Methods of using extracellular vesicles-ASO targeting STAT6

By combining antisense oligonucleotides (ASOs) targeting STAT6 transcripts with extracellular vesicles (EVs), the problem of poor stability and targeting of ASOs in vivo is solved, and more effective gene regulation and therapeutic effects are achieved.

CN120390802APending Publication Date: 2025-07-29LONZA SALES AG
View PDF 51 Cites 0 Cited by

Patent Information

Application Number
CN202380082639.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-11-29
Filing Date
2023-11-28
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

In the prior art, antisense oligonucleotides (ASOs) have poor stability and targeting in vivo, making it difficult to effectively deliver to target genes to treat related diseases.

Method used

Antisense oligonucleotides (ASOs) targeting STAT6 transcripts are used to deliver through extracellular vesicles (EVs), ensuring ASOs and EVs are associated with EVs, forming complexes containing scaffold proteins, and improving stability and targeting in vivo.

Benefits of technology

It improves the stability and targeting of ASO in vivo, enhances the regulatory effect of target genes, and provides more effective treatment methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005427013130000051
    Figure BDA0005427013130000051
  • Figure BDA0005427013130000081
    Figure BDA0005427013130000081
  • Figure BDA0005427013130000431
    Figure BDA0005427013130000431
Patent Text Reader

Abstract

The present disclosure relates to methods of administering an antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length, which contiguous nucleotide sequence is complementary to a nucleic acid sequence within a STAT6 transcript. In some aspects, the ASO is associated with an extracellular vesicle, such as an exosome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to methods of treating a disease or disorder in a subject in need thereof, comprising administering a dose of one or more antisense oligonucleotides (ASOs) that target the STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg. In some aspects, the ASO is attached to the surface of an EV. In some aspects, the ASO is attached to the outer surface of the EV. In certain aspects of the present disclosure, the extracellular vesicle further comprises a scaffold protein. Background Art

[0002] Exosomes are small extracellular vesicles that are naturally produced by every eukaryotic cell. Exosomes comprise a membrane that encloses an internal space (i.e., lumen). As drug delivery vehicles, EVs (e.g., exosomes) provide many advantages over traditional drug delivery methods as a new therapeutic modality in many therapeutic areas. Specifically, exosomes have inherently low immunogenicity, even when administered to different species.

[0003] Antisense oligonucleotides have emerged as a powerful means to regulate target gene expression in vitro or in vivo. However, there remains a need to improve the stability and targeting of ASOs in vivo. Thus, to better realize the therapeutic uses and other applications of EV-based technologies, new and more effective engineered EVs (e.g., exosomes), specifically engineered EVs that can be used to deliver therapeutic agents that can reduce the expression of genes associated with a disease (e.g., N of cancer) are necessary. Summary of the Invention

[0004] Some aspects of the present disclosure relate to a method of preventing or treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) that target the STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

[0005] Some aspects of the present disclosure relate to a method of increasing or enhancing the immune response of a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) targeting the STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a continuous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

[0006] In some aspects, the ASO is delivered by one or more extracellular vesicles (EVs). In some aspects, the one or more ASOs are associated with the one or more EVs.

[0007] In some aspects, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90% of the one or more ASOs are associated with the one or more EVs.

[0008] In some aspects, the dose is at least about 0.01 mg, at least about 0.05 mg, at least about 0.1 mg, at least about 0.5 mg, at least about 1 mg, at least about 2 mg, at least about 3 mg, at least about 4 mg, at least about 5 mg, at least about 6 mg, at least about 7 mg, at least about 8 mg, at least about 9 mg, at least about 10 mg, at least about 11 mg, at least about 12 mg, at least about 13 mg, at least about 14 mg, at least about 15 mg, at least about 16 mg, at least about 17 mg, at least about 18 mg, at least about 19 mg, at least about 20 mg, at least about 21 mg, at least about 22 mg, at least about 23 mg, at least about 24 mg, at least about 25 mg, at least about 26 mg, at least about 27 mg, at least about 28 mg, at least about 29 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 110 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 140 mg, at least about 150 mg, at least about 160 mg, at least about 170 mg, at least about 180 mg, at least about 190 mg, at least about 200 mg, at least about 220 mg or at least about 240 mg of the one or more ASOs. In some aspects, the dose is at least about 5 mg of the one or more ASOs. In some aspects, the dose is at least about 15 mg of the one or more ASOs. In some aspects, the dose is at least about 30 mg of the one or more ASOs. In some aspects, the dose is at least about 60 mg of the one or more ASOs.

[0009] In some aspects, the dose is administered about once a week, about once every two weeks, about once every three weeks or about once every four weeks. In some aspects, the dose is administered on about day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered on about day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered on about day 1 of the third 28-day cycle. In some aspects, after the third 28-day cycle, the dose is administered about once every 56 days.

[0010] In some aspects, the continuous nucleotide sequence is complementary to a nucleic acid sequence within nucleotides 1 to 2056 of the STAT6 transcript corresponding to the nucleotide sequence shown in SEQ ID NO:3, or is complementary to a nucleic acid sequence within nucleotides 2059 to 3963 of the STAT6 transcript corresponding to the nucleotide sequence shown in SEQ ID NO:3.

[0011] In some aspects, the ASO is an internucleotide oligomer, a chimeric oligomer or a fully modified oligomer. In some aspects, the ASO comprises one or more nucleoside analogs. In some aspects, one or more of the nucleoside analogs comprise 2'-O-alkyl-RNA. 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleic acid (ANA); 2'-fluoro-ANA; or bicyclic nucleoside analogs. In some aspects, one or more of the nucleoside analogs are sugar-modified nucleosides. In some aspects, the sugar-modified nucleoside is an affinity-enhanced 2'-sugar-modified nucleoside. In some aspects, one or more of the nucleoside analogs comprise nucleosides including bicyclic sugars. In some aspects, one or more of the nucleoside analogs comprise LNA. In some aspects, one or more of the nucleotide analogs are selected from the group consisting of constrained ethyl nucleoside (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA and any combination thereof. In some aspects, the ASO comprises one or more 5'-methyl-cytosine nucleobases.

[0012] In some aspects, the continuous nucleotide sequence is complementary to (i) a nucleic acid sequence within the 5' untranslated region (UTR); (ii) the coding region; or (iii) the 3' UTR of the target transcript. In some aspects, the continuous nucleotide sequence is complementary to a nucleic acid sequence comprising: (i) nucleotides 1–700 of SEQ ID NO:3; (ii) nucleotides 1000-1500 of SEQ ID NO:3; (iii) nucleotides 1500-2000 of SEQ ID NO:3; (iv) nucleotides 2000–2500 of SEQ ID NO:3; (v) positions 2500–3000 of SEQ ID NO:3; (vi) positions 3000–3700 of SEQ ID NO:3; (vii) nucleotides 413–803 of SEQ ID NO:3; (viii) nucleotides 952-1688 of SEQ ID NO:3; (ix) nucleotides 1726-2489 of SEQ ID NO:3; (x) nucleotides 2682–2912 of SEQ ID NO:3; (xi) positions 2970–3203 of SEQ ID NO:3; (xii) positions 3331–3561 of SEQ ID NO:3; (xiii) nucleotides 463–753 of SEQ ID NO:3; (xiv) nucleotides 1002-1638 of SEQ ID NO:3; (xv) nucleotides 1776-2439 of SEQ ID NO:3; (xvi) nucleotides 2682–2862 of SEQ ID NO:3; (xvii) positions 3020–3153 of SEQ ID NO:3; (xviii) positions 3381–3511 of SEQ ID NO:3; (xix) nucleotides 503–713 of SEQ ID NO:3; (xx) nucleotides 1042-1598 of SEQ ID NO:3; (xxi) nucleotides 1816-2399 of SEQ ID NO:3; (xxii) nucleotides 2722–2822 of SEQ ID NO:3; (xxiii) positions 3060–3113 of SEQ ID NO:3; or (xxiv) positions 3421–3471 of SEQ ID NO:3.

[0013] In some aspects, the continuous nucleotide sequence is complementary to a nucleic acid sequence within: (i) nucleotides 513–703 of SEQ ID NO:3; (ii) nucleotides 1052–1588 of SEQ ID NO:3; (iii) nucleotides 1826–2389 of SEQ ID NO:3; (iv) nucleotides 2732–2812 of SEQ ID NO:3; (v) positions 3070–3103 of SEQ ID NO:3; or (vi) positions 3431–3461 of SEQ ID NO:3.

[0014] In some aspects, the ASO comprises a nucleic acid sequence selected from GAAAGGTTCCGTCGGGC (SEQ ID NO:144), CTGAGTCGCTGAAGCGG (SEQ ID NO:145), GCCCTTGTACTTTTGCATAG (SEQ ID NO:193), GCAAGATCCCGGATTCGGTC (SEQ ID NO:185), and any combination thereof.

[0015] In some aspects, the continuous nucleotide sequence comprises a nucleotide sequence complementary to a sequence selected from Figure 1 the sequences in A-1B. In some aspects, the continuous nucleotide sequence is fully complementary to a nucleotide sequence within the target transcript. In some aspects, the ASO comprises a nucleotide sequence selected from SEQ ID NOs: 91-193, which has one or two mismatches. In some aspects, the ASO has a design selected from the group consisting of Figure 1 the designs in A-1B, where uppercase letters are sugar-modified nucleosides and lowercase letters are DNA.

[0016] In some aspects, the length of the ASO is 14 to 20 nucleotides.

[0017] In some aspects, the continuous nucleotide sequence comprises one or more modified internucleoside linkages. In some aspects, the one or more modified internucleoside linkages are phosphorothioate linkages. In some aspects, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the internucleoside linkages are modified. In some aspects, each internucleoside linkage in the ASO is a phosphorothioate linkage.

[0018] In some aspects, the ASO is linked to an anchoring moiety. In some aspects, the anchoring moiety comprises a sterol, GM1, a lipid, a vitamin, a small molecule, a peptide, or a combination thereof. In some aspects, the anchoring moiety comprises cholesterol. In some aspects, the anchoring moiety comprises a phospholipid, a lysophospholipid, a fatty acid, a vitamin (e.g., vitamin D and / or vitamin E), or any combination thereof. In some aspects, the anchoring moiety associates with the EV. In some aspects, the EV comprises a lipid bilayer, wherein the anchoring moiety associates with the lipid bilayer of the EV. In some aspects, the ASO is linked to the anchoring moiety on the outer surface of the EV. In some aspects, the ASO is linked to the anchoring moiety on the luminal surface of the EV. In some aspects, the ASO is linked to the anchoring moiety. In some aspects, the anchoring moiety comprises a scaffold moiety.

[0019] In some aspects, the ASO is linked to the EV via a linker. In some aspects, the linker is a polypeptide. In some aspects, the linker is a non-polypeptide moiety. In some aspects, the linker comprises ethylene glycol. In some aspects, the linker comprises HEG, TEG, PEG, or any combination thereof. In some aspects, the linker comprises acryloyl phosphoramidite (e.g., Acrydite TM ), adenylation, azide (NHS ester), digoxin (NHS ester), cholesterol-TEG, I-LINKER TM , an amino modifier (e.g., amino modifier C6, amino modifier C12, amino modifier C6 dT, or Uni-Link TM amino modifier), an alkyne, 5'-hexynyl, 5-octadiynyl dU, biotinylation (e.g., biotin, biotin (azide), biotin dT, biotin-TEG, dual biotin, PC biotin, or desthiobiotin), thiol modification (thiol modifier C3 S-S, dithiol, or thiol modifier C6 S-S), or any combination thereof. In some aspects, the linker is a cleavable linker. In some aspects, the linker comprises valine-alanine-p-aminobenzyl carbamate or valine-citrulline-p-aminobenzyl carbamate. In some aspects, the linker comprises (i) a maleimide moiety and (ii) valine-alanine-p-aminobenzyl carbamate or valine-citrulline-p-aminobenzyl carbamate.

[0020] In some aspects, the ASO comprises the nucleic acid sequence set forth in SEQ ID NO:185; and wherein the ASO has a sequence comprising LLLD 14Design of LLL, where L is LNA and D is DNA. In some aspects, each internucleoside bond in the ASO is a phosphorothioate bond. In some aspects, each RNA cytosine is 5'-methyl-cytosine. In some aspects, each DNA cytosine is 5'-methyl-cytosine. In some aspects, each RNA uracil is 5'-methyl uracil. In some aspects, each uracil is 5'-methyl uracil.

[0021] In some aspects, the ASO has a design including the following:

[0022] 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3'

[0023] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; and where "(s)" represents a phosphorothioate bond.

[0024] In some aspects, the ASO has a design including the following:

[0025] 5'GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3';

[0026] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

[0027] In some aspects, the ASO has a design including the following:

[0028]

[0029] In some aspects, the extracellular vesicles further comprise an exogenous targeting moiety. In some aspects, the exogenous targeting moiety comprises a peptide, an antibody or an antigen-binding fragment thereof, a chemical compound, an RNA aptamer, or any combination thereof.

[0030] In some aspects, the exogenous targeting moiety comprises a peptide. In some aspects, the exogenous targeting moiety comprises a microprotein, a designed ankyrin repeat protein (darpin), an anticalin, an adnectin, an aptamer, a peptidomimetic molecule, a natural ligand of a receptor, a camelid nanobody, or any combination thereof. In some aspects, the exogenous targeting moiety comprises a full-length antibody, a single-domain antibody, a heavy-chain-only antibody (VHH), a single-chain antibody, a shark heavy-chain-only antibody (VNAR), a scFv, an Fv, a Fab, a Fab', an F(ab')2, or any combination thereof. In some aspects, the antibody is a single-chain antibody.

[0031] In some aspects, the exogenous targeting moiety targets the exosomes to the liver, heart, lung, brain, kidney, central nervous system, peripheral nervous system, muscle, bone, joint, skin, intestine, bladder, pancreas, lymph node, spleen, blood, bone marrow, or any combination thereof. In some aspects, the exogenous targeting moiety targets the extracellular vesicles to tumor cells, dendritic cells, T cells, B cells, macrophages, neurons, hepatocytes, Kupffer cells, myeloid cells (e.g., neutrophils, monocytes, macrophages, hematopoietic stem cells, MDSCs (e.g., monocytic MDSCs or granulocytic MDSCs)), or any combination thereof.

[0032] In some aspects, the extracellular vesicles comprise a scaffold moiety that links the exogenous targeting moiety to the extracellular vesicles. In some aspects, the scaffold moiety is Scaffold X. In some aspects, the scaffold moiety is Scaffold Y. In some aspects, the extracellular vesicles are exosomes.

[0033] In some aspects, the ASO or the ASO and the extracellular vesicles are administered by a route selected from the group consisting of parenteral administration, topical administration, intravenous administration, oral administration, subcutaneous administration, intraarterial administration, intradermal administration, transdermal administration, rectal administration, intracranial administration, intraperitoneal administration, intrathecal administration, intranasal administration, intratumoral administration, intramuscular administration, inhalation, and any combination thereof.

[0034] In some aspects, the method further comprises administering a PD-1 antagonist to the subject. In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof that specifically binds to human PD-1 and blocks or inhibits the interaction between PD-1 and PD-L1 (“anti-PD-1 antibody”). In some aspects, the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, PDR001, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, GLS-010, AM-0001, STI-1110, AGEN2034, MGA012, IBI308, and any combination thereof. In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof that specifically binds to human PD-L1 and blocks or inhibits the interaction between PD-1 and PD-L1 (“anti-PD-L1 antibody”). In some aspects, the anti-PD-L1 antibody is selected from the group consisting of atezolizumab, durvalumab, avelumab, STI-1014, CX-072, KN035, LY3300054, CK-301, BMS-936559, and any combination thereof.

[0035] In some aspects, (i) the ASO or the ASO and the extracellular vesicles are administered simultaneously with (ii) the PD-1 antagonist. In some aspects, (i) the ASO or the ASO and the extracellular vesicles are administered sequentially with (ii) the PD-1 antagonist. In some aspects, (i) the ASO or the ASO and the extracellular vesicles are administered on different days from (i) the PD-1 antagonist.

[0036] In some aspects, the PD-1 antagonist is linked or associated with the extracellular vesicles.

[0037] In some aspects, the subject has cancer. In some aspects, the cancer is selected from the group consisting of: fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, squamous cell carcinoma of the head and neck, colorectal cancer, lymphoma, leukemia, liver cancer, gastric cancer, glioblastoma, melanoma, myeloma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, liver cancer, cholangiocarcinoma, choriocarcinoma, seminoma, non-seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, glioblastoma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, follicular lymphoma, Hodgkin's lymphoma, B-cell lymphoma, and any combination thereof. In some aspects, the cancer comprises hepatocellular carcinoma (HCC). In some aspects, the cancer comprises advanced HCC. In some aspects, the cancer comprises gastric cancer. In some aspects, the cancer comprises colorectal cancer. In some aspects, the cancer has metastasized to the liver. In some aspects, the cancer is refractory to prior therapy.

[0038] In some aspects, the method further comprises administering an additional anti-cancer agent. In some aspects, the additional anti-cancer agent comprises a standard of care therapy.

[0039] In some aspects, the amount of the one or more ASOs in the dose is measured using anion exchange chromatography (AEX). In some aspects, the AEX comprises AEX ultra-performance liquid chromatography (UPLC).

[0040] In some aspects, the amount of the one or more ASOs in the dose is measured using hydrophilic chromatography.

[0041] In some aspects, the amount of the one or more ASOs in the dose is measured using a ribogreen assay.

[0042] Some aspects of the present disclosure relate to an antisense oligonucleotide (ASO) comprising the nucleotide sequence set forth in SEQ ID NO: 185, wherein the ASO has a sequence comprising LLLD 14Design of LLL, where L is LNA and D is DNA. In some aspects, each internucleoside bond in the ASO is a phosphorothioate bond. In some aspects, each RNA cytosine is 5'-methyl-cytosine. In some aspects, each DNA cytosine is 5'-methyl-cytosine. In some aspects, each RNA uracil is 5'-methyl uracil. In some aspects, each uracil is 5'-methyl uracil.

[0043] In some aspects, the ASO has a design comprising:

[0044] 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3'

[0045] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; and where "(s)" represents a phosphorothioate bond.

[0046] In some aspects, the ASO has a design comprising:

[0047] 5'GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3';

[0048] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

[0049] In some aspects, the ASO has a design comprising:

[0050] Brief Description of the Drawings

[0051] Figure 1 is a table listing various ASO sequences targeting the STAT6 ( Figure 1 ). The table includes the following information (from left to right): (i) the description of the ASO; (ii) the ASO sequence without any specific design or chemical structure; (iii) the SEQ ID number assigned only to the ASO sequence; (iv) the ASO length; (v) the ASO sequence with a chemical structure; and (vi) the target start and end positions on the target transcript sequence (SEQ ID NO: 3). The ASOs are in the 5' to 3' order. The symbols in the chemical structure are as follows: Nb means LNA; dN means DNA; 5MdC means 5-methyl-dC; Nm means MOE; and s means phosphorothioate.

[0052] Figure 2 is a schematic diagram of exosomes overexpressing PTGFRN loaded with ASOs targeting STAT6.

[0053] Figures 3A - 3B is a representative chromatogram of exo-ASO-STAT6 obtained by anion exchange chromatography ultra-pure liquid chromatography (AEX-UPLC).

[0054] Figure 4 is an image of the chemical structure of the ASO design of the present disclosure. Detailed Description of the Invention

[0055] Some aspects of the present disclosure relate to methods of preventing or treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) that target the STAT6 transcript (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg. In some aspects, the ASO is delivered by one or more EVs. In some aspects, the one or more ASOs are associated with the one or more EVs. In some aspects, the ASO is linked to the surface of the EV. In some aspects, the ASO is linked to the outer surface of the EV. In some aspects, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of the one or more ASOs are associated with the one or more EVs.

[0056] I. Definitions

[0057] To facilitate understanding of the present description, certain terms are first defined. Other definitions are set forth throughout the detailed description.

[0058] Note that the term "a" or "an" entity refers to one or more of that entity; for example, "nucleotide sequence" is understood to mean one or more nucleotide sequences. Thus, the terms "a" or "an", "one or more", and "at least one" are used interchangeably herein.

[0059] In addition, the term "and / or" as used herein is considered to be a specific disclosure of each of the two specified features or components, with or without the other. Thus, the term "and / or" as used in phrases such as "A and / or B" herein is intended to include "A and B", "A or B", "A" (alone), and "B" (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to cover each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0060] It should be understood that whenever the language “comprising” is used to describe an aspect herein, aspects similar thereto are also provided as described by “consisting of” and / or “consisting essentially of”.

