period of time, and then continue to spin-coat at a high rotation speed greater than 1000 rpm for a period of time; after coating, heat it at a certain temperature for a period of time to obtain an ITO substrate containing the channel semiconductor solution, denoted as OECT.

[0032] Further, in step (5), the OECT includes a channel (1), a source electrode (2), a drain electrode (3), a first source lead (4), a second source lead (6), a first drain lead (5), and a second drain lead (7); the channel region is the channel (1), and the channel (1) is located at the central axis position of the ITO substrate and is rectangular; a source electrode (2) and a drain electrode (3) are respectively arranged on both sides of the channel (1), and the two are rectangles of the same size and are mirror images of each other; the lower end of the drain electrode (3) extends horizontally to form a first section of the drain lead (5), and the drain electrode (3) and the first section of the drain lead (5) are integrally in an "L" shape; the end of the first section of the drain lead (5) extends vertically downward to form a rectangular second drain lead (7), and the first section of the drain lead (5) and the second drain lead (7) integrally form a shape structure;

[0033] The lower end of the source electrode (2) extends horizontally to form a first section of the source lead (4), and the end of the first section of the source lead (4) extends vertically downward to form a second rectangular source lead (6); the overall shape of the source electrode (2), the first section of the source lead (4), and the second source lead (6) is mirror-symmetric to the overall shape of the drain electrode (3), the first section of the drain lead (5), and the second drain lead (7); the first section of the source lead (4) and the first section of the drain lead (5) are independent of each other and have no direct connection.

[0034] Among them, the length of the channel (1) is 6.5 mm and the width is 0.15 mm; the length of the source electrode (2) is 6.5 mm and the width is 0.5 mm; the length of the drain electrode (3) is 6.5 mm and the width is 0.5 mm; the length of the first source lead (4) is 3.5 mm and the width is 0.5 mm; the length of the second source lead (6) in the second section is 7.5 mm and the width is 3 mm; the length of the first drain lead (5) in the first section is 3.5 mm and the width is 0.5 mm; the length of the second drain lead (7) in the second section is 7.5 mm and the width is 3 mm; the distance 8 between the source lead (6) and the drain lead (7) is 2.15 mm.

[0035] Further, in step (5), the cleaning is carried out in a plasma cleaner for 30 s; the low rotation speed is 500 rpm and the spin coating time is 10 s; the high rotation speed is 1200 rpm and the spin coating time is 30 s; a certain heating temperature is 130 °C and the heating time is 20 min.

[0036] (6) Drop the CdS QDs solution prepared in step (1) onto the surface of the pretreated ITO electrode. After the first incubation, drop the cDNA-TDN solution prepared in step (2) and carry out the second incubation. After incubation, wash with PBS buffer; then immerse the electrode in the methylene blue (MB) solution, and the electrochemical biosensor is obtained after immersion.

[0037] Further, in step (6), the volume of the CdS QDs solution is 20 μL, the temperature of the first incubation is 37 °C and the incubation time is 1 h; the volume of the cDNA-TDN solution is 20 μL, the temperature of the second incubation is 4 °C and the incubation time is 12 h; the concentration of the methylene blue (MB) solution is 2.5 μg mL -1 , and the immersion time is 9 - 13 min.

[0038] (7) Using the electrochemical biosensor prepared in step (6) as the working electrode, the source of the OECT prepared in step (5) as the counter electrode, the drain as the second working electrode, and Ag / AgCl as the reference electrode, an OECT biosensor is constructed.

[0039] The present invention also relates to the use of an organic electrochemical transistor biosensor based on optical gain, and the steps are as follows:

[0040] (1) First, prepare FB1 solutions with different concentrations; then, take multiple OECT biosensors constructed in the above steps, modify the working electrode surfaces with FB1 solutions of different concentrations respectively, and incubate at room temperature for a period of time to obtain a biosensor interface that has completed the recognition and detection; one concentration of FB1 solution corresponds to modifying one OECT biosensor, and there is a one-to-one correspondence between the concentration and the OECT biosensor;

[0041] (2) Using PBS solution as the electrolyte and a xenon lamp as the light source for irradiating the gate, select square wave voltammetry (SWV) on a CHI750E electrochemical workstation to detect the current of the OECT biosensor in step (1), denoted as I DS ;

[0042] Modify FB1 solutions with different concentrations, denoted as I DS -0, I DS -C1, I DS -C2, I DS -C3..., I DS -Cn, where C1, C2, C3..., Cn are the concentrations of the corresponding FB1 solutions; then subtract I DS -C1, I DS -C2, I DS -C3..., I DS -Cn from I DS -0 respectively, and denote the results as ΔI DS -C1, ΔI DS -C2, ΔI DS -C3,..., ΔI DS -Cn;

[0043] ΔI DS -C1, ΔI DS -C2, ΔI DS -C3,..., ΔI DS -Cn is positively correlated with the concentrations C1, C2, C3..., Cn of the FB1 solution, and a standard curve is constructed based on ΔI DS and the logarithm of the FB1 concentration;

[0044] Principle explanation: When testing the OECT biosensor with an FB1 concentration of 0, since the concentration of MB at the sensing interface is high, the electrochemical reaction (redox reaction) of MB at the gate interface promotes the ion injection of the electrolyte solution into PEDOT:PSS. At this time, I DS is modulated to a high level; at the same time, photoexcitation promotes the separation of electron-hole pairs of MB and CdS QDs, resulting in the generation of additional carriers at the gate interface, further promoting ion migration, thereby increasing I DSModulation; Testing the OECT biosensor prepared in step (1), due to the specific recognition of FB1 Apt for FB1, when FB1 is present, TDN is stripped from the electrode interface, the concentration of MB decreases, the electrochemical reaction of MB at the gate interface decreases, the ion injection in the channel weakens, I DS The modulation decreases; At the same time, the electron-hole separation of MB and CdS QDs weakens, and the number of additional carriers generated decreases, I DS The modulation further decreases.