[0061] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd Edition, 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd Edition, 1999, Academic Press; and Oxford Dictionary Of Biochemistry And Molecular Biology, Revised Edition, 2000, Oxford University Press, provide a general dictionary of many of the terms used in this disclosure for the skilled person.

[0062] Units, prefixes, and symbols are expressed in their internationally accepted form of the International System of Units (SI). Numerical ranges include the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in a 5' to 3' orientation. Amino acid sequences are written left to right in an amino to carboxyl orientation. The headings provided herein are not limitations of the various aspects of the disclosure, which can be obtained by reference to the entire specification. Accordingly, the terms defined immediately below are more fully defined by reference to the entire specification.

[0063] The term “about” is used herein to mean approximately, roughly, around a certain region, or in a certain region. When the term “about” is used in conjunction with a numerical range, it modifies the range by extending the boundaries above and below the listed numerical values. Generally, the term “about” can modify a value above or below a specified value by, for example, a variance of 10% higher or lower (higher or lower). For example, if the statement is “The ASO reduces the expression of STAT6 protein in cells after administration of the ASO by at least about 60%”, it is implied that the STAT6 level is reduced in the range of 50% to 70%.

[0064] The term "antisense oligonucleotide" (ASO) refers to oligomers or polymers of nucleosides, such as naturally occurring nucleosides or their modified forms, which are covalently linked to each other via internucleotide bonds. The ASOs used in the present disclosure include at least one non-naturally occurring nucleoside. The ASO is at least partially complementary to the target nucleic acid such that the ASO hybridizes to the target nucleic acid sequence.

[0065] The term "nucleic acid" or "nucleotide" is intended to encompass a plurality of nucleic acids. In some aspects, the term "nucleic acid" or "nucleotide" refers to a target sequence in vivo or in vitro, such as pre-mRNA, mRNA or DNA. When the term refers to a nucleic acid or nucleotide in a target sequence, the nucleic acid or nucleotide can be a sequence that occurs naturally within a cell. In other aspects, "nucleic acid" or "nucleotide" refers to a sequence in the ASOs of the present disclosure. When the term refers to a sequence in an ASO, the nucleic acid or nucleotide can be non-naturally occurring, i.e., chemically synthesized, enzymatically produced, recombinantly produced, or any combination thereof. In some aspects, the nucleic acids or nucleotides in the ASO are synthetic or recombinantly produced but are not naturally occurring sequences or fragments thereof. In some aspects, the nucleic acids or nucleotides in the ASO are not naturally occurring because the nucleic acids or nucleotides contain at least one nucleoside analogue that is not inherently naturally occurring.

[0066] As used herein, the term "nucleotide" refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (bonding group), such as a phosphoester or phosphorothioate internucleotide bonding group, and encompasses naturally occurring nucleotides (such as DNA or RNA) and non-naturally occurring nucleotides comprising modified sugar and / or base moieties, which naturally occurring nucleotides and non-naturally occurring nucleotides are also referred to herein as "nucleotide analogues". In the present text, a single nucleotide may be referred to as a monomer or unit. In certain aspects, the term "nucleotide analogue" refers to a nucleotide having a modified sugar moiety. Non-limiting examples of nucleotides having a modified sugar moiety (e.g., LNA) are disclosed elsewhere herein. In other aspects, the term "nucleotide analogue" refers to a nucleotide having a modified nucleobase moiety. Nucleotides having a modified nucleobase moiety include, but are not limited to, 5-methyl-cytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, and 2-chloro-6-aminopurine. In some aspects, the terms "nucleotide", "unit" and "monomer" may be used interchangeably. It should be recognized that when referring to a sequence of nucleotides or monomers, what is being referred to is a sequence of bases (such as A, T, G, C or U and their analogues).

[0067] As used herein, the term "nucleoside" refers to a glycoside containing a sugar moiety and a base moiety, and can thus be used to refer to nucleotide units covalently linked by internucleotide bonds between nucleotides of an ASO. In the field of biotechnology, the term "nucleotide" is commonly used to refer to a nucleic acid monomer or unit. In the context of an ASO, the term "nucleotide" can refer to an individual base, i.e., a nucleobase sequence containing cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA), and uracil (RNA), where the presence of the sugar backbone and internucleotide bonds is implicit. Similarly, specifically in the case of an oligonucleotide in which one or more internucleotide bond groups in the internucleotide bond group are modified, the term "nucleotide" can refer to a "nucleoside". For example, the term "nucleotide" can be used, even when specifying the presence or nature of the bond between nucleosides.

[0068] As used herein, the term "nucleotide length" refers to the total number of nucleotides (monomers) in a given sequence. For example, the sequence of ASO-STAT6-1053 (SEQ ID NO:91) has 15 nucleotides; thus, the nucleotide length of this sequence is 15. Accordingly, the term "nucleotide length" is used interchangeably herein with "nucleotide number".

[0069] As will be appreciated by one of ordinary skill in the art, the 5'-terminal nucleotide of an oligonucleotide does not contain a 5'-internucleotide bond group, although it may contain a 5'-terminal group.

[0070] The compounds described herein can contain several asymmetric centers and can exist in the form of optically pure enantiomers, mixtures of enantiomers (e.g., racemates), mixtures of diastereomers, diastereomeric racemates, or mixtures of diastereomeric racemates. In some aspects, the asymmetric center can be an asymmetric carbon atom. The term "asymmetric carbon atom" means a carbon atom having four different substituents. According to the Cahn-Ingold-Prelog convention, an asymmetric carbon atom can be in the "R" or "S" configuration.

[0071] As used herein, the term "bicyclic sugar" refers to a modified sugar moiety containing a 4- to 7-membered ring, the ring containing a bridge connecting two atoms of the 4- to 7-membered ring to form a second ring, thereby forming a bicyclic structure. In some aspects, the bridge connects C2' and C4' of the ribose ring of a nucleoside (i.e., a 2'-4' bridge), as observed in LNA nucleosides.

[0072] The term "region", when used in the context of a nucleotide sequence, refers to a segment of said sequence. For example, the phrase "region within a nucleotide sequence" or "region within the complement of a nucleotide sequence" refers to a sequence that is shorter than the nucleotide sequence but longer than at least 10 nucleotides located within a specific nucleotide sequence or within the complement of a nucleotide sequence. The term "sub-sequence" or "subsequence" can also refer to a region of a nucleotide sequence.

[0073] As used herein, the term "transcript" can refer to the primary transcript synthesized by transcription of DNA and which, after processing, becomes messenger RNA (mRNA), i.e., precursor messenger RNA (pre-mRNA) and the processed mRNA itself. The term "transcript" can be used interchangeably with "pre-mRNA" and "mRNA". After transcription of a DNA strand into a primary transcript, the newly synthesized primary transcript is modified in several ways to be converted into its mature, functional form, thereby giving rise to different proteins and RNAs such as mRNA, tRNA, rRNA, lncRNA, miRNA, etc. Thus, the term "transcript" can include exons, introns, 5'UTR, and 3'UTR.

[0074] As used herein, the term "expression" refers to the process by which a polynucleotide produces a gene product, such as RNA or polypeptide. It includes, but is not limited to, transcription of a polynucleotide into messenger RNA (mRNA) and translation of the mRNA into a polypeptide. Expression produces a "gene product" As used herein, a gene product can be a nucleic acid (e.g., messenger RNA produced by gene transcription), or a polypeptide translated from a transcript. The gene products described herein further include nucleic acids having post-transcriptional modifications (e.g., polyadenylation or splicing), or polypeptides having post-translational modifications (e.g., methylation, glycosylation, addition of lipids, association with other protein subunits, or proteolytic cleavage).

[0075] In the context of two or more nucleic acids, the term "identical" or "percent identity" means that two or more sequences are identical or have a specified percentage of identical nucleotide or amino acid residues when compared and aligned for maximum correspondence (introducing gaps if necessary), without considering any conservative amino acid substitutions as part of sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection. A variety of algorithms and software known in the art can be used to obtain alignments of amino acid or nucleotide sequences.

[0076] One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., 1990, Proc. Natl. Acad. Sci., 87:2264-2268, which was modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873-5877 and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain aspects, GappedBLAST can be used, as reported in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain aspects, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using the NWSgapdna.CMP matrix and gap weights of 40, 50, 60, 70 or 90 and length weights of 1, 2, 3, 4, 5 or 6). In certain alternative aspects, the GAP program in the GCG software package incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) and can be used to determine the percent identity between two amino acid sequences (e.g., using the BLOSUM 62 matrix or the PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6 or 4, and length weights of 1, 2, 3, 4, 5). Alternatively, in certain aspects, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (Computer Applications in the Biosciences (CABIOS), 4:11-17 (1989)). For example, the ALIGN program (version 2.0) can be used with a PAM120, 12 gap length penalty and a 4 gap penalty with a residue table to determine the percent identity. Those skilled in the art can determine the appropriate parameters for maximum alignment through specific alignment software. In certain aspects, the default parameters of the alignment software are used.

[0077] In some aspects, the percent identity "X" between the first nucleotide sequence and the second nucleotide sequence is calculated as 100x(Y / Z), where Y is the number of amino acid residues scored as identical matches in an alignment of the first and second sequences (such as by visual inspection or using a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of the first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0078] The different regions within a single polynucleotide target sequence aligned to a polynucleotide reference sequence can each have their own percent identity. Note that the percent identity values are rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. Note also that length values will always be integers.

[0079] As used herein, the terms "homologous" and "homology" may be used interchangeably with the terms "identical" and "identity".

[0080] The term "naturally occurring variants" refers to variants of the STAT6 polypeptide sequence or STAT6 nucleic acid sequence (e.g., transcript) that occur naturally within the defined taxonomic groups such as mammals (e.g., mouse, monkey, and human). Generally, when referring to "naturally occurring variants" of a polynucleotide, the term can also encompass any allelic variants of the STAT6-encoding genomic DNA (found at chromosomal position 1q44 at 247,416,156 - 247,449,108, i.e., nucleotides 247,416,156 - 247,449,108 of GenBank accession number NC_000001.11) generated by chromosomal translocation or duplication, as well as RNA, such as the mRNA derived therefrom. "Naturally occurring variants" can also include variants derived from alternative splicing of STAT6 mRNA. When referring to a specific polypeptide sequence, for example, the term also includes the naturally occurring forms of the protein, which can thus be processed by, for example, co-translational or post-translational modifications such as signal peptide cleavage, proteolytic cleavage, glycosylation, etc.

[0081] When determining the degree of "complementarity" between an ASO (or a region thereof) of the present disclosure and a target region of a nucleic acid encoding a mammalian STAT6 (e.g., the STAT6 gene), such as the target regions disclosed herein, the degree of "complementarity" (also referred to as "homology" or "identity") is expressed as the percentage of identity (or percentage of homology) between the sequence of the ASO (or a region thereof) and the sequence of the target region (or the reverse complement of the target region) that is best aligned therewith. The percentage is calculated by counting the number of aligned bases that are the same between the two sequences, dividing by the total number of consecutive monomers in the ASO, and multiplying by 100. In such comparisons, if there are gaps, it is preferred that such gaps are merely mismatches rather than areas where the number of monomers within the gap is different between the ASO of the present disclosure and the target region.

[0082] As used herein, the term "complement" refers to a sequence that is complementary to a reference sequence. Complementarity is well known as a fundamental principle in DNA replication and transcription, as it is a property shared between two DNA or RNA sequences such that when the two DNA or RNA sequences are aligned anti-parallel to each other, the nucleobases at each position in the sequences will be complementary, much like seeing the opposite in a mirror. Thus, for example, the complement of the sequence 5' "ATGC" 3' can be written as 3' "TACG" 5' or 5' "GCAT" 3'. As used herein, the terms "reverse complement", "reverse complementary", and "reverse complementarity" may be used interchangeably with the terms "complement", "complementary", and "complementarity". In some aspects, the term "complementary" refers to 100% match or complementarity (i.e., perfect complementarity) with a contiguous nucleic acid sequence within the STAT6 transcript. In some aspects, the term "complementary" refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity with a contiguous nucleic acid sequence within the STAT6 transcript.

[0083] When referring to two separate nucleic acid or nucleotide sequences, the terms "corresponding to" and "corresponds to" can be used to clarify regions of sequences that are homologous and / or functionally equivalent to each other, even though the nucleotides of the specific sequences may be numbered differently. For example, different isoforms of a gene transcript may have similar or conserved portions of nucleotide sequence, and based on alternative splicing and / or other modifications, the numbering of the nucleotide sequences may be different in the respective isoforms. Additionally, it is recognized that different numbering systems can be employed when characterizing nucleic acid or nucleotide sequences (e.g., for gene transcripts and whether to number the sequence starting from the translation initiation codon or to include the 5' UTR). Further, it is recognized that the nucleic acid or nucleotide sequences of different variants of a gene or gene transcript can be different. However, as used herein, regions of variants that share nucleic acid or nucleotide sequence homology and / or functionality are considered to "correspond" to each other. For example, the nucleotide sequence of a STAT6 transcript corresponding to nucleotides X to Y of SEQ ID NO:1 ("reference sequence") refers to a STAT6 transcript sequence (e.g., STAT6 pre-mRNA or mRNA) having the same or a similar sequence as nucleotides X to Y of SEQ ID NO:1, where X is the starting site and Y is the ending site (as Figure 1 shown in A). By aligning the STAT6 transcript sequence with SEQ ID NO:1, one of ordinary skill in the art can identify the corresponding X and Y residues in the STAT6 transcript sequence.

[0084] The terms "corresponding nucleotide analogue" and "corresponding nucleotide" are intended such that the nucleobases in the nucleotide analogue and the naturally occurring nucleotide have the same pairing or hybridization ability. For example, when the 2-deoxyribose unit of a nucleotide is linked to adenine, the "corresponding nucleotide analogue" contains a pentose unit (different from 2-deoxyribose) linked to adenine.

[0085] The notations for ASO chemistry are as follows: β-D-oxy-LNA nucleotides are represented by OxyB, where B represents the nucleobase, such as thymine (T), uridine (U), cytosine (C), 5-methylcytosine (MC), adenine (A), or guanine (G), and thus include OxyA, OxyT, OxyMC, OxyC, and OxyG. DNA nucleotides are represented by DNAb, where the lowercase b represents the nucleobase, such as thymine (T), uridine (U), cytosine (C), 5-methylcytosine (Mc), adenine (A), or guanine (G), and thus include DNAa, DNAt, DNAc, and DNAg. The letter M preceding C or c indicates 5-methylcytosine. The letter "s" indicates a phosphorothioate internucleotide bond.

[0086] As used herein, the term "ASO Number" or "ASO No." refers to a unique number assigned to a nucleotide sequence having a detailed chemical structure of components such as nucleosides (e.g., DNA), nucleoside analogs (e.g., β-D-oxy-LNA), nucleobases (e.g., A, T, G, C, U or MC), and backbone structures (e.g., phosphorothioate or phosphodiester). For example, ASO-STAT6-1053 may refer to STAT6-1053 (SEQ ID NO:91).

[0087] "Potency" is usually expressed as an IC 50 or an EC 50 value, in μM, nM or pM units unless otherwise stated. Potency can also be expressed as a percentage of inhibition. IC 50 is the median inhibitory concentration of a therapeutic molecule. EC 50 is the median effective concentration of a therapeutic molecule relative to a vehicle or control (e.g., saline). In a functional assay, IC 50 is the concentration of a therapeutic molecule that reduces a biological response (e.g., mRNA transcription or protein expression) by 50% of the biological response achieved by the therapeutic molecule. In a functional assay, EC 50 is the concentration of a therapeutic molecule that produces 50% of a biological response (e.g., mRNA transcription or protein expression). IC 50 or EC 50 can be calculated by many methods known in the art.

[0088] As used herein, the term "inhibition", e.g., of the expression of the STAT6 gene transcript and / or STAT6 protein, refers to the reduction by an ASO of the expression of the STAT6 gene transcript and / or STAT6 protein in a cell or tissue. In some aspects, the term "inhibition" refers to complete inhibition (100% inhibition or undetectable level) of the STAT6 gene transcript or STAT6 protein. In other aspects, the term "inhibition" refers to at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% inhibition of the expression of the STAT6 gene transcript and / or STAT6 protein in a cell or tissue.

[0089] As used herein, the term "extracellular vesicle" or "EV" refers to cell-derived vesicles that contain a membrane enclosing an internal space. Extracellular vesicles include all membrane-bound vesicles (e.g., exosomes, nanovesicles) that have a diameter smaller than the diameter of the cell from which they are derived. In some aspects, extracellular vesicles have a diameter in the range of 20 nm to 1000 nm and can contain various macromolecular payloads that are within the internal space (i.e., lumen), displayed on the outer surface of the extracellular vesicle, and / or span the membrane. In some aspects, the payload can include nucleic acids, proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. In certain aspects, the extracellular carrier contains a scaffold moiety. By way of example and not limitation, extracellular vesicles include apoptotic bodies, cell debris, vesicles derived from cells by direct or indirect manipulation (e.g., by successive extrusion or treatment with an alkaline solution), vesicularized organelles, and vesicles produced by living cells (e.g., by direct plasma membrane budding or fusion of late endosomes with the plasma membrane). Extracellular vesicles can be derived from living organisms or dead organisms, explanted tissues or organs, prokaryotic cells or eukaryotic cells, and / or cultured cells. In some aspects, extracellular vesicles are produced by cells that express one or more transgenic products.

[0090] As used herein, the term "exosome" refers to extracellular vesicles having a diameter between 20 - 300 nm (e.g., between 40 - 200 nm). Exosomes contain a membrane enclosing an internal space (i.e., lumen) and, in some aspects, can be produced from cells (e.g., producer cells) by direct plasma membrane budding or by fusing late endosomes with the plasma membrane. In certain aspects, exosomes contain a scaffold moiety. As described below, exosomes can be derived from producer cells and isolated from producer cells based on their size, density, biochemical parameters, or a combination thereof. In some aspects, EVs (e.g., exosomes of the present disclosure) are produced by cells that express one or more transgenic products.

[0091] As used herein, the term "nanovesicle" refers to extracellular vesicles having a diameter between 20 - 250 nm (e.g., between 30 - 150 nm) and are produced from cells (e.g., producer cells) by direct or indirect manipulation such that the cells would not produce nanovesicles without the manipulation. Suitable manipulations for a cell to produce nanovesicles include, but are not limited to, successive extrusion, treatment with an alkaline solution, sonication, or a combination thereof. In some aspects, the production of nanovesicles can result in the disruption of the producer cells. In some aspects, the population of nanovesicles described herein is substantially free of vesicles derived from cells by direct budding from the plasma membrane or fusion of late endosomes with the plasma membrane. In certain aspects, nanovesicles contain a scaffold moiety. Once obtained from producer cells, nanovesicles can be isolated from producer cells based on their size, density, biochemical parameters, or a combination thereof.

[0092] As used herein, the term "surface-engineered EV (e.g., exosome)" (e.g., an EV (e.g., exosome) engineered with scaffold X) refers to an EV (e.g., exosome) having a membrane or surface of the EV (e.g., exosome) modified in its composition such that the surface of the engineered EV (e.g., exosome) is different from the surface of the EV (e.g., exosome) prior to modification or the surface of a naturally occurring EV (e.g., exosome). The engineering can be performed on the surface of the EV (e.g., exosome) or within the membrane of the EV (e.g., exosome) such that the surface of the EV (e.g., exosome) is altered. For example, the membrane is modified in its composition of proteins, lipids, small molecules, carbohydrates, etc. The composition can be altered by chemical, physical, or biological methods, or by being produced by cells previously or simultaneously modified by chemical, physical, or biological methods. Specifically, the composition can be altered by genetic engineering, or by being produced by cells previously modified by genetic engineering. In some aspects, the surface-engineered EV (e.g., exosome) contains an exogenous protein (i.e., a protein not naturally expressed by the EV (e.g., exosome)) or a fragment or variant thereof, which exogenous protein or fragment or variant thereof can be exposed on the surface of the EV (e.g., exosome) or can be an anchor point (attachment) for a moiety exposed on the surface of the EV (e.g., exosome). In other aspects, the surface-engineered EV (e.g., exosome) contains a higher expression (e.g., higher quantity) of a native exosome protein (e.g., scaffold X) or a fragment or variant thereof, which higher expression of the native exosome protein or fragment or variant thereof can be exposed on the surface of the EV (e.g., exosome), or can be an anchor point (attachment) for a moiety exposed on the surface of the EV (e.g., exosome).

[0093] As used herein, the term "intraluminal engineered exosome" (e.g., scaffold Y-engineered exosome) refers to an EV (e.g., exosome) having a modified membrane or lumen in its composition such that the lumen of the engineered EV (e.g., exosome) is different from the lumen of the EV (e.g., exosome) prior to modification or the lumen of a naturally occurring EV (e.g., exosome). Engineering can be performed directly in the lumen of the EV (e.g., exosome) or in the membrane such that the lumen of the EV (e.g., exosome) is altered. For example, the membrane is modified in its composition of proteins, lipids, small molecules, carbohydrates, etc. such that the lumen of the EV (e.g., exosome) is modified. The composition can be altered by chemical, physical, or biological methods, or by being produced by cells previously modified by chemical, physical, or biological methods. Specifically, the composition can be altered by genetic engineering, or by being produced by cells previously modified by genetic engineering. In some aspects, the intraluminal engineered exosome contains an exogenous protein (i.e., a protein not naturally expressed by the EV (e.g., exosome)) or a fragment or variant thereof, which exogenous protein or fragment or variant thereof can be exposed to the lumen of the EV (e.g., exosome) or can be an anchor point (attachment) for a portion exposed on the inner layer of the EV (e.g., exosome). In other aspects, the intraluminal engineered EV (e.g., exosome) contains a higher expressed native exosome protein (e.g., scaffold X or scaffold Y) or a fragment or variant thereof, which higher expressed native exosome protein or fragment or variant thereof can be exposed to the lumen of the exosome, or can be an anchor point (attachment) for a portion exposed in the lumen of the exosome).

[0094] The term "modified" when used in the context of an EV (e.g., an exosome as described herein) refers to an alteration or engineering of the EV (e.g., exosome and / or its producer cells) such that the modified EV (e.g., exosome) is different from a naturally occurring EV (e.g., exosome). In some aspects, the modified EV (e.g., exosome) described herein contains a membrane that is different in composition of proteins, lipids, small molecules, carbohydrates, etc. from the membrane of a naturally occurring EV (e.g., exosome) (e.g., the membrane contains a higher density or number of native exosome proteins and / or the membrane contains a protein not naturally present in exosomes (e.g., ASO)). In certain aspects, such modification of the membrane alters the outer surface of the EV, (e.g., exosome) (e.g., the surface engineered EV (e.g., exosome) as described herein). In certain aspects, such modification of the membrane alters the lumen of the EV, (e.g., exosome) (e.g., the intraluminal engineered EV (e.g., exosome) as described herein).

[0095] As used herein, the term "scaffold moiety" refers to a molecule on the luminal or outer surface of an EV (e.g., exosome) that can be used to anchor a payload or any other compound of interest (e.g., an ASO) to the EV (e.g., exosome). In some aspects, the scaffold moiety comprises a synthetic molecule. In some aspects, the scaffold moiety comprises a non-polypeptide moiety. In other aspects, the scaffold moiety comprises a lipid, carbohydrate, or protein that is naturally present in an EV (e.g., exosome). In some aspects, the scaffold moiety comprises a lipid, carbohydrate, or protein that is not naturally present in an EV (e.g., exosome). In certain aspects, the scaffold moiety is Scaffold X. In some aspects, the scaffold moiety is Scaffold Y. In additional aspects, the scaffold moiety comprises both Scaffold X and Scaffold Y. Non-limiting examples of other scaffold moieties that can be used in the present disclosure include: aminopeptidase N (CD13); enkephalinase, also known as membrane metallo-endopeptidase (MME); ectonucleotide pyrophosphatase / phosphodiesterase family member 1 (ENPP1); neuropilin-1 (NRP1); CD9, CD63, CD81, PDGFR, GPI-anchored proteins, lactadherin (MFGE8), LAMP2, and LAMP2B.

[0096] As used herein, the term "Scaffold X" refers to an exosomal protein that was recently identified on the surface of exosomes. See, for example, U.S. Patent No. 10,195,290, which is incorporated herein by reference in its entirety. Non-limiting examples of Scaffold X proteins include: prostaglandin F2 receptor negative regulator ("PTGFRN protein"); basigin ("BSG protein"); immunoglobulin superfamily member 2 ("IGSF2 protein"); immunoglobulin superfamily member 3 ("IGSF3 protein"); immunoglobulin superfamily member 8 ("IGSF8 protein"); integrin beta-1 ("ITGB1 protein"); integrin alpha-4 ("ITGA4 protein"); 4F2 cell surface antigen heavy chain ("SLC3A2 protein"); a class of ATP transporters ("ATP1A1 protein", "ATP1A2 protein", "ATP1A3 protein", "ATP1A4 protein", "ATP1B3 protein", "ATP2B1 protein", "ATP2B2 protein", "ATP2B3 protein", "ATP2B protein"); and functional fragments thereof. In some aspects, the Scaffold X protein can be the full protein or a fragment thereof (e.g., a functional fragment, e.g., the smallest fragment capable of anchoring another moiety to the outer or luminal surface of an EV (e.g., exosome)). In some aspects, Scaffold X can anchor a moiety (e.g., an ASO) to the outer or luminal surface of an exosome.

[0097] As used herein, the term "scaffold Y" refers to an exosomal protein most recently identified within the lumen of exosomes. Non-limiting examples of scaffold Y proteins that can be used in the compositions and methods disclosed herein include, for example, those scaffold Y proteins disclosed in International Publication Nos. WO / 2019 / 099942 or WO 2020 / 101740, each of which is incorporated herein by reference in its entirety. Additional examples of scaffold Y proteins include: myristoylated alanine-rich protein kinase C substrate ("MARCKS protein"); myristoylated alanine-rich protein kinase C substrate-like 1 ("MARCKSL1 protein"); and brain acid-soluble protein 1 ("BASP1 protein"). In some aspects, the scaffold Y protein can be a full-length protein or a fragment thereof (e.g., a functional fragment, e.g., the smallest fragment capable of anchoring a moiety to the luminal surface of an exosome). In some aspects, scaffold Y can anchor a moiety (e.g., an ASO) to the luminal surface of an EV (e.g., an exosome). In some aspects, scaffold Y can anchor a moiety (e.g., an ASO) to the outer surface of an EV (e.g., an exosome).

[0098] As used herein, the term "fragment" of a protein (e.g., a therapeutic protein, scaffold X, or scaffold Y) refers to an amino acid sequence of a protein that is shorter than the native sequence of the protein from which it is missing, with a deletion of part or any part of the native sequence, N-terminus, and / or C-terminus. As used herein, the term "functional fragment" refers to a protein fragment that retains the function of the protein. Thus, in some aspects, a functional fragment of a scaffold X protein retains the ability to anchor a moiety to the luminal surface or outer surface of an EV (e.g., an exosome). Similarly, in certain aspects, a functional fragment of a scaffold Y protein retains the ability to anchor a moiety to the luminal surface or outer surface of an EV (e.g., an exosome). Whether a fragment is a functional fragment can be evaluated by any known method for determining the protein content of an EV (e.g., an exosome), including Western blotting, FACS analysis, and fusion of the fragment with a self-fluorescent protein, such as GFP. In certain aspects, a functional fragment of a scaffold X protein retains at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of the native scaffold X protein, e.g., the ability to anchor a moiety. In some aspects, a functional fragment of a scaffold Y protein retains at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of the native scaffold Y protein, e.g., the ability to anchor another molecule.

[0099] As used herein, the term "variant" of a molecule (e.g., a functional molecule, an antigen, scaffold X and / or scaffold Y) refers to a molecule that shares certain structural and functional identity with another molecule as determined by methods known in the art. For example, variants of a protein can include substitutions, insertions, deletions, frameshifts, or rearrangements in another protein.

[0100] In some aspects, variants of scaffold X include variants having at least about 70% identity with a full-length, mature PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, or ATP transporter or a fragment (e.g., a functional fragment) of PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, or ATP transporter. In some aspects, variants of a PTGFRN variant or fragment share at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with PTGFRN according to SEQ ID NO:301 or a functional fragment thereof. In some aspects, variants of the scaffold X protein disclosed herein retain the ability to specifically target EVs (e.g., exosomes). In some aspects, scaffold X includes one or more mutations, e.g., conservative amino acid substitutions.

[0101] A "conservative amino acid substitution" is a substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a substitution is considered conservative if an amino acid in a polypeptide is replaced with another amino acid from the same side chain family. In another aspect, an amino acid string can be conservatively replaced with a structurally similar string that differs in the order and / or composition of side chain family members.

[0102] The term "percent sequence identity" or "identity percent" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by the sequences within a comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for the optimal alignment of the two sequences. A matching position is any position with the same nucleotide or amino acid present in both the target sequence and the reference sequence. Gaps present in the target sequence are not counted because gaps are not nucleotides or amino acids. Similarly, gaps present in the reference sequence are not counted because it is the target sequence nucleotides or amino acids that are being counted, not the nucleotides or amino acids from the reference sequence.

[0103] The percent sequence identity is calculated by determining the number of positions at which the same amino acid residue or nucleic acid base occurs in both sequences to arrive at the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent sequence identity. The comparison of sequences and the determination of the percent sequence identity between two sequences can be accomplished using readily available software that is available online and for download. Suitable software programs are available from a variety of sources and are used for the alignment of both protein and nucleotide sequences. A suitable program for determining the percent sequence identity is bl2seq, which is part of the BLAST program suite available from the BLAST website (blast.ncbi.nlm.nih.gov) of the National Center for Biotechnology Information of the United States government. Bl2seq uses the BLASTN or BLASTP algorithm to compare between two sequences. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the bioinformatics program EMBOSS suite and are also available from the European Bioinformatics Institute (EBI) at the website www.ebi.ac.uk / Tools / psa.

[0104] Different regions within a single polynucleotide or polypeptide target sequence aligned with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It should be noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It should also be noted that the length values will always be integers.

[0105] Those skilled in the art will understand that the generation of sequence alignments for calculating the percentage of sequence identity is not limited to binary sequence-sequence comparisons driven solely by primary sequence data. Sequence alignments can be derived from multiple sequence alignments. One suitable program for generating multiple sequence alignments is ClustalW2, which is available from www.clustal.org. Another suitable program is MUSCLE, which is available from www.drive5.com / muscle / . ClustalW2 and MUSCLE are alternatively available from, for example, EBI.

[0106] It should also be understood that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources, such as structural data (e.g., crystal protein structures), functional data (e.g., localization of mutations), or phylogenetic data. A suitable program for integrating heterogeneous data to generate multiple sequence alignments is T-Coffee, which is available at www.tcoffee.org and is alternatively available from, for example, EBI. It should also be understood that the final alignment for calculating the percentage of sequence identity can be curated automatically or manually.

[0107] Polynucleotide variants can contain alterations in the coding region, non-coding region, or both. In one aspect, the polynucleotide variants contain alterations that produce silent substitutions, additions, or deletions without altering the properties or activities of the encoded polypeptide. On the other hand, nucleotide variants are produced by silent substitutions due to the degeneracy of the genetic code. In other aspects, variants in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination. Polynucleotide variants can be produced for a variety of reasons, e.g., for optimizing codon expression for a particular host (changing codons in a human mRNA to other codons, e.g., a bacterial host such as Escherichia coli (E. coli)).

[0108] Naturally occurring variants are called "allelic variants" and refer to one of several alternative forms of a gene that occupies a given locus on a chromosome of an organism (Genes II, Lewin, B., Ed., John Wiley & Sons, New York (1985)). These allelic variants can vary at the polynucleotide and / or polypeptide level and are included in the present disclosure. Alternatively, non-naturally occurring variants can be produced by mutagenesis techniques or by direct synthesis.

[0109] Using methods of known protein engineering and recombinant DNA techniques, variants can be generated to improve or alter polypeptide characteristics. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of a secreted protein without significant loss of biological function. Ron et al., J. Biol. Chem. 268:2984-2988 (1993), which is incorporated herein by reference in its entirety, reported a variant KGF protein that retained heparin-binding activity even after deletion of 3, 8, or 27 amino-terminal amino acid residues. Similarly, interferon γ exhibited up to ten-fold higher activity after deletion of 8 to 10 amino acid residues from the carboxyl terminus of the protein. (Dobeli et al., J. Biotechnology 7:199-216 (1988), which is incorporated herein by reference in its entirety.)

[0110] In addition, substantial evidence demonstrates that variants generally retain biological activity similar to the naturally occurring protein. For example, Gayle and colleagues (J. Biol. Chem 268:22105-22111 (1993), which is incorporated herein by reference in its entirety) performed an extensive mutational analysis of the human cytokine IL-1α. They used random mutagenesis to generate over 3,500 individual IL-1α mutants, with an average of 2.5 amino acid changes per variant over the entire length of the molecule. Multiple mutations were examined at each possible amino acid position. The researchers found that "most of the molecule could be altered with little effect on [binding or biological activity]." (See abstract.) In fact, of the over 3,500 nucleotide sequences examined, only 23 unique amino acid sequences produced proteins with activity significantly different from the wild type.

[0111] As described above, polypeptide variants include, for example, modified polypeptides. Modifications include, for example, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of a covalent cross-link, formation of cysteine, formation of pyroglutamic acid, formylation, γ-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, polyethylene glycolylation (Mei et al., Blood 116:270-79 (2010), which is incorporated herein by reference in its entirety), proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA-mediated addition of amino acids to a protein such as arginylation, and ubiquitination. In some aspects, scaffold X and / or scaffold Y are modified at any convenient location.

[0112] As used herein, the terms "linked to" or "conjugated to" are used interchangeably and refer to a covalent or non-covalent bond formed between a first moiety and a second moiety, e.g., a scaffold X and an ASO, e.g., a scaffold moiety expressed in or on an extracellular vesicle and an ASO, e.g., a scaffold X (e.g., PTGFRN protein) located in or on the luminal surface or outer surface of an extracellular vesicle, respectively.

[0113] The term "encapsulated" or a grammatically different form of the term (e.g., "encapsulation" or "encapsulating") refers to the state or process of having a first moiety (e.g., an ASO) located inside a second moiety (e.g., an EV, e.g., an exosome) without chemically or physically linking the two moieties. In some aspects, the term "encapsulated" can be used interchangeably with "in the lumen of". Non-limiting examples of encapsulating a first moiety (e.g., an ASO) into a second moiety (e.g., an EV (e.g., an exosome)) are disclosed elsewhere herein.

[0114] As used herein, the term "producer cell" refers to a cell used to produce EVs (e.g., exosomes). The producer cell can be a cell cultured in vitro or in vivo. Producer cells include, but are not limited to, cells known to be effective in producing EVs (e.g., exosomes), such as HEK293 cells, Chinese hamster ovary (CHO) cells, mesenchymal stem cells (MSCs), BJ human foreskin fibroblasts, fHDF fibroblasts, neuronal progenitor cells, amniotic cells, adipose mesenchymal stem cells, RPTEC / TERT1 cells. In certain aspects, the producer cell is not an antigen-presenting cell. In some aspects, the producer cell is not a dendritic cell, B cell, mast cell, macrophage, neutrophil, Kupffer-Browicz cell, a cell derived from any of these cells, or any combination thereof. In some aspects, the EVs (e.g., exosomes) useful in the present disclosure do not carry antigens exposed on MHC class I or II molecules on the surface of the EVs (e.g., exosomes), but can carry antigens in the lumen of the EVs (e.g., exosomes) or on the surface of the EVs (e.g., exosomes) by attachment to scaffold X and / or scaffold Y.

[0115] As used herein, the terms "isolate", "isolated", and "isolating" or "purify", "purified", and "purifying" and "extracted" and "extracting" are used interchangeably and refer to the state of a preparation of a desired EV (e.g., multiple known or unknown amounts and / or concentrations) that has undergone one or more purification processes, e.g., selection or enrichment of a desired EV preparation. In some aspects, as used herein, isolation or purification is the process of removing, partially removing (e.g., fractionating) EVs from a sample containing producer cells. In some aspects, the isolated EV composition has no detectable undesired activity, or alternatively, the level or amount of undesired activity is at or below an acceptable level or amount. In other aspects, the isolated EV composition has an amount and / or concentration of the desired EVs that is at or above an acceptable amount and / or concentration. In other aspects, the isolated EV composition is enriched compared to the starting material from which the composition was obtained (e.g., a producer cell preparation). This enrichment can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than 99.9999% compared to the starting material. In some aspects, the isolated EV preparation is substantially free of residual bioproducts. In some aspects, the isolated EV preparation is 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% free of any contaminating biomaterial. Residual bioproducts can include non-biological materials (including chemicals) or undesired nucleic acids, proteins, lipids, or metabolites. Substantially free of residual bioproducts can also mean that the EV composition contains no detectable producer cells and only the EVs are detectable.

[0116] As used herein, the term "payload" refers to an agent that acts on a target (e.g., a target cell) in contact with an EV. Non-limiting examples of payloads that can be included on an EV (e.g., an exosome) are ASOs. Payloads that can be introduced into an EV (e.g., an exosome) and / or a producer cell include therapeutic agents such as nucleotides (e.g., nucleotides containing a detectable moiety or a toxin or disrupting transcription), nucleic acids (e.g., DNA or mRNA molecules encoding a polypeptide such as an enzyme, or RNA molecules having a regulatory function such as miRNA, dsDNA, lncRNA, and siRNA), amino acids (e.g., amino acids containing a detectable moiety or a toxin or disrupting translation), polypeptides (e.g., enzymes), lipids, carbohydrates, and small molecules (e.g., small molecule drugs and toxins). In certain aspects, the payload comprises an ASO.

[0117] As used herein, the term "antibody" encompasses immunoglobulins and fragments thereof that are naturally occurring or produced in part or in whole synthetically. The term also encompasses any protein having a binding domain homologous to an immunoglobulin binding domain. "Antibody" further includes polypeptides containing framework regions from immunoglobulin genes or fragments thereof that specifically bind and recognize an antigen. As used herein, the term "antigen" refers to any agent that, when introduced into a subject, elicits an immune response (cellular or humoral) against itself. The use of the term antibody is meant to include intact antibodies, polyclonal antibodies, monoclonal antibodies, and recombinant antibodies, fragments thereof, and further includes single-chain antibodies, humanized antibodies, murine antibodies, chimeric antibodies, mouse-human antibodies, mouse-primate antibodies, primate-human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments such as scFv, (scFv)2, Fab, Fab', and F(ab')2, F(ab1)2, Fv, dAb, and Fd fragments, bispecific antibodies, and antibody-related polypeptides. Antibodies include bispecific and multispecific antibodies, provided that they exhibit the desired biological activity or function.

[0118] The term "antibody" includes, for example, naturally occurring antibodies and non-naturally occurring antibodies; monoclonal antibodies and polyclonal antibodies; chimeric antibodies and humanized antibodies; human antibodies or non-human antibodies; fully synthetic antibodies; and single-chain antibodies. Non-human antibodies can be humanized by recombinant methods to reduce their immunogenicity in humans. Unless otherwise specified and unless the context indicates otherwise, the term "antibody" also includes antigen-binding fragments or antigen-binding portions of any of the above immunoglobulins, and includes monovalent and divalent fragments or portions, as well as single-chain Abs.

[0119] As used herein, the term "antagonist", e.g., a PD-1 antagonist, refers to any substance that limits, reduces, inhibits, blocks, or decreases the activity of a target. For example, a PD antagonist limits, reduces, inhibits, blocks, or otherwise decreases the activity of PD-1. Examples of antagonists include, but are not limited to, small molecules, polypeptides (e.g., ligands, receptors, antibodies, and fragments thereof), nucleic acid molecules, and any combination thereof. In certain aspects, the antagonist comprises an antibody or an antigen-binding portion thereof.

[0120] As used herein, "programmed death-1" or "PD-1" refers to an immunosuppressive receptor in the CD28 family. PD-1 is expressed primarily on previously activated T cells in vivo. PD-1 binds to two ligands, PD-L1 and PD-L2. As used herein, the term "PD-1" includes human PD-1 (hPD-1), variants, isotypes, and species homologs of hPD-1, and analogs having at least one epitope in common with hPD-1. The complete hPD-1 sequence can be found under GenBank accession number U64863. "PD-1" and "PD-1 receptor" are used interchangeably herein. As used herein, the term "PD-1 activity" or "PD-1 signaling" refers to, but is not limited to, the interaction between PD-1 and PD-L1 and / or PD-L1. Thus, in some aspects, a PD-1 antagonist inhibits or blocks the interaction between PD-1 and PD-L1 (and / or PD-L2). Thus, in some aspects, a "PD-1 antagonist" comprises an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, or any combination thereof.