[0045] (3) Detection of FB1 in the sample: First, pretreat the sample to obtain a sample solution; then modify the sample solution on the surface of the working electrode of the OECT biosensor, incubate according to the incubation conditions in step (1), and then continue to operate according to step (2). Finally, electrochemically detect the current of the sample and substitute it into the standard curve constructed in step (2) to achieve the use of detecting FB1 in an unknown sample.

[0046] Furthermore, in step (1), the concentration of the FB1 solution is 1 fg mL -1 -100 pg mL -1 , and the modification dosage is 20 μL; The room temperature incubation for a period of time is 40 - 60 min.

[0047] Furthermore, in step (2), the concentration of the PBS solution is 10 mM.

[0048] Advantages of the present invention:

[0049] (1) Significant current amplification effect: Compared with the traditional gate current, after introducing OECT, the current is greatly increased from the microampere (μA) level to the milliampere (mA) level, realizing efficient amplification of the current signal.

[0050] (2) Photoelectric dual-response characteristics: Different from the traditional OECT sensor, the OECT sensor constructed in the present invention has photoelectric dual-response ability. After introducing light into the gate interface, compared with the OECT sensor without light, the modulation ability of the source-drain current is significantly enhanced, and the amplification factor reaches 2.72 times.

[0051] (3) High sensitivity and selective detection: The light-gain OECT biosensor constructed in the present invention is used to detect FB1, showing high sensitivity and good selectivity, and successfully realizing the accurate detection of FB1 in mildewed samples. Description of the Drawings

[0052] Figure 1 It is a process diagram for constructing an OECT biosensor; among them, Figure A is a diagram of the components of the biosensor; Figure B is a diagram of the electron transfer mechanism at the sensing interface.

[0053] Figure 2 (A) is the TEM image of CdS QDs, and the inset is the size distribution diagram of CdS QDs; (B) is the photocurrent response diagrams of ITO / MB, ITO / CdS QDs, and ITO / CdS QDs / MB.

[0054] Figure 3 (A) is the structural design diagram of OECT, and the labels in the figure are: 1-channel, 2-source electrode, 3-drain electrode, 4-source lead 1, 5-drain lead 1, 6-source lead 2, 7-drain lead 2, 8-spacing; (B) is the transfer curve diagram of OECT; (C) is the optical gain effect diagram.

[0055] Figure 4 (A) is the feasibility experiment diagram; (B) is the optimization of the MB adsorption time; (C) is the optimization of the incubation time of FB1; (D) is the linear relationship diagram between the sensor of the present invention and the FB1 concentration. Detailed implementation manners

[0056] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings: The embodiments are carried out on the premise of the technical solution of the present invention, and detailed implementation steps and specific operation processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0057] The reagents mentioned in the present invention: Five kinds of single-stranded DNA solids (S1, S2, S3, Apt, cDNA) are all purchased from Shanghai Bioengineering Company;

[0058] The solutions used in the present invention: The DNA self-assembly solution is TM buffer (20 mM Tris, 50 mM MgCl2, pH = 8.0) and TE buffer (10 mM Tris, 1 mM EDTA, pH = 8.0); The electrode rinsing solution is 0.1 M PBS (pH = 7.4). All solutions are prepared with ultrapure water.

[0059] (1) Exploration of the synthesis of cadmium sulfide quantum dot solution

[0060] S1. First, deoxygenate 50 mL of deionized water with nitrogen, then add 0.0917 g of cadmium chloride and 250 μL of mercaptoacetic acid to obtain a mixed solution. Subsequently, adjust the pH of the mixed solution to 11 with sodium hydroxide. After adjusting the pH, stir at 45 °C for 30 min, and the resulting solution is denoted as solution A;

[0061] S2. Add 5 mL of 0.1 M sodium sulfide solution to 50 mL of the A solution in step S1, react at 110 °C for 4 h under a nitrogen atmosphere, and obtain a pale yellow cadmium sulfide quantum dot stock solution after the reaction; after centrifugation, washing, and drying, the obtained dried product is redissolved in deionized water to obtain a cadmium sulfide quantum dot solution, denoted as CdS QDs solution, 0.3 mg mL -1 ;

[0062] The morphology of the material was studied by measuring the TEM of cadmium sulfide quantum dots (CdS QDs). Take a TEM image of the CdS QDs solution, Figure 2 where (A) is the TEM image of CdS QDs, and the inset is the size distribution diagram of CdS QDs; it can be observed from Figure (A) that CdS QDs are in a uniform granular structure. The inset in Figure (A) shows that the size of CdS QDs mainly concentrates in the range of 3.5 nm - 7.5 nm.

[0063] (2) Exploration of the optoelectronic properties of the gate material

[0064] The specific exploration method is as follows: Set three groups of experiments, namely ITO / MB to measure photocurrent; ITO / CdS QDs to measure photocurrent; ITO / CdS QDs / MB to measure photocurrent. These three groups of experiments are denoted as group a, group b, and group c respectively.

[0065] The operation of group a is as follows: Modify 20 μL of MB solution (2.5 μg mL -1 ) onto the surface of the ITO electrode and incubate at 37 °C for 1 h; then detect its photocurrent in PBS solution using a CHI750E electrochemical workstation. It can be observed from Figure 2 (B) that there is almost no photocurrent at this time.

[0066] The operation of group b is as follows: Modify 20 μL of CdS QDs solution (0.3 mg mL -1 ) onto the surface of the ITO electrode and incubate at 37 °C for 1 h; then detect its photocurrent in PBS solution using a CHI750E electrochemical workstation. It can be observed from Figure 2 (B) that the photocurrent is relatively large at this time, indicating that light illumination excites the separation of electrons and holes in CdS QDs, resulting in a relatively large photocurrent.

[0067] The operation of group c is as follows: Modify 20 μL of CdS QDs solution (0.3 mg mL -1 ) onto the surface of the ITO electrode and incubate at 37 °C for 1 h; then, modify 20 μL of MB solution (2.5 μg mL -1 ) onto the electrode surface and incubate at 37 °C for 1 h; detect its photocurrent in PBS solution using a CHI750E electrochemical workstation; throughFigure 2 (B) It can be observed that the photocurrent is the largest at this time, indicating that there is an interaction between MB and CdS QDs, which improves the electron-hole separation rate and thus increases the photocurrent.

[0068] (3) Performance investigation of organic electrochemical transistors

[0069] S1. Mix OE-000 type PEDOT:PSS, APY-30 type PEDOT:PSS, ethylene glycol and silane coupling agent in a certain proportion and ultrasonicate for a period of time, which is recorded as the channel semiconductor solution; the volume ratio of OE-000 type PEDOT:PSS, APY-30 type PEDOT:PSS, ethylene glycol and silane coupling agent is 100:10:5:4; the ultrasonication time is 30 min.

[0070] S2. First, use computer drawing software to design the shape of the organic electrochemical transistor (OECT), including the channel region, source region, drain region, source lead region and drain lead region;

[0071] Then select ITO as the substrate and perform laser etching on the ITO according to the designed shape by laser etching method to prepare the ITO substrate.

[0072] Pretreat the ITO substrate. The operation is as follows: First, boil the ITO substrate in a 1M NaOH solution for 1 h, and then ultrasonicate it in ethanol and distilled water for 15 min respectively; subsequently, dry the electrode at room temperature to obtain the pretreated ITO substrate; and dry it in an N2 atmosphere; then, clean the pretreated ITO substrate in a plasma cleaner for 30 s to obtain the treated ITO substrate; spin-coat the channel semiconductor solution prepared in S1 on the channel region at a low speed of 500 rpm for 30 s, and then continue to spin-coat it at a high speed of 1200 rpm for 30 s; finally, heat the ITO substrate at 130 °C for 20 min to obtain the ITO substrate containing the channel semiconductor solution, which is recorded as OECT.

[0073] Among them, the OECT specifically includes a channel 1, a source 2, a drain 3, a source lead 1 4, a source lead 2 6, a drain lead 1 5 and a drain lead 2 7; the channel 1 is located at the central axis position of the ITO substrate and is rectangular; a source 2 and a drain 3 are respectively arranged on both sides of the channel 1, and they are rectangles of the same size and are mirror images of each other; the lower end of the drain 3 extends horizontally to form the first section of the drain lead 1 5, and the drain 3 and the drain lead 1 5 as a whole are in an "L" shape; the end of the first section of the drain lead 1 5 extends vertically downward to form a rectangular drain lead 2 7, and the drain lead 1 5 and the drain lead 2 7 as a whole form a [specific shape] structure;

[0074] The lower end of the source electrode 2 extends horizontally in the reverse direction to form the first section of the source lead 4. The end of the first section of the source lead 4 extends vertically downward to form the second rectangular source lead 6. The overall shape of the source electrode 2, the first source lead 4, and the second source lead 6 is mirror-symmetrical to that of the drain electrode 3, the first drain lead 5, and the second drain lead 7. The first source lead 4 and the first drain lead 5 are independent of each other and have no direct connection.

[0075] Among them, the length of the channel 1 is 6.5 mm and the width is 0.15 mm; the length of the source electrode 2 is 6.5 mm and the width is 0.5 mm; the length of the drain electrode 3 is 6.5 mm and the width is 0.5 mm; the length of the first source lead 4 is 3.5 mm and the width is 0.5 mm; the length of the second source lead 6 of the second section is 7.5 mm and the width is 3 mm; the length of the first drain lead 5 of the first section is 3.5 mm and the width is 0.5 mm; the length of the second drain lead 7 of the second section is 7.5 mm and the width is 3 mm; the distance 8 between the second source lead 6 and the second drain lead 7 is 2.15 mm.

[0076] S3. The specific method operation is as follows: Set up seven groups of experiments. Place the organic electrochemical transistor (OECT) in the electrolyte for 0 min, 20 min, 40 min, 60 min, 80 min, 100 min, and 120 min respectively, and test its transfer curve. These seven groups of experiments are respectively recorded as group a, group b, group c, group d, group e, group f, and group g.

[0077] The operation of group a is as follows: Using 10 mM PBS as the electrolyte solution, with Ag / AgCl as the working electrode, the source electrode of the OECT as the counter electrode and reference electrode, and the drain electrode of the OECT as the second working electrode. Under the condition that the source-drain voltage (V DS ) is set to -0.2 V, select linear sweep voltammetry (LSV) on the CHI750E electrochemical workstation to test the transfer curve of the OECT.

[0078] The operation of group b is as follows: Using 10 mM PBS as the electrolyte solution, with Ag / AgCl as the working electrode, the source electrode of the OECT as the counter electrode and reference electrode, and the drain electrode of the OECT as the second working electrode. Under the condition that V DS is set to -0.2 V, after placing the OECT in the electrolyte for 20 min, select LSV on the CHI750E electrochemical workstation to test the transfer curve of the OECT.

[0079] The operation of group c is as follows: Using 10 mM PBS as the electrolyte solution, with Ag / AgCl as the working electrode, the source electrode of the OECT as the counter electrode and reference electrode, and the drain electrode of the OECT as the second working electrode. Under the condition that V DSUnder the condition that the voltage is set to -0.2V, after placing the OECT in the electrolyte for 40 minutes, select LSV on the CHI750E electrochemical workstation to test the transfer curve of the OECT.