[0121] Any anti-PD-1 antibody or anti-PD-L1 antibody known in the art can be used in the methods disclosed herein. Non-limiting examples of anti-PD-1 antibodies include nivolumab (see US 8,008,449), pembrolizumab, PDR001 (see WO 2015 / 112900), MEDI-0680 (see WO 2012 / 145493), cemiplimab (see WO2015 / 112800), JS001 (see Si-Yang Liu et al., J. Hematol. Oncol. 10:136 (2017)), BGB-A317 (see WO 2015 / 35606 and US2015 / 0079109), INCSHR1210 (see WO 2015 / 085847; Si-Yang Liu et al., J. Hematol. Oncol. 10:136 (2017)), TSR-042 (see WO2014 / 179664), GLS-010 (see Si-Yang Liu et al., J. Hematol. Oncol. 10:136 (2017)), AM-0001, STI-1110 (see WO2014 / 194302), AGEN2034 (see WO 2017 / 040790), MGA012 (see WO2017 / 19846), and IBI308 (see WO 2017 / 024465, WO 2017 / 025016, WO 2017 / 132825, and WO 2017 / 133540) (each of these documents is incorporated herein by reference in its entirety). Non-limiting examples of anti-PD-L1 antibodies include, but are not limited to, BMS-936559 (see, for example, US 7,943,743 and WO 2013 / 173223), atezolizumab (see US 8,217,149), durvalumab (see WO 2011 / 066389), avelumab (see WO 2013 / 079174), STI-1014 (see WO 2013 / 181634), CX-072 (see WO2016 / 149201), KN035 (see Zhang et al., Cell Discov. 7:3 (March 2017)), LY3300054 (see, for example, WO 2017 / 034916), and CK-301 (see Gorelik et al., AACR: Abstract 4606 (April 2016)) (each of these documents is incorporated herein by reference in its entirety).

[0122] The terms "individual", "subject", "host", and "patient" are used interchangeably herein and refer to any mammalian subject, specifically a human, desiring a diagnosis, treatment, or therapy. The compositions and methods described herein are applicable to both human therapy and veterinary applications. In some aspects, the subject is a mammal, and in other aspects, the subject is a human. As used herein, "mammalian subject" includes all mammals, including but not limited to humans, domestic animals (e.g., dogs, cats, etc.), farm animals (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.).

[0123] The term "pharmaceutical composition" refers to a preparation in such form as to permit the bioactivity of the active ingredient to be effective and which contains no additional components that are unacceptably toxic to the subject to which the composition is to be administered. Such compositions may be sterile.

[0124] As used herein, the term "substantially free" means that a sample containing EVs (e.g., exosomes) contains less than 10% macromolecules by mass / volume (m / v) percentage concentration. Some fractions may contain less than 0.001%, less than 0.01%, less than 0.05%, less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% (m / v) macromolecules.

[0125] As used herein, the term "macromolecule" means nucleic acid, contaminant protein, lipid, carbohydrate, metabolite, or a combination thereof.

[0126] As used herein, the term "conventional exosomal protein" means a protein previously known to be enriched in exosomes, including but not limited to CD9, CD63, CD81, PDGFR, GPI-anchored protein, lactadherin (MFGE8), LAMP2 and LAMP2B, fragments thereof, or peptides binding thereto.

[0127] As used herein, "administering" means administering to a subject a composition comprising EVs (e.g., exosomes) disclosed herein by a pharmaceutically acceptable route. The route of administration may be intravenous administration, e.g., intravenous injection and intravenous infusion. Other routes of administration include, e.g., subcutaneous, intramuscular, oral, nasal, and pulmonary administration. EVs (e.g., exosomes) may be administered as part of a pharmaceutical composition comprising at least one excipient.

[0128] For example, an “effective amount” of an ASO or extracellular vesicle as disclosed herein is an amount sufficient to achieve the stated purpose. The “effective amount” can be determined empirically and in a conventional manner according to the purpose.

[0129] As used herein, “treat” or “treatment” refers to, for example, reducing the severity of a disease or disorder; shortening the duration of the disease process; ameliorating or eliminating one or more symptoms associated with the disease or disorder; providing a beneficial effect to a subject having the disease or disorder, without necessarily curing the disease or disorder. The term also includes prevention or prophylaxis of a disease or condition or its symptoms. In one aspect, “treatment” includes inducing hematopoiesis in a subject in need thereof. In some aspects, the disease or condition is associated with hematopoiesis or its lack. In certain aspects, the disease or condition is cancer. In some aspects, treatment enhances hematopoiesis in a subject having cancer, wherein the enhanced hematopoiesis comprises an increase in the proliferation and / or differentiation of one or more immune cells in the subject.

[0130] As used herein, “prevent” or “preventing” refers to reducing or lowering the incidence or severity of a particular outcome. In some aspects, prevention of an outcome is achieved by prophylactic treatment. In some aspects, an EV (e.g., exosome) comprising an ASO as described herein is administered prophylactically to a subject. In some aspects, the subject is at risk of having cancer. In some aspects, the subject is at risk of having a hematopoietic disorder.

[0131] II. Methods of the Disclosure

[0132] Certain aspects of the disclosure relate to methods of preventing and / or treating a disease or disorder in a subject in need thereof, the method comprising administering a dose of one or more antisense oligonucleotides (ASOs) that target the STAT6 transcript (SEQ ID NO:1 or SEQ ID NO:3), wherein each of the one or more ASOs comprises a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg.

[0133] II.A. Dose

[0134] In some aspects, the dose is at least about 0.01 mg, at least about 0.05 mg, at least about 0.1 mg, at least about 0.5 mg, at least about 1 mg, at least about 2 mg, at least about 3 mg, at least about 4 mg, at least about 5 mg, at least about 6 mg, at least about 7 mg, at least about 8 mg, at least about 9 mg, at least about 10 mg, at least about 11 mg, at least about 12 mg, at least about 13 mg, at least about 14 mg, at least about 15 mg, at least about 16 mg, at least about 17 mg, at least about 18 mg, at least about 19 mg, at least about 20 mg, at least about 21 mg, at least about 22 mg, at least about 23 mg, at least about 24 mg, at least about 25 mg, at least about 26 mg, at least about 27 mg, at least about 28 mg, at least about 29 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 110 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 140 mg, at least about 150 mg, at least about 160 mg, at least about 170 mg, at least about 180 mg, at least about 190 mg, at least about 200 mg, at least about 220 mg or at least about 240 mg of the one or more ASOs.

[0135] In some aspects, the dose is at least about 1 mg of the one or more ASOs. In some aspects, the dose is at least about 2 mg of the one or more ASOs. In some aspects, the dose is at least about 3 mg of the one or more ASOs. In some aspects, the dose is at least about 4 mg of the one or more ASOs. In some aspects, the dose is at least about 5 mg of the one or more ASOs. In some aspects, the dose is at least about 6 mg of the one or more ASOs. In some aspects, the dose is at least about 7 mg of the one or more ASOs. In some aspects, the dose is at least about 8 mg of the one or more ASOs. In some aspects, the dose is at least about 9 mg of the one or more ASOs. In some aspects, the dose is at least about 10 mg of the one or more ASOs.

[0136] In some aspects, the dose is at least about 11 mg of the one or more ASOs. In some aspects, the dose is at least about 12 mg of the one or more ASOs. In some aspects, the dose is at least about 13 mg of the one or more ASOs. In some aspects, the dose is at least about 14 mg of the one or more ASOs. In some aspects, the dose is at least about 15 mg of the one or more ASOs. In some aspects, the dose is at least about 16 mg of the one or more ASOs. In some aspects, the dose is at least about 17 mg of the one or more ASOs. In some aspects, the dose is at least about 18 mg of the one or more ASOs. In some aspects, the dose is at least about 19 mg of the one or more ASOs. In some aspects, the dose is at least about 20 mg of the one or more ASOs.

[0137] In some aspects, the dose is at least about 21 mg of the one or more ASOs. In some aspects, the dose is at least about 22 mg of the one or more ASOs. In some aspects, the dose is at least about 23 mg of the one or more ASOs. In some aspects, the dose is at least about 24 mg of the one or more ASOs. In some aspects, the dose is at least about 25 mg of the one or more ASOs. In some aspects, the dose is at least about 26 mg of the one or more ASOs. In some aspects, the dose is at least about 27 mg of the one or more ASOs. In some aspects, the dose is at least about 28 mg of the one or more ASOs. In some aspects, the dose is at least about 29 mg of the one or more ASOs. In some aspects, the dose is at least about 30 mg of the one or more ASOs.

[0138] In some aspects, the dose is at least about 31 mg of the one or more ASOs. In some aspects, the dose is at least about 32 mg of the one or more ASOs. In some aspects, the dose is at least about 33 mg of the one or more ASOs. In some aspects, the dose is at least about 34 mg of the one or more ASOs. In some aspects, the dose is at least about 35 mg of the one or more ASOs. In some aspects, the dose is at least about 36 mg of the one or more ASOs. In some aspects, the dose is at least about 37 mg of the one or more ASOs. In some aspects, the dose is at least about 38 mg of the one or more ASOs. In some aspects, the dose is at least about 39 mg of the one or more ASOs. In some aspects, the dose is at least about 40 mg of the one or more ASOs.

[0139] In some aspects, the dose is at least about 41 mg of the one or more ASOs. In some aspects, the dose is at least about 42 mg of the one or more ASOs. In some aspects, the dose is at least about 43 mg of the one or more ASOs. In some aspects, the dose is at least about 44 mg of the one or more ASOs. In some aspects, the dose is at least about 45 mg of the one or more ASOs. In some aspects, the dose is at least about 46 mg of the one or more ASOs. In some aspects, the dose is at least about 47 mg of the one or more ASOs. In some aspects, the dose is at least about 48 mg of the one or more ASOs. In some aspects, the dose is at least about 49 mg of the one or more ASOs. In some aspects, the dose is at least about 50 mg of the one or more ASOs.

[0140] In some aspects, the dose is at least about 51 mg of the one or more ASOs. In some aspects, the dose is at least about 52 mg of the one or more ASOs. In some aspects, the dose is at least about 53 mg of the one or more ASOs. In some aspects, the dose is at least about 54 mg of the one or more ASOs. In some aspects, the dose is at least about 55 mg of the one or more ASOs. In some aspects, the dose is at least about 56 mg of the one or more ASOs. In some aspects, the dose is at least about 57 mg of the one or more ASOs. In some aspects, the dose is at least about 58 mg of the one or more ASOs. In some aspects, the dose is at least about 59 mg of the one or more ASOs. In some aspects, the dose is at least about 60 mg of the one or more ASOs.

[0141] In some aspects, the dose is administered daily, every two days, every three days, every four days, or every five days. In some aspects, during a 1-week cycle, the dose is administered once a week, twice a week, three times a week, four times a week, or five times a week. In some aspects, during the first 1-week cycle, the dose is administered twice a week. In some aspects, during the first 1-week cycle, the dose is administered three times a week. In some aspects, during the first 1-week cycle, the dose is administered four times a week.

[0142] In some aspects, the dose is administered approximately once a week, approximately once every two weeks, approximately once every three weeks, or approximately once every four weeks. In some aspects, the dose is administered twice a week. In some aspects, the dose is administered three times a week. In some aspects, the dose is administered three times a week during the first week of a 28-day cycle. In some aspects, the dose is administered twice a week during the first week of a 28-day cycle.

[0143] In some aspects, the dose is administered on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered on approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered on approximately day 1 of the third 28-day cycle. In some aspects, the dose is administered approximately every 56 days after the third 28-day cycle. In some aspects, the dose is administered (i) on approximately day 1 and day 15 of the first 28-day cycle, and (ii) on approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered (i) on approximately day 1 and day 15 of the first 28-day cycle, (ii) on approximately day 1 and day 15 of the second 28-day cycle, and (iii) on approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered (i) on approximately day 1 and day 15 of the first 28-day cycle, (ii) on approximately day 1 and day 15 of the second 28-day cycle, (iii) on approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0144] In some aspects, the dose is administered (i) three times per week in the first week of the first 28-day cycle, (ii) twice per week in the second week of the first 28-day cycle, and (iii) once per week in the fourth week of the first 28-day cycle. In some aspects, the dose is administered (i) three times per week in the first week of the first 28-day cycle, (ii) twice per week in the second week of the first 28-day cycle, (iii) once per week in the fourth week of the first 28-day cycle, and (iv) twice per month during each subsequent 28-day cycle, for example, during six subsequent 28-day cycles.

[0145] In some aspects, the dose is administered at a dose of approximately 5 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of approximately 5 mg of the ASO (i) on approximately day 1 and day 15 of the first 28-day cycle, and (ii) on approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of approximately 5 mg of the ASO (i) on approximately day 1 and day 15 of the first 28-day cycle, (ii) on approximately day 1 and day 15 of the second 28-day cycle, and (iii) on approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of approximately 5 mg (i) on approximately day 1 and day 15 of the first 28-day cycle, (ii) on approximately day 1 and day 15 of the second 28-day cycle, (iii) on approximately day 1 of the third 28-day cycle, and (iii) approximately once every 56 days after the third 28-day cycle.

[0146] In some aspects, the dose is administered at a dose of about 10 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 10 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 10 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 10 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0147] In some aspects, the dose is administered at a dose of about 15 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 15 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 15 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 15 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0148] In some aspects, the dose is administered at a dose of about 20 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 20 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 20 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 20 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0149] In some aspects, the dose is administered at a dose of about 25 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 25 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 25 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 25 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0150] In some aspects, the dose is administered at a dose of about 30 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 30 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 30 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 30 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0151] In some aspects, the dose is administered at a dose of about 35 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 35 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 35 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 35 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0152] In some aspects, the dose is administered at a dose of about 40 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 40 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 40 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 40 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0153] In some aspects, the dose is administered at a dose of about 45 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 45 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 45 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 45 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0154] In some aspects, the dose is administered at a dose of about 50 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 50 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 50 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 50 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0155] In some aspects, the dose is administered at a dose of about 55 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 55 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 55 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 55 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0156] In some aspects, the dose is administered at a dose of about 60 mg of the ASO on approximately day 1 and day 15 of the first 28-day cycle. In some aspects, the dose is administered at a dose of about 60 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, and (ii) approximately day 1 and day 15 of the second 28-day cycle. In some aspects, the dose is administered at a dose of about 60 mg of the ASO on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, and (iii) approximately day 1 of the third 28-day cycle. In certain aspects, the dose is administered at a dose of about 60 mg on (i) approximately day 1 and day 15 of the first 28-day cycle, (ii) approximately day 1 and day 15 of the second 28-day cycle, (iii) approximately day 1 of the third 28-day cycle, and (iii) approximately every 56 days after the third 28-day cycle.

[0157] In some aspects, the amount of the one or more ASOs in the dose is measured using anion exchange chromatography (AEX). In some aspects, the AEX comprises AEX ultra performance liquid chromatography (UPLC). In some aspects, the amount of the one or more ASOs in the dose is measured using hydrophilic chromatography. In some aspects, the amount of the one or more ASOs in the dose is measured using a ribogreen assay.

[0158] As described herein, the ASOs useful in the present disclosure can specifically hybridize to one or more regions of the STAT6 transcript (e.g., pre-mRNA or mRNA), thereby reducing and / or inhibiting STAT6 protein expression in cells. Accordingly, EVs (e.g., exosomes) (e.g., the EVs disclosed herein) comprising such ASOs can be used to prevent and / or treat any disease or disorder associated with increased STAT6 protein expression.

[0159] In some aspects, the diseases or disorders that can be treated with the methods of the present invention include cancer. In certain aspects, the cancer is associated with increased STAT6 protein expression. Non-limiting examples of cancers that can be treated with the present disclosure include: colorectal cancer, lung cancer (e.g., non-small cell lung cancer (NSCLC)), pancreatic cancer (e.g., pancreatic ductal adenocarcinoma (PDAC)), leukemia, uterine cancer, ovarian cancer, breast cancer, bladder cancer, cholangiocarcinoma, gastric cancer, or any combination thereof. In some aspects, the cancer is selected from colon adenocarcinoma, rectal adenocarcinoma, pancreatic cancer, pancreatic ductal adenocarcinoma (PDAC), ovarian serous cystadenocarcinoma, acute myeloid leukemia, testicular germ cell tumor, lung adenocarcinoma, low-grade glioma of the brain, glioblastoma multiforme, uveal melanoma, thyroid cancer, endometrial carcinoma of the uterine corpus, carcinosarcoma of the uterus, pheochromocytoma, paraganglioma, renal papillary cell carcinoma, gastric adenocarcinoma, renal clear cell carcinoma, thymoma, sarcoma, lung squamous cell carcinoma, esophageal adenocarcinoma, esophageal squamous cell carcinoma, and any combination thereof. In certain aspects, the cancer is a bone marrow-rich cancer. In some aspects, the cancer includes liver cancer. In some aspects, the cancer includes hepatocellular carcinoma (HCC). In some aspects, the cancer includes pancreatic ductal adenocarcinoma (PDAC). In some aspects, the cancer includes gastric cancer. In some aspects, the cancer includes gastric cancer that has metastasized to the liver. In some aspects, the cancer includes colorectal cancer (CRC). In some aspects, the cancer includes CRC that has metastasized to the liver. In some aspects, the cancer includes ovarian cancer. In some aspects, the cancer includes leptomeningeal carcinoma. In some aspects, the methods disclosed herein increase the infiltration of immune cells, such as macrophages, into the tumor. In certain aspects, the cancer is a bone marrow-rich cancer. In certain aspects, the cancer includes M2-rich cancers. In some aspects, the cancer includes liver cancer. In some aspects, the cancer includes hepatocellular carcinoma (HCC). In some aspects, the cancer includes pancreatic ductal adenocarcinoma (PDAC), and in some aspects, the cancer includes colorectal cancer (CRC). In some aspects, the cancer includes ovarian cancer. In some aspects, the cancer includes leptomeningeal carcinoma. In certain aspects, the cancer includes refractory tumors of the central nervous system.

[0160] In some aspects, the methods disclosed herein treat tumors of the central nervous system of a subject. In some aspects, the methods treat brain tumors of a subject. In some aspects, the methods treat glioblastoma of a subject. In some aspects, the glioblastoma is glioblastoma multiforme (GBM). In some aspects, the methods treat leptomeningeal carcinomatosis of a subject. In some aspects, EVs (e.g., exosomes) comprising ASO activate macrophages within the central nervous system. In some aspects, EVs (e.g., exosomes) comprising ASO induce M1 polarization of macrophages within the central nervous system. In some aspects, EVs (e.g., exosomes) comprising ASO activate meningeal macrophages. In some aspects, EVs (e.g., exosomes) comprising ASO induce M1 polarization of meningeal macrophages. In some aspects, EVs (e.g., exosomes) comprising ASO induce tumor infiltration of meningeal macrophages.

[0161] When administered to a subject with cancer, in certain aspects, the EVs (e.g., exosomes) of the present disclosure can upregulate the immune response and enhance the tumor targeting of the subject's immune system. In some aspects, the cancer being treated is characterized by infiltration of white blood cells (T cells, B cells, macrophages, dendritic cells, monocytes) into the tumor microenvironment, or a so-called "hot tumor" or "inflamed tumor". In some aspects, the cancer being treated is characterized by low or undetectable levels of infiltration of white blood cells into the tumor microenvironment, or a so-called "cold tumor" or "non-inflamed tumor". In some aspects, the dosage and timing of administration of the EVs are sufficient to convert a "cold tumor" into a "hot tumor", i.e., the administration causes infiltration of white blood cells (such as T cells) into the tumor microenvironment. In certain aspects, the cancer comprises bladder cancer, cervical cancer (e.g., cervical squamous cell carcinoma), renal cell carcinoma, testicular cancer, colorectal cancer, lung cancer, head and neck cancer, and ovarian, lymphoma, liver cancer, glioblastoma, melanoma, myeloma, leukemia, pancreatic cancer, or a combination thereof. In some aspects, the cancer comprises hepatocellular carcinoma (HCC). In some aspects, the cancer comprises advanced HCC. In some aspects, the cancer comprises gastric cancer. In some aspects, the cancer comprises colorectal cancer. In some aspects, the cancer has metastasized to the liver.

[0162] As used herein, the terms "distant tumor" or "distant metastasis" refer to a tumor that has spread from the original (or primary) tumor to a distant organ or distant tissue (e.g., lymph node). In some aspects, the EVs of the present disclosure treat tumors after metastatic spread. In some aspects, administration of the EVs (e.g., exosomes) of the present disclosure induces immune memory.