[0080] The operation of group d is as follows: Using 10 mM PBS as the electrolyte solution, with Ag / AgCl as the working electrode, the source of the OECT as the counter electrode and reference electrode, and the drain of the OECT as the second working electrode, set V DS Under the condition that the voltage is set to -0.2V, after placing the OECT in the electrolyte for 60 minutes, select LSV on the CHI750E electrochemical workstation to test the transfer curve of the OECT.

[0081] The operation of group e is as follows: Using 10 mM PBS as the electrolyte solution, with Ag / AgCl as the working electrode, the source of the OECT as the counter electrode and reference electrode, and the drain of the OECT as the second working electrode, set V DS Under the condition that the voltage is set to -0.2V, after placing the OECT in the electrolyte for 80 minutes, select LSV on the CHI750E electrochemical workstation to test the transfer curve of the OECT.

[0082] The operation of group f is as follows: Using 10 mM PBS as the electrolyte solution, with Ag / AgCl as the working electrode, the source of the OECT as the counter electrode and reference electrode, and the drain of the OECT as the second working electrode, set V DS Under the condition that the voltage is set to -0.2V, after placing the OECT in the electrolyte for 100 minutes, select LSV on the CHI750E electrochemical workstation to test the transfer curve of the OECT.

[0083] The operation of group g is as follows: Using 10 mM PBS as the electrolyte solution, with Ag / AgCl as the working electrode, the source of the OECT as the counter electrode and reference electrode, and the drain of the OECT as the second working electrode, set V DS Under the condition that the voltage is set to -0.2V, after placing the OECT in the electrolyte for 120 minutes, select LSV on the CHI750E electrochemical workstation to test the transfer curve of the OECT.

[0084] According to the results of the seven groups of experiments, through Figure 3 In figure (B) below, it can be seen that as the gate voltage (V G ) increases from 0V to 1.2V, I DS decreases from -1.35 mA to -39.2 μA, showing the typical behavior of the OECT working in the depletion mode, indicating that the OECT is successfully prepared and has good amplification ability;

[0085] According to the control results of the seven groups of experiments, through Figure 3(B) It can be seen that within 120 min, the transfer curves overlap well and the drift is negligible, confirming the good stability of the OECT.

[0086] (4) Exploration of the optical gain effect

[0087] The specific exploration method is as follows: Set up two groups of experiments, namely ITO / CdS QDs / MB test I under no-light conditions DS ; ITO / CdS QDs / MB test I under light illumination conditions DS , and these two groups of experiments are respectively recorded as group a and group b.

[0088] The operation of group a is as follows: Using 10 mM PBS as the electrolyte solution, ITO / CdS QDs / MB as the working electrode, Ag / AgCl as the reference electrode, the source of the OECT as the counter electrode, and the drain as the second working electrode. Set V DS to -0.2 V. Under the condition of no light illumination on the gate, select SWV test I DS modulation on the CHI750E electrochemical workstation. It can be observed that at this time, the I Figure 3 (B) modulation is small. DS

[0089] The operation of group b is as follows: Using 10 mM PBS as the electrolyte solution, ITO / CdS QDs / MB as the working electrode, Ag / AgCl as the reference electrode, the source of the OECT as the counter electrode, and the drain as the second working electrode. Set V DS to -0.2 V. Under the condition of light illumination on the gate, select SWV test I DS modulation on the CHI750E electrochemical workstation. It can be observed that at this time, the I Figure 3 (B) modulation increases by 2.72 times. DS

[0090] (5) Exploration of the feasibility of detecting FB1

[0091] The specific exploration method is as follows: Set up three groups of experiments, namely testing the gate current (I G ) and I DS modulation under light illumination conditions without the target FB1; testing I -1 and I G modulation under light illumination conditions with 10 fg mL DS of the target FB1; testing I -1 and I G modulation under light illumination conditions with 10 pg mL DS of the target FB1. These three groups of experiments are respectively recorded as group a, group b, and group c.

[0092] The operation of Group A is as follows: A CdS QDs solution with a volume of 20 μL and a concentration of 0.3 mg mL -1 is dropped onto the surface of the pretreated ITO electrode and incubated at 37 °C for 1 h. Subsequently, a solution of complementary DNA-DNA tetrahedron complex (cDNA-TDN) with a volume of 20 μL and a concentration of 2 μM is modified onto the surface of the ITO electrode, incubated at 4 °C for 12 h, and washed with PBS buffer. Subsequently, the electrode is immersed in a 2.5 μg mL -1 MB solution to adsorb MB for 11 min to obtain the prepared ITO gate. Using 10 mM PBS as the electrolyte solution, the prepared ITO gate as the working electrode, Ag / AgCl as the reference electrode, the source of the OECT as the counter electrode, and the drain as the second working electrode, set V DS to -0.2 V. Under the condition of gate illumination, select SWV on the CHI750E electrochemical workstation to test the gate current and I DS modulation. Through Figure 4 (A), it can be observed that both I G and I DS modulations are relatively large at this time.

[0093] The operation of Group B is as follows: A CdS QDs solution with a volume of 20 μL and a concentration of 0.3 mg mL -1 is dropped onto the surface of the pretreated ITO electrode and incubated at 37 °C for 1 h. Subsequently, a 20 μL cDNA-TDN solution with a concentration of 2 μM is modified onto the electrode surface, incubated at 4 °C for 12 h, and washed with PBS buffer. Subsequently, the electrode is immersed in a 2.5 μg mL -1 MB solution to adsorb MB for 11 min. Add 20 μL of 10 fg mL -1 target FB1 and incubate at room temperature for 50 min. Obtain the prepared ITO gate. Using 10 mM PBS as the electrolyte solution, the prepared ITO gate as the working electrode, Ag / AgCl as the reference electrode, the source of the OECT as the counter electrode, and the drain as the second working electrode, set V DS to -0.2 V. Under the condition of gate illumination, select SWV on the CHI750E electrochemical workstation to test I G and I DS modulation. Through Figure 4 (A), it can be observed that both I G and I DS modulations decrease at this time.

[0094] The operation of Group C is as follows: A CdS QDs solution with a volume of 20 μL and a concentration of 0.3 mg mL -1The CdS QDs solution was dropped onto the surface of the pretreated ITO electrode and incubated at 37 °C for 1 h. Subsequently, 20 μL of a 2 μM cDNA-TDN solution was modified onto the electrode surface and incubated at 4 °C for 12 h, and then washed with PBS buffer. Subsequently, the electrode was immersed in a 2.5 μg mL -1 MB solution to adsorb MB for 11 min. 20 μL of a 10 pg mL -1 target FB1 was added and incubated at room temperature for 50 min. The prepared ITO gate was obtained. Using 10 mM PBS as the electrolyte solution, the prepared ITO gate as the working electrode, Ag / AgCl as the reference electrode, the source of the OECT as the counter electrode, and the drain as the second working electrode, V DS was set to -0.2 V. Under the condition of gate illumination, SWV was selected on a CHI750E electrochemical workstation to test I G and I DS modulation. Through Figure 4 (A), it can be observed that at this time, the modulation of I G and I DS was further reduced, proving that the sensor can be used for FB1 detection.

[0095] (6) Optimization of MB adsorption time

[0096] 20 μL of a 0.3 mg mL -1 CdS QDs solution was dropped onto the surface of the pretreated ITO electrode and incubated at 37 °C for 1 h. Subsequently, 20 μL of a 2 μM cDNA-TDN solution was modified onto the electrode surface and incubated at 4 °C for 12 h, and then washed with PBS buffer. Subsequently, the electrode was immersed in a 2.5 μg mL -1 MB solution to adsorb MB for 1 - 13 min. SWV was selected on a CHI750E electrochemical workstation to test the current of the sensing interface MB.

[0097] Figure 4 (B) shows that from 1 to 9 min, the MB signal increased with the increase of the adsorption time and then tended to be stable, indicating that the adsorption of MB in the DNA double strand reached saturation. Therefore, 11 min was selected as the optimal concentration.

[0098] (7) Optimization of the reaction time of FB1

[0099] 20 μL of a 0.3 mg mL -1The CdS QDs solution was dropped onto the surface of the pretreated ITO electrode and incubated at 37 °C for 1 h. Subsequently, 20 μL of a cDNA-TDN solution with a concentration of 2 μM was modified onto the electrode surface and incubated at 4 °C for 12 h, and then washed with PBS buffer. Subsequently, the electrode was immersed in a 2.5 μg mL -1 MB solution to adsorb 11 min of MB. 20 μL of a 10 fg mL -1 target FB1 was added and incubated at room temperature for 10 - 60 min. The current of the sensing interface MB was measured by SWV on a CHI750E electrochemical workstation.

[0100] Figure 4 (C) shows that from 0 to 40 min, the MB signal decreased with the increase of the FB1 incubation time and then tended to be stable. Therefore, 50 min was selected as the optimal reaction time for FB1.

[0101] Example 1:

[0102] (1) Preparation of cadmium sulfide quantum dot solution:

[0103] First, 50 mL of deionized water was degassed with nitrogen, then 0.0917 g of cadmium chloride solid and 250 μL of mercaptoacetic acid were added to obtain a mixed solution. Subsequently, the pH was adjusted to 11 with sodium hydroxide and stirred at 45 °C for 30 min to obtain solution A; in the second step, 5 mL of a 0.1 M sodium sulfide solution was added to 50 mL of solution A, and the reaction was carried out at 110 °C for 4 h under a nitrogen atmosphere to obtain a pale yellow cadmium sulfide quantum dot stock solution; after centrifugation, washing, drying, and re-dissolving in deionized water, a 0.3 mg mL -1 cadmium sulfide quantum dot solution was obtained.

[0104] (2) Preparation of complementary DNA-DNA tetrahedron composite structure solution:

[0105] Five single-stranded DNA solids, denoted as S1, S2, S3, Apt, and cDNA, were separately dissolved in TE buffer to obtain TE dissolution solutions with a concentration of 100 μM; subsequently, the five TE dissolution solutions were mixed in equal proportions to obtain a DNA mixed solution; finally, tris(2-carboxyethyl)phosphine was added to the DNA mixed solution with a final concentration of 3 mM and diluted to 2 μM with TM buffer, and then incubated at 95 °C for 2 min and then rapidly cooled to 4 °C and incubated for 10 min. After the reaction, a cDNA-TDN solution could be obtained.

[0106] (3) Pretreatment of indium tin oxide electrode:

[0107] First, boil the indium tin oxide (ITO) electrode in a 1M NaOH solution for 1 h, and then ultrasonically treat it in ethanol and distilled water for 15 min each; subsequently, dry the electrode at room temperature to obtain a clean ITO working electrode.

[0108] (4) Preparation of the channel semiconductor solution:

[0109] Mix OE-000 type PEDOT:PSS, APY-30 type PEDOT:PSS, ethylene glycol, and silane coupling agent in a volume ratio of 100:10:5:4 and ultrasonically treat for 30 min, denoted as the channel semiconductor solution.

[0110] (5) Preparation of the organic electrochemical transistor:

[0111] First, use computer drawing software to design the shape of the organic electrochemical transistor (OECT), including the channel region, source region, drain region, source lead region, and drain lead region;

[0112] Then select ITO as the substrate and, through laser etching, perform laser etching on the ITO according to the designed shape to obtain the ITO substrate. Pretreat the ITO substrate. The operation is as follows: First, boil the ITO substrate in a 1M NaOH solution for 1 h, and then ultrasonically treat it in ethanol and distilled water for 15 min each; subsequently, dry the electrode at room temperature to obtain the pretreated ITO substrate;

[0113] Dry the pretreated ITO substrate in an N2 atmosphere; subsequently, clean the pretreated ITO substrate in a plasma cleaner for 30 s to obtain the treated ITO substrate; spin-coat the channel semiconductor solution prepared in S1 on the channel region at a low speed of 500 rpm for 30 s, and then continue to spin-coat at a high speed of 1200 rpm for 30 s; finally, heat the ITO substrate at 130 °C for 20 min to obtain the ITO substrate containing the channel semiconductor solution, denoted as OECT.