[0163] In some aspects, EVs (e.g., exosomes) containing ASO activate tumor-associated macrophages (TAMs). In some aspects, EVs (e.g., exosomes) containing ASO induce M1 polarization of TAMs. In some aspects, EVs (e.g., exosomes) containing ASO induce the expression of M1 markers in TAMs. In some aspects, EVs (e.g., exosomes) containing ASO reduce the expression of M2 markers in TAMs. Accordingly, certain aspects of the present disclosure relate to methods of inducing M1 polarization of TAMs, the methods comprising administering to a subject EVs (e.g., exosomes) containing ASO disclosed herein.

[0164] In some aspects, EVs (e.g., exosomes) treat fibrosis in a subject in need thereof. Excessive M2 macrophage activation causes the continued production of TGFβ and growth factors, thereby promoting the proliferation of myofibroblasts, the activation of EMT / EndoMT, and extracellular matrix deposition. M2 macrophages represent the breakpoint between wound healing and the exacerbation of the profibrotic process. In some aspects, the fibrosis is selected from liver fibrosis (NASH), cirrhosis, pulmonary fibrosis, cystic fibrosis, chronic ulcerative colitis / IBD, bladder fibrosis, renal fibrosis, CAPS (Muckle-Wells syndrome), atrial fibrosis, endomyocardial fibrosis, old myocardial infarction, glial scar, arteriosclerosis, joint fibrosis, Crohn's disease, Dupuytren's contracture, keloid fibrosis, mediastinal fibrosis, myelofibrosis, Peyronie's disease, nephrogenic systemic fibrosis, progressive massive fibrosis, retroperitoneal fibrosis, scleroderma / systemic sclerosis, adhesive capsulitis, and any combination thereof. In some aspects, EVs (e.g., exosomes) treat liver fibrosis (NASH). In some aspects, EVs (e.g., exosomes) treat CAPS (Muckle-Wells syndrome).

[0165] In some aspects, EVs (e.g., exosomes) treat neurodegenerative diseases. In some aspects, the neurodegenerative diseases are selected from Alzheimer's disease, Parkinson's disease, prion diseases, motor neuron diseases, Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, and any combination thereof.

[0166] In some aspects, EVs (e.g., exosomes) treat metabolic disorders / CVD. In some aspects, the metabolic disorder / CVD is selected from acid-base imbalance, metabolic encephalopathy, calcium metabolism disorder, DNA repair deficiency disorder, glucose metabolism disorder, hyperlacticacidemia, iron metabolism disorder, lipid metabolism disorder, malabsorption syndrome, metabolic syndrome X, inborn error of metabolism, mitochondrial disease, phosphorus metabolism disorder, porphyria, proteostasis deficiency, metabolic skin disease, cachexia syndrome, water and electrolyte imbalance, and any combination thereof.

[0167] In some aspects, EVs (e.g., exosomes) promote anti-tumor immunity in a subject. In some aspects, administration of EVs (e.g., exosomes) induces the expression of nitric oxide synthase (NOS2) in a subject. In some aspects, administration of EVs (e.g., exosomes) promotes the remodeling of the tumor microenvironment (TME) in a subject. In some aspects, administration of EVs (e.g., exosomes) induces the activation of tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells) in a subject. In some aspects, administration of EVs (e.g., exosomes) increases the effector / activator gene expression of tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells) in a subject. In certain aspects, after administration of EVs (e.g., exosomes), the expression of effector / activation genes Gzmb and Id2 increases in tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells). In some aspects, administration of EVs (e.g., exosomes) reduces the exhaustion of tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells) in a subject. In some aspects, administration of EVs (e.g., exosomes) decreases the expression of exhaustion markers in tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells). In some aspects, administration of EVs (e.g., exosomes) decreases the expression of Lag3 in tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells). In some aspects, administration of EVs (e.g., exosomes) increases the number of tumor-infiltrating lymphocytes (e.g., tumor-infiltrating CD8 T cells). In some aspects, administration of EVs (e.g., exosomes) decreases the number of, for example, Foxp3+ regulatory T cells in the TME.

[0168] In some aspects, EVs (e.g., exosomes) and / or PD-1 antagonists are administered intravenously into the circulatory system of a subject. In some aspects, EVs and / or PD-1 antagonists are infused into a suitable liquid and administered into the vein of a subject.

[0169] In some aspects, EVs (e.g., exosomes) and / or PD-1 antagonists are administered into the arteries of the circulatory system of a subject. In some aspects, the EVs and / or PD-1 antagonists are infused into a suitable fluid and administered into the artery of the subject.

[0170] In some aspects, EVs (e.g., exosomes) and / or PD-1 antagonists are administered to a subject by intrathecal administration. In some aspects, EVs (e.g., exosomes) and / or PD-1 antagonists are administered by intrathecal administration followed by applying a mechanical convection force to the torso. See, e.g., Verma et al., Alzheimer's Dement. 12:e12030 (2020); which is incorporated herein by reference in its entirety). In some aspects, the mechanical convection force (e.g., an oscillating vest) facilitates further downward diffusion of intrathecally administered EVs (e.g., exosomes) along the nerves, thereby allowing better delivery of the EVs (e.g., exosomes) to the nerves.

[0171] In some aspects, the intra- and inter-compartmental biodistribution of exosomes can be manipulated by an exogenous external force that acts on the subject after compartmental delivery of the exosomes. This includes the application of mechanical convection, such as by applying impact, vibration, shaking, or massage to a body compartment or the whole body. For example, after intrathecal administration, chest wall vibration can be applied in several ways, including by an oscillating mechanical jacket, to spread the biodistribution of exosomes along the nerve axis or along the cranial and spinal nerves, which aids in the treatment of neurological diseases by exosomes carrying drugs.

[0172] In some aspects, applying an external mechanical convection force by an oscillating jacket or other similar means can be used to remove exosomes and other materials from the cerebrospinal fluid in the intrathecal space and drain them into the peripheral circulation. This aspect helps to remove endogenous toxic exosomes and other harmful macromolecules such as beta-amyloid, tau protein, alpha-synuclein, TDP43, neurofilaments, and excess cerebrospinal fluid from the intrathecal space to the periphery for clearance.

[0173] In some aspects, exosomes delivered by the intraventricular route can be translocated along the entire nerve axis by simultaneously incorporating a lumbar puncture and allowing ventriculo-lumbar perfusion, where additional fluid is infused into the ventricles after exosome administration while allowing the existing CSF axonal column to drain through the lumbar puncture. Ventriculo-lumbar perfusion can allow exosomes administered by ICV to spread along the entire nerve axis and completely cover the subarachnoid space to treat leptomeningeal carcinomatosis and other diseases.

[0174] In some aspects, external extracorporeal focused ultrasound, thermal energy (heat), or cold can be used to manipulate the compartmental pharmacokinetics and drug release characteristics of exosomes that are engineered to be sensitive to these phenomena.

[0175] In some aspects, the inter-compartmental behavior and biodistribution of exosomes engineered to contain paramagnetic materials can be manipulated by externally applying a magnet or magnetic field.

[0176] In some aspects, EVs are administered by injection into the spinal canal or into the subarachnoid space to reach the cerebrospinal fluid (CSF).

[0177] In some aspects, EVs (e.g., exosomes) are administered intratumorally to one or more tumors of a subject.

[0178] In some aspects, EVs (e.g., exosomes) are administered to a subject by intranasal administration. In some aspects, EVs can be insufflated nasally in the form of a topical or systemic administration. In certain aspects, EVs are administered in the form of a nasal spray.

[0179] In some aspects, EVs (e.g., exosomes) are administered to a subject by intraperitoneal administration. In some aspects, EVs are infused into a suitable fluid and injected into the peritoneum of the subject. In some aspects, intraperitoneal administration results in the distribution of EVs to the lymph. In some aspects, intraperitoneal administration results in the distribution of EVs to the thymus, spleen, and / or bone marrow. In some aspects, intraperitoneal administration results in the distribution of EVs to one or more lymph nodes. In some aspects, intraperitoneal administration results in the distribution of EVs to one or more of the cervical lymph nodes, inguinal lymph nodes, mediastinal lymph nodes, or sternal lymph nodes. In some aspects, intraperitoneal administration results in the distribution of EVs to the pancreas.

[0180] In some aspects, EVs (e.g., exosomes) are administered to a subject by periocular administration. In some aspects, s are injected into the periocular tissue. Periocular drug administration includes routes of subconjunctival, anterior sub-Tenon's, posterior sub-Tenon's, and retrobulbar administration.

[0181] In some aspects, the method further comprises administering a PD-1 antagonist. In some aspects, the PD-1 antagonist blocks, inhibits, and / or reduces the interaction between PD-1 and PD-L1. In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof that specifically binds to PD-1 (“anti-PD-1 antibody”). In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof that specifically binds to PD-L1 (“anti-PD-L1 antibody”). In some aspects, the extracellular vesicles containing ASO and the PD-1 antagonist are administered simultaneously. In some aspects, the extracellular vesicles containing ASO and the PD-1 antagonist are administered sequentially. In some aspects, the extracellular vesicles containing ASO and the PD-1 antagonist are administered on the same day. In some aspects, the extracellular vesicles containing ASO are administered before the PD-1 antagonist.

[0182] II.B. Combination Therapy

[0183] Some aspects of the present disclosure relate to methods of administering to a subject in need thereof: (i) a dose of one or more antisense oligonucleotides (ASOs) targeting STAT6 transcripts (SEQ ID NO: 1 or SEQ ID NO: 3), wherein each of the one or more ASOs comprises a continuous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; and wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg; and (ii) an additional therapy. In some aspects, the additional therapy is an additional anti-cancer agent and / or an immunomodulator. Such agents can include, for example, chemotherapy drugs, small molecule drugs, or antibodies that stimulate an immune response against a given cancer. In some aspects, the methods described herein are used in combination with standard of care treatments (e.g., surgery, radiation, and chemotherapy).

[0184] In some aspects, the EVs (e.g., exosomes) disclosed herein can be used in combination with one or more additional therapeutic agents (e.g., immuno-oncology agents) such that multiple elements of the immune pathway can be targeted. Non-limiting examples of such combinations include: therapies that enhance tumor antigen presentation (e.g., dendritic cell vaccines, GM-CSF secreting cell vaccines, CpG oligonucleotides, imiquimod); therapies that inhibit negative immune regulation, e.g., by inhibiting the CTLA-4 and / or PD1 / PD-L1 / PD-L2 pathways and / or depleting or blocking Tregs or other immunosuppressive cells (e.g., myeloid-derived suppressor cells); therapies that stimulate positive immune regulation, e.g., using agonists that stimulate the CD-137, OX-40, and / or CD40 or GITR pathways and / or stimulate T cell effector function; therapies that systemically increase the frequency of anti-tumor T cells; therapies that deplete or inhibit Tregs (such as Tregs in tumors), e.g., using antagonists of CD25 (e.g., daclizumab) or depletion by ex vivo anti-CD25 beads; therapies that affect the function of inhibitory myeloid cells in tumors; therapies that enhance the immunogenicity of tumor cells (e.g., anthracyclines); adoptive T cell or NK cell transfer, which includes genetically modified cells, e.g., cells modified by chimeric antigen receptors (CAR-T therapy); therapies that inhibit metabolic enzymes such as indoleamine dioxygenase (IDO), dioxygenases, arginase, or nitric oxide synthase; therapies that reverse / prevent T cell anergy or exhaustion; therapies that trigger innate immune activation and / or inflammation at the tumor site; administration of immunostimulatory cytokines; or blockade of immunosuppressive cytokines.

[0185] In some aspects, the additional anti-cancer agent comprises an immune checkpoint inhibitor (i.e., blocking signal transduction through a specific immune checkpoint pathway). Non-limiting examples of immune checkpoint inhibitors that can be used in the methods of the present invention include CTLA-4 antagonists (e.g., anti-CTLA-4 antibodies), PD-1 antagonists (e.g., anti-PD-1 antibodies, anti-PD-L1 antibodies), TIM-3 antagonists (e.g., anti-TIM-3 antibodies), or combinations thereof.

[0186] In some aspects, the immuno-oncology agent comprises an immune checkpoint activator (i.e., promoting signal transduction through a specific immune checkpoint pathway). In certain aspects, the immune checkpoint activator includes OX40 agonists (e.g., anti-OX40 antibodies), LAG-3 agonists (e.g., anti-LAG-3 antibodies), 4-1BB (CD137) agonists (e.g., anti-CD137 antibodies), GITR agonists (e.g., anti-GITR antibodies), or any combination thereof.

[0187] In some aspects, the additional anti-cancer agent comprises standard of care chemotherapy. In some aspects, the standard of care chemotherapy comprises platinum-based chemotherapy. In some aspects, the standard of care chemotherapy comprises platinum-based doublet chemotherapy.

[0188] In some aspects, the additional anti-cancer agent is the standard of care therapy for treating colorectal cancer. In some aspects, the additional anti-cancer agent comprises 5-fluorouracil (FU), leucovorin (LV), oxaliplatin, irinotecan, anti-vascular endothelial growth factor (VEGF) antibody, anti-epidermal growth factor receptor (EGFR) antibody, or any combination thereof. In some aspects, the additional anti-cancer agent comprises FU, LV, and oxaliplatin (FOLFOX). In some aspects, the additional anti-cancer agent comprises FU, LV, and irinotecan (FOLFIRI). In some aspects, the subject has microsatellite instability-high (MSI-high) colorectal cancer. In some aspects, the subject has colorectal cancer presenting one or more KRAS mutations, such as at position Gly12, Gly13, Glu61, or any combination thereof. In some aspects, the subject has colorectal cancer presenting one or more BRAF mutations (e.g., BRAF V600E).

[0189] In some aspects, additional anti-cancer agents are standard of care therapies for treating HCC. In some aspects, the additional anti-cancer agent comprises sorafenib. In some aspects, the additional anti-cancer agent comprises lenvatinib. In some aspects, the additional anti-cancer agent comprises atezolizumab and bevacizumab. In some aspects, the additional anti-cancer agent comprises pembrolizumab, nivolumab, ipilimumab, or a combination thereof. In some aspects, the additional anti-cancer agent comprises FU, LV, and oxaliplatin (FOLFOX). In some aspects, the additional anti-cancer agent comprises regorafenib, cabozantinib, ramucirumab, or any combination thereof.

[0190] In some aspects, additional anti-cancer agents are standard of care therapies for treating colorectal gastric cancer. In some aspects, the additional anti-cancer agent comprises (i) epirubicin, cisplatin, and 5-FU (“ECF”); (ii) or epirubicin, cisplatin, and capecitabine (“ECX”); or (iii) docetaxel, oxaliplatin, and 5-FU / leucovorin (“FLOT”). In some aspects, the additional anti-cancer agent comprises a HER2-targeting agent.

[0191] In some aspects, the combination of EVs (e.g., exosomes) disclosed herein and the second agent (e.g., immune checkpoint inhibitor) discussed herein can be administered simultaneously as a single composition in a pharmaceutically acceptable carrier. In other aspects, the combination of EVs (e.g., exosomes) and the second agent (e.g., immune checkpoint inhibitor) discussed herein can be administered simultaneously as separate compositions. In additional aspects, the combination of EVs (e.g., exosomes) and the second agent (e.g., immune checkpoint inhibitor) discussed herein can be administered sequentially. In some aspects, the EVs (e.g., exosomes) are administered before the second agent (e.g., immune checkpoint inhibitor).

[0192] III. Antisense oligonucleotides (ASO)

[0193] The present disclosure employs antisense oligonucleotides (ASOs) for modulating the function of nucleic acid molecules encoding mammalian STAT6, such as STAT6 nucleic acids, e.g., STAT6 transcripts, including STAT6 precursor mRNA and STAT6 mRNA, or nucleic acid molecules that are naturally occurring variants of such nucleic acid molecules encoding mammalian STAT6. In the context of the present disclosure, the term "ASO" refers to a molecule formed by covalent bonds of two or more nucleotides (i.e., an oligonucleotide).

[0194] In some aspects, EVs (e.g., exosomes) comprise at least one ASO. In some aspects, EVs (e.g., exosomes) comprise at least two ASOs, e.g., a first ASO comprising a first nucleotide sequence and a second ASO comprising a second nucleotide sequence. In some aspects, EVs (e.g., exosomes) comprise at least three ASOs, at least four ASOs, at least five ASOs, at least six ASOs, or more than six ASOs. In some aspects, the first ASO, the second ASO, the third ASO, the fourth ASO, the fifth ASO, the sixth ASO, and / or the ninth ASO are different.

[0195] In some aspects, EVs (e.g., exosomes) comprise a first ASO and a second ASO, wherein the first ASO comprises a first nucleotide sequence complementary to a first target sequence in a first transcript, and wherein the second ASO comprises a second nucleotide sequence complementary to a second target sequence in the first transcript. In some aspects, the first target sequence does not overlap with the second target sequence. In some aspects, the first target sequence comprises at least one nucleotide within the 5'UTR of the transcript, and the second target sequence does not comprise nucleotides within the 5'UTR. In some aspects, the first target sequence comprises at least one nucleotide within the 3'UTR of the transcript, and the second target sequence does not comprise nucleotides within the 3'UTR. In some aspects, the first target sequence comprises at least one nucleotide within the 5'UTR of the transcript, and the second target sequence comprises at least one nucleotide within the 3'UTR.

[0196] In some aspects, the first ASO targets a sequence within an exon-intron junction, and the second ASO targets a sequence within an exon-intron junction. In some aspects, the first ASO targets a sequence within an exon-intron junction, and the second ASO targets a sequence within an exon. In some aspects, the first ASO targets a sequence within an exon-intron junction, and the second ASO targets a sequence within an intron. In some aspects, the first ASO targets a sequence within an exon, and the second ASO targets a sequence within an exon. In some aspects, the first ASO targets a sequence within an intron, and the second ASO targets a sequence within an exon. In some aspects, the first ASO targets a sequence within an intron, and the second ASO targets a sequence within an intron.

[0197] In some aspects, an EV (e.g., an exosome) contains a first ASO and a second ASO, wherein the first ASO contains a first nucleotide sequence complementary to a first target sequence in a first transcript, and wherein the second ASO contains a second nucleotide sequence complementary to a second target sequence in a second transcript, wherein the first transcript is not a product of the same gene as the second transcript.

[0198] The ASO contains a continuous nucleotide sequence that is about 10 to about 30 nucleotides in length, such as 10 - 20 nucleotides, 14 - 20 nucleotides, 16 - 20 nucleotides, or 15 - 25 nucleotides. In certain aspects, the length of the ASO is 20 nucleotides. In certain aspects, the length of the ASO is 18 nucleotides. In certain aspects, the length of the ASO is 19 nucleotides. In certain aspects, the length of the ASO is 17 nucleotides. In certain aspects, the length of the ASO is 16 nucleotides. In certain aspects, the length of the ASO is 15 nucleotides. In certain aspects, the length of the ASO is 14 nucleotides. In certain aspects, the length of the ASO is 13 nucleotides. In certain aspects, the length of the ASO is 12 nucleotides. In certain aspects, the length of the ASO is 11 nucleotides. In certain aspects, the length of the ASO is 10 nucleotides.

[0199] In some aspects, the ASO comprises a continuous nucleotide sequence that is about 10 to about 50 nucleotides in length, such as, about 10 to about 45, about 10 to about 40, about 10 to about 35, or about 10 to about 30 nucleotides. In certain aspects, the length of the ASO is 21 nucleotides. In certain aspects, the length of the ASO is 22 nucleotides. In certain aspects, the length of the ASO is 23 nucleotides. In certain aspects, the length of the ASO is 24 nucleotides. In certain aspects, the length of the ASO is 25 nucleotides. In certain aspects, the length of the ASO is 26 nucleotides. In certain aspects, the length of the ASO is 27 nucleotides. In certain aspects, the length of the ASO is 28 nucleotides. In certain aspects, the length of the ASO is 29 nucleotides. In certain aspects, the length of the ASO is 30 nucleotides. In certain aspects, the length of the ASO is 31 nucleotides. In certain aspects, the length of the ASO is 32 nucleotides. In certain aspects, the length of the ASO is 33 nucleotides. In certain aspects, the length of the ASO is 34 nucleotides. In certain aspects, the length of the ASO is 35 nucleotides. In certain aspects, the length of the ASO is 36 nucleotides. In certain aspects, the length of the ASO is 37 nucleotides. In certain aspects, the length of the ASO is 38 nucleotides. In certain aspects, the length of the ASO is 39 nucleotides. In certain aspects, the length of the ASO is 40 nucleotides. In certain aspects, the length of the ASO is 41 nucleotides. In certain aspects, the length of the ASO is 42 nucleotides. In certain aspects, the length of the ASO is 43 nucleotides. In certain aspects, the length of the ASO is 44 nucleotides. In certain aspects, the length of the ASO is 45 nucleotides. In certain aspects, the length of the ASO is 46 nucleotides. In certain aspects, the length of the ASO is 47 nucleotides. In certain aspects, the length of the ASO is 48 nucleotides. In certain aspects, the length of the ASO is 49 nucleotides. In certain aspects, the length of the ASO is 50 nucleotides.