[0114] Among them, the OECT specifically includes a channel 1, a source 2, a drain 3, a source lead 1 4, a source lead 2 6, a drain lead 1 5, and a drain lead 2 7; the channel 1 is located at the central axis position of the ITO substrate and is rectangular; a source 2 and a drain 3 are respectively provided on both sides of the channel 1, and the two are rectangles of the same size and are mirror images of each other; the lower end of the drain 3 extends horizontally to form the first section of the drain lead 1 5, and the drain 3 and the drain lead 1 5 as a whole are in an "L" shape; the end of the first section of the drain lead 1 5 extends vertically downward to form a rectangular drain lead 2 7, and the drain lead 1 5 and the drain lead 2 7 as a whole form a shape structure;

[0115] The lower end of the source 2 extends horizontally in the reverse direction to form the first section of the source lead 4. The end of the first section of the source lead 4 extends vertically downward to form the second section of the rectangular source lead 6. The overall shape of the source 2, the first source lead 4, and the second source lead 6 is mirror-symmetrical to that of the drain 3, the first drain lead 5, and the second drain lead 7. The first source lead 4 and the first drain lead 5 are independent of each other and have no direct connection.

[0116] Among them, the length of the channel 1 is 6.5 mm and the width is 0.15 mm; the length of the source 2 is 6.5 mm and the width is 0.5 mm; the length of the drain 3 is 6.5 mm and the width is 0.5 mm; the length of the first source lead 4 is 3.5 mm and the width is 0.5 mm; the length of the second section of the source lead 6 is 7.5 mm and the width is 3 mm; the length of the first section of the drain lead 5 is 3.5 mm and the width is 0.5 mm; the length of the second section of the drain lead 7 is 7.5 mm and the width is 3 mm; the distance 8 between the source lead 6 and the drain lead 7 is 2.15 mm.

[0117] (6) A CdS QDs solution with a volume of 20 μL and a concentration of 0.3 mg mL -1 was dropped onto the surface of the pretreated ITO electrode and incubated at 37 °C for 1 h. Subsequently, a cDNA-TDN solution with a volume of 20 μL and a concentration of 2 μM was modified onto the electrode surface and incubated at 4 °C for 12 h, and then washed with PBS buffer. Subsequently, the electrode was immersed in a 2.5 μg mL -1 MB solution to adsorb 11 min of MB to obtain an electrochemical sensor.

[0118] (7) Using the electrochemical biosensor prepared in step (6) as the working electrode, the source of the OECT prepared in step (5) as the counter electrode, the drain as the second working electrode, and Ag / AgCl as the reference electrode, an OECT biosensor was obtained.

[0119] (8) Using a rice flour extract without FB1 as the solvent, FB1 solutions with different concentrations were prepared. According to the concentration, multiple OECT biosensors were taken, and FB1 solutions with concentrations of 0, 1 fg mL -1 , 10 fg mL -1 , 100 fg mL -1 ,

[0120] 1000 fg mL -1 , 10000 fg mL -1 , 100000 fg mL -1FB1 solution was incubated at room temperature for 50 min to obtain an OECT biosensor that had completed the recognition detection. One concentration of FB1 solution corresponded to one modified OECT biosensor, and there was a one-to-one correspondence between the concentration and the OECT biosensor.

[0121] (9) Using a PBS solution with a concentration of 10 mM as the electrolyte solution and a xenon lamp as the light source for the irradiation gate, SWV was selected on a CHI750E electrochemical workstation to detect the I of the OECT biosensor. DS .

[0122] First, organic electrochemical transistor biosensors modified with FB1 solutions at different concentrations (the concentrations were recorded as 0, 1, 10, 100, 1000, 10000, 100000 fg

[0123] mL -1 ) were tested, and the corresponding I DS was obtained and recorded as I DS -0, I DS -1, I DS -10, I DS -100, I DS -1000, I DS -10000, I DS -100000; I DS -1, I DS -10, I DS -100, I DS -1000, I DS -10000, I DS -100000 were respectively subtracted from I DS -0, and were recorded as ΔI DS -1, ΔI DS -10, ΔI DS -100, ΔI DS -1000, ΔI DS -10000, ΔI DS -100000; ΔI DS was positively correlated with the concentration of the FB1 solution, and a standard curve was constructed based on the logarithm of ΔI DS and the FB1 concentration.

[0124] Calculate the linear regression equation of the logarithm of the FB1 concentration (C FB1 ) and ΔI DS . The equation formula is ΔI DS = 0.0281lgC FB1 + 0.0068 as the linear equation of FB1 in actual detection.

[0125] (10) Detection of FB1 in the sample: The rice sample was stored in a humid environment for 3 days to induce mildew. The mildewed rice sample was ground into rice flour, and 3 g of the rice flour was soaked in a methanol-water (60:40, v / v, 30 mL) mixture. After extraction by shaking for 30 min, it was centrifuged at 6000 rpm for 15 min, and the supernatant was dialyzed with a 0.22 μm ultrafiltration membrane to obtain the extract of the mildewed rice sample. Then, 20 μL of the sample solution was modified on the surface of the working electrode of the OECT biosensor, incubated according to the incubation conditions in step (8), and then continued to be operated according to step (9). Finally, the current (I DS ) of the sample was detected electrochemically; the I DS value was substituted into the linear regression equation in Figure 4 (D) to obtain its detection value, as shown in Table 1 specifically.