[0200] As used herein, the terms "antisense ASO", "antisense oligonucleotide", and "oligomer" may be used interchangeably with the term "ASO".

[0201] References to SEQ ID numbers include the specific nucleobase sequences, but do not include any design or complete chemical structure. Additionally, unless otherwise indicated, the ASOs disclosed in the figures herein show representative designs but are not limited to the specific designs shown in the figures. For example, when a claim (or this specification) refers to SEQ ID NO:101, it only includes the nucleotide sequence of SEQ ID NO:101. The design of any ASO disclosed herein can be written as SEQ ID NO:XX, where each of the first nucleotide, second nucleotide, third nucleotide, first nucleotide, second nucleotide, and the Nth nucleotide from the 5'-end is a modified nucleotide, e.g., LNA, and each of the other nucleotides is an unmodified nucleotide (e.g., DNA).

[0202] In various aspects, the ASOs of the present disclosure do not contain RNA (units). In some aspects, the ASO contains one or more DNA units. In one aspect, the ASO according to the present disclosure is a linear molecule or is synthesized as a linear molecule. In some aspects, the ASO is a single-stranded molecule and does not contain short regions of, for example, at least 3, 4, or 5 consecutive nucleotides that are complementary to an equivalent region (i.e., duplex) within the same ASO - in this aspect, the ASO is not (substantially) double-stranded. In some aspects, the ASO is substantially not double-stranded. In some aspects, the ASO is not siRNA. In various aspects, the ASOs of the present disclosure can consist entirely of continuous nucleotide regions. Thus, in some aspects, the ASO is substantially not self-complementary.

[0203] In other aspects, the present disclosure includes fragments of the ASO. For example, the present disclosure includes at least one nucleotide, at least two consecutive nucleotides, at least three consecutive nucleotides, at least four consecutive nucleotides, at least five consecutive nucleotides, at least six consecutive nucleotides, at least seven consecutive nucleotides, at least eight consecutive nucleotides, or at least nine consecutive nucleotides of the ASOs disclosed herein. Fragments of any sequence disclosed herein are contemplated as part of the present disclosure.

[0204] In some aspects, the ASOs for the present disclosure include phosphorodiamidate morpholino oligomers (PMO) or peptide-conjugated phosphorodiamidate morpholino oligomers (PPMO).

[0205] In some aspects, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90% of one or more ASOs associate with one or more EVs. In some aspects, at least about 20% of one or more ASOs associate with one or more EVs. In some aspects, at least about 25% of one or more ASOs associate with one or more EVs. In some aspects, at least about 30% of one or more ASOs associate with one or more EVs. In some aspects, at least about 35% of one or more ASOs associate with one or more EVs. In some aspects, at least about 40% of one or more ASOs associate with one or more EVs. In some aspects, at least about 45% of one or more ASOs associate with one or more EVs. In some aspects, at least about 50% of one or more ASOs associate with one or more EVs. In some aspects, at least about 55% of one or more ASOs associate with one or more EVs. In some aspects, at least about 60% of one or more ASOs associate with one or more EVs. In some aspects, at least about 65% of one or more ASOs associate with one or more EVs. In some aspects, at least about 70% of one or more ASOs associate with one or more EVs. In some aspects, at least about 75% of one or more ASOs associate with one or more EVs. In some aspects, at least about 80% of one or more ASOs associate with one or more EVs. In some aspects, at least about 85% of one or more ASOs associate with one or more EVs. In some aspects, at least about 90% of one or more ASOs associate with one or more EVs.

[0206] III.A. ASOs Targeting STAT6

[0207] Suitably, the ASOs of the present disclosure are capable of downregulating (e.g., reducing or eliminating) the expression of STAT6 mRNA or STAT6 protein. In this regard, the ASOs of the present disclosure can promote the differentiation of M2 macrophages and / or reduce the differentiation of M1 macrophages. Specifically, the present disclosure relates to ASOs targeting one or more regions (e.g., intronic regions, exonic regions, and / or exon-intron junction regions) of the STAT6 pre-mRNA.

[0208] Unless otherwise indicated, the term “STAT6” as used herein can refer to STAT6 from one or more species (e.g., human, non-human primate, dog, cat, guinea pig, rabbit, rat, mouse, horse, cow, and bear).

[0209] STAT6 (Signal Transducer and Activator of Transcription 6) is also known as Signal Transducer and Activator of Transcription 6. Synonyms for STAT6 / STAT6 are known and include IL-4STAT; STAT, interleukin 4-induced; transcription factor IL-4STAT; STAT6B; STAT6C; and D12S1644. The sequence of the human STAT6 gene can be found under the publicly available GenBank accession number NC_000012.12:c57111413-57095404. The human STAT6 gene is found at chromosomal position 12q13.3, complement, at 57111413-57095404.

[0210] The sequence of the human STAT6 pre-mRNA transcript (SEQ ID NO:1) corresponds to the reverse complementary sequence of residues 57111413 to 57095404, the complementary sequence of chromosome 12q13.3. The STAT6 mRNA sequence (GenBank accession number NM_001178078.1) is provided in SEQ ID NO:3 (Table 1), but the nucleotide "t" in SEQ ID NO:3 is shown as "u" in the mRNA. The sequence of the human STAT6 protein can be found under the public accession numbers: P42226-1, (canonical sequence, SEQ ID NO:2; Table 1), P42226-2 (SEQ ID NO:4) and P42226-3 (SEQ ID NO:5), each of these accession numbers is incorporated herein by reference in its entirety.

[0211] Table 1. STAT6 mRNA and Protein Sequences

[0212]

[0213]

[0214] Natural variants of the human STAT6 gene product are known. For example, natural variants of the human STAT6 protein can contain one or more amino acid substitutions selected from: M118R, D419N, and any combination thereof. Additional variants of the human STAT6 protein produced by alternative splicing are also known in the art. STAT6 isoform 2 (identifier on UniProt: P42226-2) differs from the canonical sequence (SEQ ID NO:3) in that residues 1-174 are deleted relative to SEQ ID NO:3 and 175 MEQ 177 is substituted for 175 PSE 177。The sequence of STAT6 isoform 3 (identifier: P42226-3) differs from the canonical sequence (SEQ ID NO: 3) as follows: residues 1 to 110 are missing relative to SEQ ID NO: 3. Accordingly, the ASOs of the present disclosure can be designed to reduce or inhibit the expression of the native variants of the STAT6 protein.

[0215] An example of the target nucleic acid sequence of the ASO is STAT6 pre-mRNA. SEQ ID NO: 1 represents the human STAT6 genomic sequence (i.e., the reverse complementary sequence of nucleotides 57111413 to 57095404, the complementary sequence of chromosome 12q13.3). SEQ ID NO: 1 is identical to the STAT6 pre-mRNA sequence, except that the nucleotide "t" in SEQ ID NO: 1 is shown as "u" in the pre-mRNA. In some aspects, the "target nucleic acid" includes the introns of the STAT6 protein encoding nucleic acid or its naturally occurring variants, and the RNA nucleic acids derived therefrom, e.g., pre-mRNA. In other aspects, the target nucleic acid includes the exon regions of the STAT6 protein encoding nucleic acid or its naturally occurring variants, and the RNA nucleic acids derived therefrom, e.g., pre-mRNA. In still other aspects, the target nucleic acid includes the exon-intron junctions of the STAT6 protein encoding nucleic acid or its naturally occurring variants, and the RNA nucleic acids derived therefrom, e.g., pre-mRNA. In some aspects, e.g., when used in research or diagnosis, the "target nucleic acid" can be cDNA or synthetic oligonucleotides derived from the above DNA or RNA nucleic acid targets. The human STAT6 protein sequence encoded by the STAT6 pre-mRNA is shown as SEQ ID NO: 3. In other aspects, the target nucleic acid includes the untranslated regions of the STAT6 protein encoding nucleic acid or its naturally occurring variants, e.g., 5'UTR, 3'UTR, or both.

[0216] In some aspects, the ASOs of the present disclosure hybridize to regions within the introns of the STAT6 transcript (e.g., SEQ ID NO: 1). In certain aspects, the ASOs of the present disclosure hybridize to regions within the exons of the STAT6 transcript (e.g., SEQ ID NO: 1). In other aspects, the anti-ASOs of the present disclosure hybridize to regions within the exon-intron junctions of the STAT6 transcript (e.g., SEQ ID NO: 1). In certain aspects, the ASOs of the present disclosure hybridize to regions within the STAT6 transcript (e.g., introns, exons, or exon-intron junctions), e.g., SEQ ID NO: 1, wherein the ASO has a design according to the formula: 5'A-B-C 3' described elsewhere herein.

[0217] In some aspects, the ASO targets the mRNA encoding a specific isoform of the STAT6 protein (e.g., isoform 1). In some aspects, the ASO targets all isoforms of the STAT6 protein. In other aspects, the ASO targets two isoforms of the STAT6 protein (e.g., isoform 1 and isoform 2, isoform 1 and isoform 3, or isoform 2 and isoform 3).

[0218] In some aspects, the ASO comprises a continuous nucleotide sequence that is complementary to a nucleic acid sequence within the STAT6 transcript (e.g., having a length of 10 to 30 nucleotides, such as a length of 20 nucleotides), e.g., a region corresponding to SEQ ID NO:1 or SEQ ID NO:3. In certain aspects, the ASO comprises a continuous nucleotide sequence that hybridizes to a nucleic acid sequence or a region within the sequence of the STAT6 transcript ("target region"), wherein the nucleic acid sequence corresponds to (i) nucleotides 1–700 of SEQ ID NO:3; (ii) nucleotides 1000 - 1500 of SEQ ID NO:3; (iii) nucleotides 1500 - 2000 of SEQ ID NO:3; (iv) nucleotides 2000–2500 of SEQ ID NO:3; (v) positions 2500–3000 of SEQ ID NO:3; or (vi) positions 3000–3700 of SEQ ID NO:3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0219] In some aspects, the ASO comprises a continuous nucleotide sequence that hybridizes to a nucleic acid sequence or a region within the sequence ("target region") of the STAT6 transcript, wherein the nucleic acid sequence corresponds to (i) nucleotides 413–803 of SEQ ID NO:3; (ii) nucleotides 952 - 1688 of SEQ ID NO:3; (iii) nucleotides 1726 - 2489 of SEQ ID NO:3; (iv) nucleotides 2682–2912 of SEQ ID NO:3; (v) positions 2970–3203 of SEQ ID NO:3; or (vi) positions 3331–3561 of SEQ ID NO:3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0220] In some aspects, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence or a region within the sequence (“target region”) of the STAT6 transcript, wherein the nucleic acid sequence corresponds to (i) nucleotides 463–753 of SEQ ID NO:3; (ii) nucleotides 1002-1638 of SEQ ID NO:3; (iii) nucleotides 1776-2439 of SEQ ID NO:3; (iv) nucleotides 2682–2862 of SEQ ID NO:3; (v) positions 3020–3153 of SEQ ID NO:3; or (vi) 3381–3511 of SEQ ID NO:3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0221] In some aspects, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence or a region within the sequence (“target region”) of the STAT6 transcript, wherein the nucleic acid sequence corresponds to (i) nucleotides 503–713 of SEQ ID NO:3; (ii) nucleotides 1042-1598 of SEQ ID NO:3; (iii) nucleotides 1816-2399 of SEQ ID NO:3; (iv) nucleotides 2722–2822 of SEQ ID NO:3; (v) positions 3060–3113 of SEQ ID NO:3; or (vi) 3421–3471 of SEQ ID NO:3, and wherein, optionally, the ASO has one of the designs described herein or a chemical structure shown elsewhere herein.

[0222] In some aspects, the target region corresponds to nucleotides 1053 - 1067 of SEQ ID NO:3 (e.g., ASO-STAT6-1053; SEQ ID NO:91). In some aspects, the target region corresponds to nucleotides 1359 - 1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1359; SEQ ID NO:92). In some aspects, the target region corresponds to nucleotides 1890 - 1904 of SEQ ID NO:3 (e.g., ASO-STAT6-1890; SEQ ID NO:93). In some aspects, the target region corresponds to nucleotides 1892 - 1906 of SEQ ID NO:3 (e.g., ASO-STAT6-1892; SEQ ID NO:94). In some aspects, the target region corresponds to nucleotides 1915 - 1929 of SEQ ID NO:3 (e.g., ASO-STAT6-1915; SEQ ID NO:95). In some aspects, the target region corresponds to nucleotides 1916 - 1930 of SEQ ID NO:3 (e.g., ASO-STAT6-1916; SEQ ID NO:96). In some aspects, the target region corresponds to nucleotides 1917 - 1931 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; SEQ ID NO:97). In some aspects, the target region corresponds to nucleotides 1918 - 1932 of SEQ ID NO:3 (e.g., ASO-STAT6-1918; SEQ ID NO:98). In some aspects, the target region corresponds to nucleotides 1919 - 1933 of SEQ ID NO:3 (e.g., ASO-STAT6-1919; SEQ ID NO:99). In some aspects, the target region corresponds to nucleotides 1920 - 1934 of SEQ ID NO:3 (e.g., ASO-STAT6-1920; SEQ ID NO:100). In some aspects, the target region corresponds to nucleotides 1937 - 1951 of SEQ ID NO:3 (e.g., ASO-STAT6-1937; SEQ ID NO:101). In some aspects, the target region corresponds to nucleotides 1938 - 1952 of SEQ ID NO:3 (e.g., ASO-STAT6-1938; SEQ ID NO:102). In some aspects, the target region corresponds to nucleotides 2061 - 2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2061; SEQ ID NO:103). In some aspects, the target region corresponds to nucleotides 2062 - 2076 of SEQ ID NO:3 (e.g., ASO-STAT6-2062; SEQ ID NO:104). In some aspects, the target region corresponds to nucleotides 2063 - 2077 of SEQ ID NO:3 (e.g., ASO-STAT6-2063;(SEQ ID NO:105) In some aspects, the target region corresponds to nucleotides 2064 - 2078 of SEQ ID NO:3 (e.g., ASO-STAT6-2064; SEQ ID NO:106) In some aspects, the target region corresponds to nucleotides 2066 - 2080 of SEQ ID NO:3 (e.g., ASO-STAT6-2066; SEQ ID NO:107) In some aspects, the target region corresponds to nucleotides 2067 - 2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2067; SEQ ID NO:108) In some aspects, the target region corresponds to nucleotides 2068 - 2082 of SEQ ID NO:3 (e.g., ASO-STAT6-2068; SEQ ID NO:109) In some aspects, the target region corresponds to nucleotides 2352 - 2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2352; SEQ ID NO:110) In some aspects, the target region corresponds to nucleotides 3073 - 3087 of SEQ ID NO:3 (e.g., ASO-STAT6-3073; SEQ ID NO:111) In some aspects, the target region corresponds to nucleotides 1053 - 1068 of SEQ ID NO:3 (e.g., ASO-STAT6-1053; SEQ ID NO:112) In some aspects, the target region corresponds to nucleotides 1054 - 1069 of SEQ ID NO:3 (e.g., ASO-STAT6-1054; SEQ ID NO:113) In some aspects, the target region corresponds to nucleotides 1356 - 1371 of SEQ ID NO:3 (e.g., ASO-STAT6-1356; SEQ ID NO:114) In some aspects, the target region corresponds to nucleotides 1847 - 1862 of SEQ ID NO:3 (e.g., ASO-STAT6-1847; SEQ ID NO:115) In some aspects, the target region corresponds to nucleotides 1886 - 1901 of SEQ ID NO:3 (e.g., ASO-STAT6-1886; SEQ ID NO:116) In some aspects, the target region corresponds to nucleotides 1887 - 1902 of SEQ ID NO:3 (e.g., ASO-STAT6-1887; SEQ ID NO:117) In some aspects, the target region corresponds to nucleotides 1888 - 1903 of SEQ ID NO:3 (e.g., ASO-STAT6-1888; SEQ ID NO:118) In some aspects, the target region corresponds to nucleotides 1889 - 1904 of SEQ ID NO:3 (e.g., ASO-STAT6-1889;SEQ ID NO: 119) In some aspects, the target region corresponds to nucleotides 1890 - 1905 of SEQ ID NO: 3 (e.g., ASO-STAT6-1890; SEQ ID NO: 120) In some aspects, the target region corresponds to nucleotides 1893 - 1908 of SEQ ID NO: 3 (e.g., ASO-STAT6-1893; SEQ ID NO: 121) In some aspects, the target region corresponds to nucleotides 1917 - 1932 of SEQ ID NO: 3 (e.g., ASO-STAT6-1917; SEQ ID NO: 122) In some aspects, the target region corresponds to nucleotides 1919 - 1934 of SEQ ID NO: 3 (e.g., ASO-STAT6-1919; SEQ ID NO: 123) In some aspects, the target region corresponds to nucleotides 2056 - 2071 of SEQ ID NO: 3 (e.g., ASO-STAT6-2056; SEQ ID NO: 124) In some aspects, the target region corresponds to nucleotides 2060 - 2075 of SEQ ID NO: 3 (e.g., ASO-STAT6-2060; SEQ ID NO: 125) In some aspects, the target region corresponds to nucleotides 2066 - 2081 of SEQ ID NO: 3 (e.g., ASO-STAT6-2066; SEQ ID NO: 126) In some aspects, the target region corresponds to nucleotides 2070 - 2085 of SEQ ID NO: 3 (e.g., ASO-STAT6-2070; SEQ ID NO: 127) In some aspects, the target region corresponds to nucleotides 2351 - 2366 of SEQ ID NO: 3 (e.g., ASO-STAT6-2351; SEQ ID NO: 128) In some aspects, the target region corresponds to nucleotides 2352 - 2367 of SEQ ID NO: 3 (e.g., ASO-STAT6-2352; SEQ ID NO: 129) In some aspects, the target region corresponds to nucleotides 2359 - 2374 of SEQ ID NO: 3 (e.g., ASO-STAT6-2359; SEQ ID NO: 130) In some aspects, the target region corresponds to nucleotides 3633 - 3648 of SEQ ID NO: 3 (e.g., ASO-STAT6-3633; SEQ ID NO: 131) In some aspects, the target region corresponds to nucleotides 673 - 689 of SEQ ID NO: 3 (e.g., ASO-STAT6-673; SEQ ID NO: 132) In some aspects, the target region corresponds to nucleotides 1052 - 1068 of SEQ ID NO: 3 (e.g., ASO-STAT6-1052;SEQ ID NO: 133) In some aspects, the target region corresponds to nucleotides 1356 - 1372 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1356; SEQ ID NO: 134) In some aspects, the target region corresponds to nucleotides 1357 - 1373 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1357; SEQ ID NO: 135) In some aspects, the target region corresponds to nucleotides 1359 - 1375 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1359; SEQ ID NO: 136) In some aspects, the target region corresponds to nucleotides 1360 - 1376 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1360; SEQ ID NO: 137) In some aspects, the target region corresponds to nucleotides 1839 - 1855 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1839; SEQ ID NO: 138) In some aspects, the target region corresponds to nucleotides 1848 - 1864 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1848; SEQ ID NO: 139) In some aspects, the target region corresponds to nucleotides 1849 - 1865 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1849; SEQ ID NO: 140) In some aspects, the target region corresponds to nucleotides 1891 - 1907 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1891; SEQ ID NO: 141) In some aspects, the target region corresponds to nucleotides 1915 - 1931 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1915; SEQ ID NO: 142) In some aspects, the target region corresponds to nucleotides 1916 - 1932 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1916; SEQ ID NO: 143) In some aspects, the target region corresponds to nucleotides 1917 - 1933 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1917; SEQ ID NO: 144) In some aspects, the target region corresponds to nucleotides 1938 - 1954 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1938; SEQ ID NO: 145) In some aspects, the target region corresponds to nucleotides 1939 - 1955 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1939; SEQ ID NO: 146) In some aspects, the target region corresponds to nucleotides 2063 - 2079 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2063;(SEQ ID NO: 147) In some aspects, the target region corresponds to nucleotides 2064 - 2080 of SEQ ID NO: 3 (e.g., ASO-STAT6-2064; SEQ ID NO: 148) In some aspects, the target region corresponds to nucleotides 2065 - 2081 of SEQ ID NO: 3 (e.g., ASO-STAT6-2065; SEQ ID NO: 149) In some aspects, the target region corresponds to nucleotides 2066 - 2082 of SEQ ID NO: 3 (e.g., ASO-STAT6-2066; SEQ ID NO: 150) In some aspects, the target region corresponds to nucleotides 2068 - 2084 of SEQ ID NO: 3 (e.g., ASO-STAT6-2068; SEQ ID NO: 151) In some aspects, the target region corresponds to nucleotides 2187 - 2203 of SEQ ID NO: 3 (e.g., ASO-STAT6-2187; SEQ ID NO: 152) In some aspects, the target region corresponds to nucleotides 2350 - 2366 of SEQ ID NO: 3 (e.g., ASO-STAT6-2350; SEQ ID NO: 153) In some aspects, the target region corresponds to nucleotides 2351 - 2367 of SEQ ID NO: 3 (e.g., ASO-STAT6-2351; SEQ ID NO: 154) In some aspects, the target region corresponds to nucleotides 2352 - 2368 of SEQ ID NO: 3 (e.g., ASO-STAT6-2352; SEQ ID NO: 155) In some aspects, the target region corresponds to nucleotides 2357 - 2373 of SEQ ID NO: 3 (e.g., ASO-STAT6-2357; SEQ ID NO: 156) In some aspects, the target region corresponds to nucleotides 513 - 532 of SEQ ID NO: 3 (e.g., ASO-STAT6-513; SEQ ID NO: 157) In some aspects, the target region corresponds to nucleotides 671 - 690 of SEQ ID NO: 3 (e.g., ASO-STAT6-671; SEQ ID NO: 158) In some aspects, the target region corresponds to nucleotides 1131 - 1150 of SEQ ID NO: 3 (e.g., ASO-STAT6-1131; SEQ ID NO: 159) In some aspects, the target region corresponds to nucleotides 1354 - 1373 of SEQ ID NO: 3 (e.g., ASO-STAT-6-1354; SEQ ID NO: 160) In some aspects, the target region corresponds to nucleotides 1355 - 1374 of SEQ ID NO: 3 (e.g., ASO-STAT6-1355;SEQ ID NO: 161) In some aspects, the target region corresponds to nucleotides 1356 - 1375 of SEQ ID NO: 3 (e.g., ASO-STAT6-1356; SEQ ID NO: 162) In some aspects, the target region corresponds to nucleotides 1432 - 1451 of SEQ ID NO: 3 (e.g., ASO-STAT6-1432; SEQ ID NO: 163) In some aspects, the target region corresponds to nucleotides 1555 - 1574 of SEQ ID NO: 3 (e.g., ASO-STAT6-1555; SEQ ID NO: 164) In some aspects, the target region corresponds to nucleotides 1556 - 1575 of SEQ ID NO: 3 (e.g., ASO-STAT6-1556; SEQ ID NO: 165) In some aspects, the target region corresponds to nucleotides 1557 - 1576 of SEQ ID NO: 3 (e.g., ASO-STAT6-1557; SEQ ID NO: 166) In some aspects, the target region corresponds to nucleotides 1558 - 1577 of SEQ ID NO: 3 (e.g., ASO-STAT6-1558; SEQ ID NO: 167) In some aspects, the target region corresponds to nucleotides 1826 - 1845 of SEQ ID NO: 3 (e.g., ASO-STAT6-1826; SEQ ID NO: 168) In some aspects, the target region corresponds to nucleotides 1827 - 1846 of SEQ ID NO: 3 (e.g., ASO-STAT6-1827; SEQ ID NO: 169) In some aspects, the target region corresponds to nucleotides 1833 - 1852 of SEQ ID NO: 3 (e.g., ASO-STAT6-1833; SEQ ID NO: 170) In some aspects, the target region corresponds to nucleotides 1843 - 1862 of SEQ ID NO: 3 (e.g., ASO-STAT6-1843; SEQ ID NO: 171) In some aspects, the target region corresponds to nucleotides 1846 - 1865 of SEQ ID NO: 3 (e.g., ASO-STAT6-1846; SEQ ID NO: 172) In some aspects, the target region corresponds to nucleotides 1847 - 1866 of SEQ ID NO: 3 (e.g., ASO-STAT6-1847; SEQ ID NO: 173) In some aspects, the target region corresponds to nucleotides 1883 - 1902 of SEQ ID NO: 3 (e.g., ASO-STAT6-1883; SEQ ID NO: 174) In some aspects, the target region corresponds to nucleotides 1889 - 1908 of SEQ ID NO: 3 (e.g., ASO-STAT6-1889;SEQ ID NO: 175) In some aspects, the target region corresponds to nucleotides 1890 - 1909 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1890; SEQ ID NO: 176) In some aspects, the target region corresponds to nucleotides 1891 - 1910 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1891; SEQ ID NO: 177) In some aspects, the target region corresponds to nucleotides 1916 - 1935 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1916; SEQ ID NO: 178) In some aspects, the target region corresponds to nucleotides 1917 - 1936 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 1917; SEQ ID NO: 179) In some aspects, the target region corresponds to nucleotides 2056 - 2075 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2056; SEQ ID NO: 180) In some aspects, the target region corresponds to nucleotides 2057 - 2076 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2057; SEQ ID NO: 181) In some aspects, the target region corresponds to nucleotides 2060 - 2079 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2060; SEQ ID NO: 182) In some aspects, the target region corresponds to nucleotides 2062 - 2081 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2062; SEQ ID NO: 183) In some aspects, the target region corresponds to nucleotides 2063 - 2082 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2063; SEQ ID NO: 184) In some aspects, the target region corresponds to nucleotides 2065 - 2084 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2065; SEQ ID NO: 185) In some aspects, the target region corresponds to nucleotides 2068 - 2087 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2068; SEQ ID NO: 186) In some aspects, the target region corresponds to nucleotides 2347 - 2366 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2347; SEQ ID NO: 187) In some aspects, the target region corresponds to nucleotides 2348 - 2367 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2348; SEQ ID NO: 188) In some aspects, the target region corresponds to nucleotides 2358 - 2377 of SEQ ID NO: 3 (e.g., ASO - STAT6 - 2358;(SEQ ID NO:189) In some aspects, the target region corresponds to nucleotides 2782-2801 of SEQ ID NO:3 (e.g., ASO-STAT6-2782; SEQ ID NO:190) In some aspects, the target region corresponds to nucleotides 3070-3089 of SEQ ID NO:3 (e.g., ASO-STAT6-3070; SEQ ID NO:191) In some aspects, the target region corresponds to nucleotides 3071-3090 of SEQ ID NO:3 (e.g., ASO-STAT6-3071; SEQ ID NO:192) In some aspects, the target region corresponds to nucleotides 3431-3450 of SEQ ID NO:3 (e.g., ASO-STAT6-3431; SEQ ID NO:193).;