[0126] Table 1: Detection of FB1 in the mildewed rice sample

[0127]

[0128]

[0129] As can be seen from Table 1, the OECT biosensor prepared in this example can sensitively and quantitatively detect FB1 in the sample to be detected accurately, and does not require professional training and is easy to operate.

[0130] Note: The above embodiments are only used to illustrate the present invention and do not limit the technical solutions described in the present invention; therefore, although this specification has described the present invention in detail with reference to the above embodiments, those of ordinary skill in the art should understand that the present invention can still be modified or equivalently replaced; and all technical solutions and their improvements that do not depart from the spirit and scope of the present invention shall be covered by the scope of the claims of the present invention.

Claims

1. A preparation method of an organic electrochemical transistor biosensor based on optical gain, characterized in that, The steps are as follows: (1) Preparation of cadmium sulfide quantum dot solution: S1. First, deionized water is degassed with nitrogen, then cadmium chloride solid and mercaptoacetic acid are added to obtain a mixed solution. Subsequently, the pH is adjusted with sodium hydroxide and stirred at a certain temperature for a period of time, denoted as solution A; S2. The sodium sulfide solution is added to solution A and reacted at a certain temperature under a nitrogen atmosphere for a period of time to obtain a pale yellow cadmium sulfide quantum dot stock solution; After centrifugation, washing, and drying, a dry product is obtained, and the dry product is redissolved in deionized water to obtain a cadmium sulfide quantum dot solution, denoted as CdS QDs solution; (2) Preparation of complementary DNA-DNA tetrahedron composite structure solution: Take five single-stranded DNA solids, denoted as S1, S2, S3, Apt, and cDNA, and dissolve them in TE buffer respectively to obtain five TE dissolution solutions; Subsequently, the five TE dissolution solutions are mixed in equal proportions to obtain a DNA mixed solution; Finally, tris(2-carboxyethyl)phosphine is added to the DNA mixed solution and diluted with TM buffer to obtain a dilution solution, and a heating reaction is carried out. After the heating reaction, a cooling reaction is carried out, and a complementary DNA-DNA tetrahedron composite structure solution, denoted as cDNA-TDN solution, is obtained after the reaction; (3) Pretreatment of indium tin oxide electrode: First, the ITO electrode is boiled in NaOH solution for a period of time, and then ultrasonically treated in ethanol and distilled water for a period of time respectively; Subsequently, the electrode is dried at room temperature to obtain a pretreated ITO electrode; (4) Preparation of channel semiconductor solution: Mix OE-000 type PEDOT:PSS, APY-30 type PEDOT:PSS, ethylene glycol, and silane coupling agent in proportion, and after ultrasonic treatment, the obtained mixed solution is the channel semiconductor solution; (5) Preparation of organic electrochemical transistor: First, use computer drawing software to design the shape of the organic electrochemical transistor as needed, select ITO as the substrate, and through laser etching method, laser etching is carried out on the ITO according to the designed shape to prepare an ITO substrate; the ITO substrate includes a channel region; Then, the ITO substrate is pretreated according to the operation in step (3), and the pretreated ITO substrate is dried in an N2 atmosphere to obtain a dried ITO substrate; then the dried ITO substrate is cleaned to obtain a treated ITO substrate; The channel semiconductor solution prepared in step (4) is spin-coated on the channel region of the treated ITO substrate at a low rotation speed not higher than 500 rpm for a period of time, and then continued to be spin-coated at a high rotation speed greater than 1000 rpm for a period of time; After coating, it is heated at a certain temperature for a period of time to obtain an ITO substrate containing the channel semiconductor solution, denoted as OECT; (6)Drop the CdS QDs solution prepared in step (1) onto the surface of the pretreated ITO electrode. After the first incubation, drop the cDNA-TDN solution prepared in step (2), conduct the second incubation, and wash with PBS buffer after incubation; Subsequently, immerse the electrode in methylene blue solution for adsorption for a period of time to obtain an electrochemical biosensor; (7)Use the electrochemical biosensor prepared in step (6) as the working electrode, the source of the OECT prepared in step (5) as the counter electrode, the drain as the second working electrode, and Ag / AgCl as the reference electrode to construct an OECT biosensor.

2. The preparation method of an organic electrochemistry transistor biosensor based on optical gain according to claim 1, wherein, In step (1), the dosage relationship of deionized water, cadmium chloride solid, and mercaptoacetic acid in S1 is 50 mL: 0.0917 g: 250 μL; the pH is adjusted to 11, a certain temperature is 45 °C, and the stirring time is 30 min; in S2, the volume ratio of the sodium sulfide solution to solution A is 1: 10 - 11 mL, where the concentration of the sodium sulfide solution is 0.1 M; a certain temperature condition is 110 °C, and the reaction time is 4 h; the concentration of the CdS QDs solution is 0.3 mg mL -1 .

3. The preparation method of an organic electrochemistry transistor biosensor based on optical gain according to claim 1, wherein (2) The concentrations of the five TE dissolution solutions are all 100 μM; the dilution concentration of the diluted TM buffer is 2 μM; the final concentration of TCEP in the cDNA-TDN solution is 3 mM; the temperature of the heating reaction is 95 °C, and the reaction duration is 2 min; the cooling reaction is to cool to 4 °C, and the cooling reaction time is 10 min; (3) The sequences of the 5' to 3' ends of S1, S2, S3, Apt, and cDNA are as follows: S1： TATCACCAGGCAGTTGATCATGGTATAAGGTAATGCGAAGATGCGAGGGTCCAATACG; S2： ATCAACTGCCTGGTGATAAAACGACACTACGTGGGAACTCGCAGACGTAATTGAATAA; S3： AATTGAATAAGCTGGTATAAGTTCCCACGTAGTGTCGTTTCGTATTGGACCCTCGCAT; Apt: ATACCAGCTTATTCAATTAATCGCATTACCTTATACCAGCTTATTCAATTACGTCTGCACATACCAGCTTATTCAATTAGATAGTAAGTGCAATCT; cDNA: SH-AGATTGCACGGACTATCTAATTGAATAAGC.

4. The preparation method of an organic electrochemical transistor biosensor based on optical gain according to claim 1, wherein (3) The concentration of the NaOH solution in step (3) is 1 M, and the boiling time is 1 h; the ultrasonic treatment time is 15 min.

5. The preparation method of an organic electrochemical transistor biosensor based on optical gain according to claim 1, characterized in that, (4) The volume ratio of OE-000 type PEDOT:PSS, APY-30 type PEDOT:PSS, ethylene glycol, and silane coupling agent in step (4) is 100:10:5:4; the ultrasonic treatment time is 30 min.

6. The preparation method of an organic electrochemistry transistor biosensor based on optical gain according to claim 1, wherein, In step (5), the OECT includes a channel (1), a source electrode (2), a drain electrode (3), a first source lead (4), a second source lead (6), a first drain lead (5), and a second drain lead (7); the channel region is the channel (1), and the channel (1) is located at the central axis position of the ITO substrate and is strip-shaped; a source electrode (2) and a drain electrode (3) are respectively arranged on both sides of the channel (1), and the two are rectangles of the same size and are mirror images of each other; the lower end of the drain electrode (3) extends horizontally to form a first section of the drain lead (5), and the drain electrode (3) and the first section of the drain lead (5) are integrally in an "L" shape; the end of the first section of the drain lead (5) extends vertically downward to form a rectangular second drain lead (7), and the first drain lead (5) and the second drain lead (7) are integrally formed into a shape structure; (12) The lower end of the source electrode (2) extends horizontally to form the first section of the source electrode lead one (4), and the end of the first section of the source electrode lead one (4) extends vertically downward to form the second section of the rectangular source electrode lead two (6); the overall shape of the source electrode (2), the source electrode lead one (4), and the source electrode lead two (6) is mirror-symmetrical to the overall shape of the drain electrode (3), the drain electrode lead one (5), and the drain electrode lead two (7); among them, the source electrode lead one (4) and the drain electrode lead one (5) are independent of each other and have no direct connection; Among them, the length of the channel (1) is 6.5 mm and the width is 0.15 mm; the length of the source electrode (2) is 6.5 mm and the width is 0.5 mm; the length of the drain electrode (3) is 6.5 mm and the width is 0.5 mm; the length of the first source lead (4) is 3.5 mm and the width is 0.5 mm; the length of the second source lead (6) in the second section is 7.5 mm and the width is 3 mm; the length of the first drain lead (5) in the first section is 3.5 mm and the width is 0.5 mm; the length of the second drain lead (7) in the second section is 7.5 mm and the width is 3 mm; the distance 8 between the source lead (6) and the drain lead (7) is 2.15 mm; The cleaning is carried out in a plasma cleaner for 30 s; the low rotation speed is 500 rpm and the spin coating time is 10 s; the high rotation speed is 1200 rpm and the spin coating time is 30 s; the certain heating temperature is 130 °C and the heating time is 20 min.

7. The preparation method of an organic electrochemistry transistor biosensor based on optical gain according to claim 1, characterized in that In step (6), the volume of the CdS QDs solution is 20 μL, the temperature of the first incubation is 37 °C, and the incubation time is 1 h; the volume of the cDNA-TDN solution is 20 μL, the temperature of the second incubation is 4 °C, and the incubation time is 12 h; the concentration of the methylene blue solution is 2.5 μg mL -1 , and the soaking time is 9 - 13 min.

8. Use of the electrochemistry biosensor prepared by the method according to any one of claims 1-7 for detecting fumonisin B1, characterized in that, The steps are as follows: (1) First, prepare FB1 solutions with different concentrations; then take multiple OECT biosensors constructed in the above steps, modify FB1 solutions with different concentrations on the surface of the working electrode respectively, and incubate at room temperature for a period of time to obtain a biosensor interface that has completed the recognition and detection; one concentration of FB1 solution corresponds to modifying one OECT biosensor, and there is a one-to-one correspondence between the concentration and the OECT biosensor; (2) Using PBS solution as the electrolyte and a xenon lamp as the light source for irradiating the gate, select the square wave voltammetry detection step on the CHI750E electrochemical workstation to measure the current of the OECT biosensor in step (1), denoted as I DS ; Modify FB1 solutions with different concentrations, denoted as I DS -0, I DS -C1, I DS -C2, I DS -C3..., I DS -Cn, where C1, C2, C3..., Cn are the concentrations of the corresponding FB1 solutions; then subtract I DS -C1, I DS -C2, I DS -C3..., I DS -Cn from I respectively DS -0 for difference processing, denoted as ΔI DS -C1, ΔI DS -C2, ΔI DS -C3,...ΔI DS -Cn; ΔI DS -C1, ΔI DS -C2, ΔI DS -C3,...ΔI DS -Cn is positively correlated with the concentrations C1, C2, C3,..., Cn of the FB1 solution. According to ΔI DS and the logarithm of the FB1 concentration, a standard curve is constructed; (3) Detection of FB1 in the sample: First, pretreat the sample to obtain a sample solution; then modify the sample solution on the surface of the working electrode of the OECT biosensor, continue to operate according to step (2) after incubating according to the incubation conditions in step (1), and finally detect the current of the sample electrochemically and substitute it into the standard curve constructed in step (2) to achieve the use of detecting FB1 in an unknown sample.

9. The use according to claim 8, wherein In step (1), the concentration of the FB1 solution is 1 fg mL -1 -100 pg mL -1 , and the dosage of the modification is 20 μL; the incubation at room temperature for a period of time is 40 - 60 min.

10. The use according to claim 8, characterized in that, In step (2), the concentration of the PBS solution is 10 mM.

Images