[0223] In some aspects, the target region corresponds to nucleotides 1053 - 1067 of SEQ ID NO:3 (e.g., ASO-STAT6-1053; EQ ID NO:91), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1359 - 1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1359; EQ ID NO:92), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1890 - 1904 of SEQ ID NO:3 (e.g., ASO-STAT6-1890; EQ ID NO:93), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1892 - 1906 of SEQ ID NO:3 (e.g., ASO-STAT6-1892; EQ ID NO:94), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1915 - 1929 of SEQ ID NO:3 (e.g., ASO-STAT6-1915; EQID NO:95), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1916 - 1930 of SEQ ID NO:3 (e.g., ASO-STAT6-1916; EQ ID NO:96), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1917 - 1931 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; EQ ID NO:97), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end.In some aspects, the target region corresponds to nucleotides 1918 - 1932 of SEQ ID NO:3 (e.g., ASO-STAT6-1918; EQ ID NO:98), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1919 - 1933 of SEQ ID NO:3 (e.g., ASO-STAT6-1919; EQ ID NO:99), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1920 - 1934 of SEQ ID NO:3 (e.g., ASO-STAT6-1920; EQ ID NO:100), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1937 - 1951 of SEQ ID NO:3 (e.g., ASO-STAT6-1937; EQ ID NO:101), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1938 - 1952 of SEQ ID NO:3 (e.g., ASO-STAT6-1938; EQ ID NO:102), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2061 - 2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2061; EQ ID NO:103), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2062 - 2076 of SEQ ID NO:3 (e.g., ASO-STAT6-2062; EQ ID NO:104), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 2063 - 2077 of SEQ ID NO:3 (e.g., ASO-STAT6-2063; EQ ID NO:105), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2064 - 2078 of SEQ ID NO:3 (e.g., ASO-STAT6-2064; EQ ID NO:106), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2066 - 2080 of SEQ ID NO:3 (e.g., ASO-STAT6-2066; EQ ID NO:107), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2067 - 2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2067; EQ ID NO:108), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2068 - 2082 of SEQ ID NO:3 (e.g., ASO-STAT6-2068; EQ ID NO:109), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2352 - 2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2352; EQ ID NO:110), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 3073 - 3087 of SEQ ID NO:3 (e.g., ASO-STAT6-3073; EQ ID NO:111), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end.In some aspects, the target region corresponds to nucleotides 1053 - 1068 of SEQ ID NO:3 (e.g., ASO-STAT6-1053; EQ ID NO:112), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1054 - 1069 of SEQ ID NO:3 (e.g., ASO-STAT6-1054; EQ ID NO:113), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1356 - 1371 of SEQ ID NO:3 (e.g., ASO-STAT6-1356; EQ ID NO:114), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1847 - 1862 of SEQ ID NO:3 (e.g., ASO-STAT6-1847; EQ ID NO:115), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1886 - 1901 of SEQ ID NO:3 (e.g., ASO-STAT6-1886; EQ ID NO:116), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1887 - 1902 of SEQ ID NO:3 (e.g., ASO-STAT6-1887; EQ ID NO:117), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1888 - 1903 of SEQ ID NO:3 (e.g., ASO-STAT6-1888; EQ ID NO:118), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end.In some aspects, the target region corresponds to nucleotides 1889-1904 of SEQ ID NO:3 (e.g., ASO-STAT6-1889; EQ ID NO:119), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1890-1905 of SEQ ID NO:3 (e.g., ASO-STAT6-1890; EQ ID NO:120), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1893-1908 of SEQ ID NO:3 (e.g., ASO-STAT6-1893; EQ ID NO:121), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1917-1932 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; EQ ID NO:122), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1919-1934 of SEQ ID NO:3 (e.g., ASO-STAT6-1919; EQ ID NO:123), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2056-2071 of SEQ ID NO:3 (e.g., ASO-STAT6-2056; EQ ID NO:124), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2060-2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2060; EQ ID NO:125), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 2066 - 2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2066; EQ ID NO:126), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2070 - 2085 of SEQ ID NO:3 (e.g., ASO-STAT6-2070; EQ ID NO:127), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2351 - 2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2351; EQ ID NO:128), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2352 - 2367 of SEQ ID NO:3 (e.g., ASO-STAT6-2352; EQ ID NO:129), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2359 - 2374 of SEQ ID NO:3 (e.g., ASO-STAT6-2359; EQ ID NO:130), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 3633 - 3648 of SEQ ID NO:3 (e.g., ASO-STAT6-3633; EQ ID NO:131), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 673 - 689 of SEQ ID NO:3 (e.g., ASO-STAT6-673; EQ ID NO:132), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 1052-1068 of SEQ ID NO:3 (e.g., ASO-STAT6-1052; EQ ID NO:133), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1356-1372 of SEQ ID NO:3 (e.g., ASO-STAT6-1356; EQ ID NO:134), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1357-1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1357; EQ ID NO:135), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1359-1375 of SEQ ID NO:3 (e.g., ASO-STAT6-1359; EQ ID NO:136), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1360-1376 of SEQ ID NO:3 (e.g., ASO-STAT6-1360; EQ ID NO:137), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1839-1855 of SEQ ID NO:3 (e.g., ASO-STAT6-1839; EQ ID NO:138), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1848-1864 of SEQ ID NO:3 (e.g., ASO-STAT6-1848; EQ ID NO:139), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 1849 - 1865 of SEQ ID NO:3 (e.g., ASO-STAT6-1849; EQ ID NO:140), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1891 - 1907 of SEQ ID NO:3 (e.g., ASO-STAT6-1891; EQ ID NO:141), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1915 - 1931 of SEQ ID NO:3 (e.g., ASO-STAT6-1915; EQ ID NO:142), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1916 - 1932 of SEQ ID NO:3 (e.g., ASO-STAT6-1916; EQ ID NO:143), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1917 - 1933 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; EQ ID NO:144), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1938 - 1954 of SEQ ID NO:3 (e.g., ASO-STAT6-1938; EQ ID NO:145), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1939 - 1955 of SEQ ID NO:3 (e.g., ASO-STAT6-1939; EQ ID NO:146), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 2063-2079 of SEQ ID NO:3 (e.g., ASO-STAT6-2063; EQ ID NO:147), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2064-2080 of SEQ ID NO:3 (e.g., ASO-STAT6-2064; EQ ID NO:148), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2065-2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2065; EQ ID NO:149), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2066-2082 of SEQ ID NO:3 (e.g., ASO-STAT6-2066; EQ ID NO:150), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2068-2084 of SEQ ID NO:3 (e.g., ASO-STAT6-2068; EQ ID NO:151), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2187-2203 of SEQ ID NO:3 (e.g., ASO-STAT6-2187; EQ ID NO:152), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2350-2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2350; EQ ID NO:153), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end.In some aspects, the target region corresponds to nucleotides 2351 - 2367 of SEQ ID NO:3 (e.g., ASO-STAT6-2351; EQ ID NO:154), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2352 - 2368 of SEQ ID NO:3 (e.g., ASO-STAT6-2352; EQ ID NO:155), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 2357 - 2373 of SEQ ID NO:3 (e.g., ASO-STAT6-2357; EQ ID NO:156), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 513 - 532 of SEQ ID NO:3 (e.g., ASO-STAT6-513; EQ ID NO:157), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 671 - 690 of SEQ ID NO:3 (e.g., ASO-STAT6-671; EQ ID NO:158), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1131 - 1150 of SEQ ID NO:3 (e.g., ASO-STAT6-1131; EQ ID NO:159), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end. In some aspects, the target region corresponds to nucleotides 1354 - 1373 of SEQ ID NO:3 (e.g., ASO-STAT6-1354; EQ ID NO:160), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3'-end and / or 5'-end.In some aspects, the target region corresponds to nucleotides 1355 - 1374 of SEQ ID NO:3 (e.g., ASO - STAT6 - 1355; EQ ID NO:161), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1356 - 1375 of SEQ ID NO:3 (e.g., ASO - STAT6 - 1356; EQ ID NO:162), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1432 - 1451 of SEQ ID NO:3 (e.g., ASO - STAT6 - 1432; EQ ID NO:163), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1555 - 1574 of SEQ ID NO:3 (e.g., ASO - STAT6 - 1555; EQID NO:164), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1556 - 1575 of SEQ ID NO:3 (e.g., ASO - STAT6 - 1556; EQ ID NO:165), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1557 - 1576 of SEQ ID NO:3 (e.g., ASO - STAT6 - 1557; EQ ID NO:166), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1558 - 1577 of SEQ ID NO:3 (e.g., ASO - STAT6 - 1558; EQ ID NO:167), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 1826 - 1845 of SEQ ID NO:3 (e.g., ASO-STAT6-1826; EQID NO:168), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1827 - 1846 of SEQ ID NO:3 (e.g., ASO-STAT6-1827; EQ ID NO:169), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1833 - 1852 of SEQ ID NO:3 (e.g., ASO-STAT6-1833; EQ ID NO:170), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1843 - 1862 of SEQ ID NO:3 (e.g., ASO-STAT6-1843; EQ ID NO:171), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1846 - 1865 of SEQ ID NO:3 (e.g., ASO-STAT6-1846; EQID NO:172), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1847 - 1866 of SEQ ID NO:3 (e.g., ASO-STAT6-1847; EQ ID NO:173), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1883 - 1902 of SEQ ID NO:3 (e.g., ASO-STAT6-1883; EQ ID NO:174), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 1889-1908 of SEQ ID NO:3 (e.g., ASO-STAT6-1889; EQ ID NO:175), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1890-1909 of SEQ ID NO:3 (e.g., ASO-STAT6-1890; EQID NO:176), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1891-1910 of SEQ ID NO:3 (e.g., ASO-STAT6-1891; EQ ID NO:177), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1916-1935 of SEQ ID NO:3 (e.g., ASO-STAT6-1916; EQ ID NO:178), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 1917-1936 of SEQ ID NO:3 (e.g., ASO-STAT6-1917; EQ ID NO:179), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2056-2075 of SEQ ID NO:3 (e.g., ASO-STAT6-2056; EQID NO:180), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the �' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2057-2076 of SEQ ID NO:3 (e.g., ASO-STAT6-2057; EQ ID NO:181), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 2060 - 2079 of SEQ ID NO:3 (e.g., ASO-STAT6-2060; EQ ID NO:182), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2062 - 2081 of SEQ ID NO:3 (e.g., ASO-STAT6-2062; EQ ID NO:183), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2063 - 2082 of SEQ ID NO:3 (e.g., ASO-STAT6-2063; EQID NO:184), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2065 - 2084 of SEQ ID NO:3 (e.g., ASO-STAT6-2065; EQ ID NO:185), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2068 - 2087 of SEQ ID NO:3 (e.g., ASO-STAT6-2068; EQ ID NO:186), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2347 - 2366 of SEQ ID NO:3 (e.g., ASO-STAT6-2347; EQ ID NO:187), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2348 - 2367 of SEQ ID NO:3 (e.g., ASO-STAT6-2348; EQID NO:188), ±10, ±20, ±30, ±40, ±50, ±60, ±70, ±80, or ±90 nucleotides at the 3' end and / or 5' end.In some aspects, the target region corresponds to nucleotides 2358 - 2377 of SEQ ID NO:3 (e.g., ASO-STAT6-2358; EQ ID NO:189), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 2782 - 2801 of SEQ ID NO:3 (e.g., ASO-STAT6-2782; EQ ID NO:190), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 3070 - 3089 of SEQ ID NO:3 (e.g., ASO-STAT6-3070; EQ ID NO:191), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 3071 - 3090 of SEQ ID NO:3 (e.g., ASO-STAT6-3071; EQID NO:192), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end. In some aspects, the target region corresponds to nucleotides 3431 - 3450 of SEQ ID NO:3 (e.g., ASO-STAT6-3431; SEQ ID NO:193), plus or minus 10, plus or minus 20, plus or minus 30, plus or minus 40, plus or minus 50, plus or minus 60, plus or minus 70, plus or minus 80, or plus or minus 90 nucleotides at the 3' end and / or 5' end).

[0224] In some aspects, the ASO is not TGAGCGAATGGACAGGTCTT (SEQ ID NO:89). In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2056 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2055 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2054 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2053 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2052 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2051 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2050 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2049 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2048 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2047 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2046 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2045 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1 - 2044 of SEQ ID NO:3.In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1-2043 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1-2042 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1-2041 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1-2040 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1-2039 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 1-2038 of SEQ ID NO:3.

[0225] In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2041 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2042 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2043 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2044 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2045 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2046 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2047 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2048 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2049 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2050 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2051 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2052 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to the nucleic acid sequence within nucleotides 2053 - 3963 of SEQ ID NO:3.In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 2054 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 2055 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 2056 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 2057 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 2058 - 3963 of SEQ ID NO:3. In some aspects, the target region corresponds to a contiguous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within nucleotides 2059 - 3963 of SEQ ID NO:3.

[0226] In some aspects, the ASOs of the present disclosure hybridize to multiple target regions (e.g., genomic sequence, SEQ ID NO:1) within the STAT6 transcript. In some aspects, the ASO hybridizes to two different target regions within the STAT6 transcript. In some aspects, the ASO hybridizes to three different target regions within the STAT6 transcript. Figure 1 Sequences of exemplary ASOs that hybridize to multiple target regions and start / stop sites of different target regions are provided in A. In some aspects, compared to an ASO that hybridizes to a single region within the STAT6 transcript (e.g., genomic sequence, SEQ ID NO:1), an ASO that hybridizes to multiple regions within the STAT6 transcript (e.g., genomic sequence, SEQ ID NO:1) is more effective (e.g., has a lower EC50) in reducing STAT6 expression.

[0227] III.B. ASO STAT6 Sequences

[0228] In some aspects, the ASOs of the present disclosure comprise a contiguous nucleotide sequence corresponding to the complement of a region of the STAT6 transcript, e.g., a nucleotide sequence corresponding to SEQ ID NO:1 or SEQ ID NO:3.

[0229] In some aspects, the present disclosure provides ASOs that are 10-30 nucleotides in length, such as 10-15 nucleotides, 10-20 nucleotides, 10-25 nucleotides, or about 20 nucleotides, wherein the contiguous nucleotide sequence has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to a region within the complement of: a STAT6 transcript, such as SEQ ID NO:1 or SEQ ID NO:3 or a naturally occurring variant thereof. Thus, for example, the ASO hybridizes to a single-stranded nucleic acid molecule having a sequence of SEQ ID NO:1 or SEQ ID NO:3 or a portion thereof.

[0230] The ASO can comprise a contiguous nucleotide sequence that is fully complementary (perfectly complementary) to an equivalent region of a nucleic acid encoding a mammalian STAT6 protein (e.g., SEQ ID NO:1 or SEQ ID NO:3). The ASO can comprise a contiguous nucleotide sequence that is fully complementary to a nucleic acid sequence or a region within the sequence, corresponding to nucleotides X-Y of SEQ ID NO:1 or SEQ ID NO:3, wherein X and Y are the starting and ending positions, respectively, as Figure 1 shown in A.

[0231] The ASO can comprise a contiguous nucleotide sequence that is fully complementary to an equivalent region of an mRNA encoding a mammalian STAT6 protein (e.g., SEQ ID NO:3). The ASO can comprise a contiguous nucleotide sequence that is fully complementary to an mRNA sequence or a region within the sequence, corresponding to nucleotides X-Y of SEQ ID NO:3, wherein X and Y are the starting and ending positions, respectively.

[0232] In some aspects, the nucleotide sequence or contiguous nucleotide sequence of the ASOs of the present disclosure has at least about 80% sequence identity to a sequence selected from the sequences of SEQ ID NOs: 91 to 193 (i.e., Figure 1 the sequences in A), such as at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or about 100% sequence identity (homologous). In some aspects, the ASO has a design described elsewhere herein or a chemical structure shown elsewhere herein (e.g., Figure 1 A).

[0233] In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences consisting of SEQ ID NOs: 91-193 or a region of at least 10 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise one, two, three, or four mismatches when compared to the corresponding STAT6 transcript.

[0234] In some aspects, the ASO comprises a sequence selected from the group consisting of: 91 (e.g., ASO-STAT6-1053), 92 (e.g., ASO-STAT6-1359), 93 (e.g., ASO-STAT6-1890), 94 (e.g., ASO-STAT6-1892), 95 (e.g., ASO-STAT6-1915), 96 (e.g., ASO-STAT6-1916), 97 (e.g., ASO-STAT6-1917), 98 (e.g., ASO-STAT6-1918), 99 (e.g., ASO-STAT6-1919), 100 (e.g., ASO-STAT6-1920), 101 (e.g., ASO-STAT6-1937), 102 (e.g., ASO-STAT6-1938), 103 (e.g., ASO-STAT6-2061), 104 (e.g., ASO-STAT6-2062), 105 (e.g., ASO-STAT6-2063), 106 (e.g., ASO-STAT6-2064), 107 (e.g., ASO-STAT6-2066), 108 (e.g., ASO-STAT6-2067), 109 (e.g., ASO-STAT6-2068), 110 (e.g., ASO-STAT6-2352), 111 (e.g., ASO-STAT6-3073), 112 (e.g., ASO-STAT6-1053), 113 (e.g., ASO-STAT6-1054), 114 (e.g., ASO-STAT6-1356), 115 (e.g., ASO-STAT6-1847), 116 (e.g., ASO-STAT6-1886), 117 (e.g., ASO-STAT6-1887), 118 (e.g., ASO-STAT6-1888), 119 (e.g., ASO-STAT6-1889), 120 (e.g., ASO-STAT6-1890), 121 (e.g., ASO-STAT6-1893), 122 (e.g., ASO-STAT6-1917), 123 (e.g., ASO-STAT6-1919), 124 (e.g., ASO-STAT6-2056), 125 (e.g., ASO-STAT6-2060), 126 (e.g., ASO-STAT6-2066), 127 (e.g., ASO-STAT6-2070), 128 (e.g., ASO-STAT6-2351), 129 (e.g., ASO-STAT6-2352), 130 (e.g., ASO-STAT6-2359), 131 (e.g., ASO-STAT6-3633), 132 (e.g., ASO-STAT6-673), 133 (e.g.,ASO - STAT6 - 1052), 134 (e.g., ASO - STAT6 - 1356), 135 (e.g., ASO - STAT6 - 1357), 136 (e.g., ASO - STAT6 - 1359), 137 (e.g., ASO - STAT6 - 1360), 138 (e.g., ASO - STAT6 - 1839), 139 (e.g., ASO - STAT6 - 1848), 140 (e.g., ASO - STAT6 - 1849), 141 (e.g., ASO - STAT6 - 1891), 142 (e.g., ASO - STAT6 - 1915), 143 (e.g., ASO - STAT6 - 1916), 144 (e.g., ASO - STAT6 - 1917), 145 (e.g., ASO - STAT6 - 1938), 146 (e.g., ASO - STAT6 - 1939), 147 (e.g., ASO - STAT6 - 2063), 148 (e.g., ASO - STAT6 - 2064), 149 (e.g., ASO - STAT6 - 2065), 150 (e.g., ASO - STAT6 - 2066), 151 (e.g., ASO - STAT6 - 2068), 152 (e.g., ASO - STAT6 - 2187), 153 (e.g., ASO - STAT6 - 2350), 154 (e.g., ASO - STAT6 - 2351), 155 (e.g., ASO - STAT6 - 2352), 156 (e.g., ASO - STAT6 - 2357), 157 (e.g., ASO - STAT6 - 513), 158 (e.g., ASO - STAT6 - 671), 159 (e.g., ASO - STAT6 - 1131), 160 (e.g., ASO - STAT6 - 1354), 161 (e.g., ASO - STAT6 - 1355), 162 (e.g., ASO - STAT6 - 1356), 163 (e.g., ASO - STAT6 - 1432), 164 (e.g., ASO - STAT6 - 1555), 165 (e.g., ASO - STAT6 - 1556), 166 (e.g., ASO - STAT6 - 1557), 167 (e.g., ASO - STAT6 - 1558), 168 (e.g., ASO - STAT6 - 1826), 169 (e.g., ASO - STAT6 - 1827), 170 (e.g., ASO - STAT6 - 1833), 171 (e.g., ASO - STAT6 - 1843), 172 (e.g., ASO - STAT6 - 1846), 173 (e.g., ASO - STAT6 - 1847), 174 (e.g., ASO - STAT6 - 1883), 175 (e.g., ASO - STAT6 - 1889), 176 (e.g.,ASO-STAT6-1890), 177 (e.g., ASO-STAT6-1891), 178 (e.g., ASO-STAT6-1916), 179 (e.g., ASO-STAT6-1917), 180 (e.g., ASO-STAT6-2056), 181 (e.g., ASO-STAT6-2057), 182 (e.g., ASO-STAT6-2060), 183 (e.g., ASO-STAT6-2062), 184 (e.g., ASO-STAT6-2063), 185 (e.g., ASO-STAT6-2065), 186 (e.g., ASO-STAT6-2068), 187 (e.g., ASO-STAT6-2347), 188 (e.g., ASO-STAT6-2348), 189 (e.g., ASO-STAT6-2358), 190 (e.g., ASO-STAT6-2782), 191 (e.g., ASO-STAT6-3070), 192 (e.g., ASO-STAT6-3071) and 193 (e.g., ASO-STAT6-3431).

[0235] In some aspects, the ASO comprises the sequence shown in SEQ ID NO:91 (e.g., ASO-STAT6-1053). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:92 (e.g., ASO-STAT6-1359). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:93 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:94 (e.g., ASO-STAT6-1892). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:95 (e.g., ASO-STAT6-1915). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:96 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:97 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:98 (e.g., ASO-STAT6-1918). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:99 (e.g., ASO-STAT6-1919). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:100 (e.g., ASO-STAT6-1920). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:101 (e.g., ASO-STAT6-1937). In some aspects, the ASO comprises the sequence shown in SEQID NO:102 (e.g., ASO-STAT6-1938). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:103 (e.g., ASO-STAT6-2061). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:104 (e.g., ASO-STAT6-2062). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:105 (e.g., ASO-STAT6-2063). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:106 (e.g., ASO-STAT6-2064). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:107 (e.g., ASO-STAT6-2066). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:108 (e.g., ASO-STAT6-2067). In some aspects, the ASO comprises the sequence shown in SEQ ID NO:109 (e.g., ASO-STAT6-2068).In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 110 (e.g., ASO-STAT6-2352). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 111 (e.g., ASO-STAT6-3073). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 112 (e.g., ASO-STAT6-1053). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 113 (e.g., ASO-STAT6-1054). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 114 (e.g., ASO-STAT6-1356). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 115 (e.g., ASO-STAT6-1847). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 116 (e.g., ASO-STAT6-1886). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 117 (e.g., ASO-STAT6-1887). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 118 (e.g., ASO-STAT6-1888). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 119 (e.g., ASO-STAT6-1889). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 120 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 121 (e.g., ASO-STAT6-1893). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 122 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 123 (e.g., ASO-STAT6-1919). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 124 (e.g., ASO-STAT6-2056). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 125 (e.g., ASO-STAT6-2060). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 126 (e.g., ASO-STAT6-2066). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 127 (e.g., ASO-STAT6-2070). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 128 (e.g., ASO-STAT6-2351).In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 129 (e.g., ASO-STAT6-2352). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 130 (e.g., ASO-STAT6-2359). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 131 (e.g., ASO-STAT6-3633). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 132 (e.g., ASO-STAT6-673). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 133 (e.g., ASO-STAT6-1052). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 134 (e.g., ASO-STAT6-1356). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 135 (e.g., ASO-STAT6-1357). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 136 (e.g., ASO-STAT6-1359). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 137 (e.g., ASO-STAT6-1360). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 138 (e.g., ASO-STAT6-1839). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 139 (e.g., ASO-STAT6-1848). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 140 (e.g., ASO-STAT6-1849). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 141 (e.g., ASO-STAT6-1891). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 142 (e.g., ASO-STAT6-1915). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 143 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 144 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 145 (e.g., ASO-STAT6-1938). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 146 (e.g., ASO-STAT6-1939). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 147 (e.g., ASO-STAT6-2063).In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 148 (e.g., ASO-STAT6-2064). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 149 (e.g., ASO-STAT6-2065). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 150 (e.g., ASO-STAT6-2066). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 151 (e.g., ASO-STAT6-2068). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 152 (e.g., ASO-STAT6-2187). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 153 (e.g., ASO-STAT6-2350). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 154 (e.g., ASO-STAT6-2351). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 155 (e.g., ASO-STAT6-2352). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 156 (e.g., ASO-STAT6-2357). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 157 (e.g., ASO-STAT6-513). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 158 (e.g., ASO-STAT6-671). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 159 (e.g., ASO-STAT6-1131). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 160 (e.g., ASO-STAT6-1354). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 161 (e.g., ASO-STAT6-1355). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 162 (e.g., ASO-STAT6-1356). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 163 (e.g., ASO-STAT6-1432). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 164 (e.g., ASO-STAT6-1555). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 165 (e.g., ASO-STAT6-1556). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 166 (e.g., ASO-STAT6-1557).In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 167 (e.g., ASO-STAT6-1558). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 168 (e.g., ASO-STAT6-1826). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 169 (e.g., ASO-STAT6-1827). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 170 (e.g., ASO-STAT6-1833). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 171 (e.g., ASO-STAT6-1843). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 172 (e.g., ASO-STAT6-1846). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 173 (e.g., ASO-STAT6-1847). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 174 (e.g., ASO-STAT6-1883). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 175 (e.g., ASO-STAT6-1889). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 176 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 177 (e.g., ASO-STAT6-1891). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 178 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 179 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 180 (e.g., ASO-STAT6-2056). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 181 (e.g., ASO-STAT6-2057). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 182 (e.g., ASO-STAT6-2060). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 183 (e.g., ASO-STAT6-2062). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 184 (e.g., ASO-STAT6-2063). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 185 (e.g., ASO-STAT6-2065).In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 186 (e.g., ASO-STAT6-2068). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 187 (e.g., ASO-STAT6-2347). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 188 (e.g., ASO-STAT6-2348). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 189 (e.g., ASO-STAT6-2358). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 190 (e.g., ASO-STAT6-2782). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 191 (e.g., ASO-STAT6-3070). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 192 (e.g., ASO-STAT6-3071). In some aspects, the ASO comprises the sequence shown in SEQ ID NO: 193 (e.g., ASO-STAT6-3431).

[0236] In some aspects, the ASO of the present disclosure binds to a target nucleic acid sequence (e.g., the STAT6 transcript) and is capable of inhibiting or reducing the expression of the STAT6 transcript by at least 10% or 20% compared to the normal (i.e., control) expression level in a cell, e.g., at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% compared to the normal expression level (e.g., the expression level in cells not exposed to the ASO).

[0237] In some aspects, compared to cells not in contact with the ASO (e.g., in contact with saline), when cells are in contact with the ASO, the ASO of the present disclosure is capable of reducing the in vitro expression of STAT6 mRNA in the target cells by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100%.

[0238] Some aspects of the present disclosure relate to an antisense oligonucleotide (ASO) that comprises the nucleotide sequence shown in SEQ ID NO: 185, wherein the ASO has a sequence comprising LLLD 14Design of LLL, where L is LNA and D is DNA. In some aspects, each internucleoside bond in the ASO is a phosphorothioate bond. In some aspects, each RNA cytosine is 5'-methyl-cytosine. In some aspects, each DNA cytosine is 5'-methyl-cytosine. In some aspects, each RNA uracil is 5'-methyl uracil. In some aspects, each uracil is 5'-methyl uracil.

[0239] In some aspects, the ASO has a design comprising:

[0240] 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3'

[0241] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; and where "(s)" represents a phosphorothioate bond.

[0242] In some aspects, the ASO has a design comprising:

[0243] 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-lnT-(s)-ln5MeC 3'

[0244] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; and where "(s)" represents a phosphorothioate bond.

[0245] In some aspects, the ASO has a design comprising:

[0246] 5' GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3';

[0247] Where "lnN" represents LNA of the specific nucleoside "N"; where "dN" represents DNA of the specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

[0248] In some aspects, the ASO has a design including the following:

[0249] 5′ GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-lnT-(s)-ln5MeC 3′;

[0250] Where "lnN" represents LNA of the specific nucleoside "N"; where "dN" represents DNA of the specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

[0251] In some aspects, the ASO has a design including the following:

[0252]

[0253] III.C. ASO Length

[0254] An ASO can comprise a contiguous nucleotide sequence that is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in total length. It should be understood that when a range of lengths of an ASO or a contiguous nucleotide sequence is given, the range includes the lower and higher lengths provided in the range, e.g., from (or between) 10 to 30, including both 10 and 30.

[0255] In some aspects, the ASO comprises a contiguous nucleotide sequence that is about 14 - 20, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides in total length. In certain aspects, the ASO comprises a contiguous nucleotide sequence that is about 20 contiguous nucleotides in total length. In certain aspects, the ASO of the present disclosure is 14 nucleotides in length. In certain aspects, the ASO of the present disclosure is 15 nucleotides in length. In certain aspects, the ASO of the present disclosure is 16 nucleotides in length. In certain aspects, the ASO of the present disclosure is 17 nucleotides in length. In certain aspects, the ASO of the present disclosure is 18 nucleotides in length. In certain aspects, the ASO of the present disclosure is 19 nucleotides in length. III.D. Nucleosides and nucleoside analogs

[0256] In one aspect of the present disclosure, the ASO comprises one or more non-naturally occurring nucleoside analogs. As used herein, a "nucleoside analog" is a variant of a natural nucleoside, such as a DNA or RNA nucleoside, modified by the sugar and / or base moiety. In the context of an oligonucleotide, an analog can in principle be merely "silent" or "equivalent" to a natural nucleoside, i.e., have no functional effect on the way the oligonucleotide inhibits target gene expression. However, if such an "equivalent" analog is easier or cheaper to prepare, or more stable under storage or manufacturing conditions, or represents a label or tag, then the equivalent analog may be useful. However, in some aspects, the analog will have a functional effect on the way the ASO inhibits expression; for example, by producing increased binding affinity for the target and / or increased resistance to intracellular nucleases and / or increased ease of transport into cells. Specific examples of nucleotide analogs are described, for example, in Freier and Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Scheme 1. The ASO of the present disclosure can contain more than one, more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 18, more than 19, or more than 20 nucleoside analogs. In some aspects, the nucleoside analogs in the ASO are the same. In other aspects, the nucleoside analogs in the ASO are different. The nucleotide analogs in the ASO can be any one or a combination of the following nucleoside analogs.

[0257] In some aspects, the nucleoside analog comprises 2'-O-alkyl-RNA; 2'-O-methyl RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluoro-RNA; 2'-fluoro-DNA; arabinonucleic acid (ANA); 2'-fluoro-ANA; bicyclic nucleoside analogs; or any combination thereof. In some aspects, the nucleoside analog comprises a sugar-modified nucleoside. In some aspects, the nucleoside analog comprises a nucleoside including a bicyclic sugar. In some aspects, the nucleoside analog comprises LNA.

[0258] In some aspects, the nucleoside analogs are selected from the group consisting of: constrained ethyl nucleoside (cEt), 2',4'-constrained 2'-O-methoxyethyl (cMOE), α-L-LNA, β-D-LNA, 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amino-LNA, oxy-LNA, thio-LNA, and any combination thereof. In some aspects, the ASO comprises one or more 5'-methyl-cytosine nucleobases. In some aspects, each RNA cytosine is 5'-methyl-cytosine. In some aspects, each DNA cytosine is 5'-methyl-cytosine. In some aspects, each cytosine is 5'-methyl-cytosine. In some aspects, each RNA uracil is 5'-methyl-uracil. In some aspects, each uracil is 5'-methyl-uracil. As used herein, 5'-methyl-uracil is used interchangeably with thymine. For example, the term "ln5MeU" is used interchangeably with "lnT".

[0259] III.D.1 Nucleobases

[0260] The term nucleobase includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present disclosure, the term nucleobase also encompasses modified nucleobases that are different from the naturally occurring nucleobases but are functional during nucleic acid hybridization. In some aspects, the nucleobase moiety is modified by modifying or substituting the nucleobase. In this context, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, by Hirao et al., (2012) Accounts of Chemical Research, Vol. 45, p. 2055, and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1.

[0261] In some aspects, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or a substituted pyrimidine, such as a nucleobase selected from: isocytosine, pseudoisocytosine, 5-methyl-cytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thiouracil, 2'-thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0262] The nucleobase moiety can be indicated by the letter code of each corresponding nucleobase, e.g., A, T, G, C, or U, where each letter can optionally include a modified nucleobase with equivalent functionality. For example, in an exemplary oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methyl-cytosine. Optionally, for LNA gapmers, 5-methyl-cytosine LNA nucleosides can be used. In some aspects, each RNA cytosine is 5'-methyl-cytosine. In some aspects, each DNA cytosine is 5'-methyl-cytosine. In some aspects, each RNA uracil is 5'-methyl-uracil. In some aspects, each uracil is 5'-methyl-uracil. In some aspects, each cytosine in the ASO is 5'-methyl-cytosine.

[0263] III.D.2. Sugar modifications

[0264] The ASOs of the present disclosure can include one or more nucleosides having a modified sugar moiety, i.e., a modification to the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA. Many modified nucleosides having a ribose moiety have been prepared, mainly for the purpose of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0265] Such modifications include modifications that modify the ribose ring structure, e.g., by substituting a hexose ring (HNA), or a bicyclic (LNA) that typically has a biradical bridge between the C2' and C4' carbons on the ribose ring, or an unlinked ribose ring that typically lacks a bond between the C2' and C3' carbons (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acid (WO2011 / 017521) or tricyclic nucleic acid (WO2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, e.g., in the case of peptide nucleic acid (PNA) or morpholino nucleic acid.

[0266] Sugar modifications also include modifications via changing a substituent group on the ribose ring to a group other than hydrogen or the 2'-OH group that is naturally present in RNA nucleosides. The substituent can be introduced, for example, at the 2', 3', 4', or 5' position. Nucleosides having a modified sugar moiety also include 2'-modified nucleosides, such as 2'-substituted nucleosides. In fact, much effort has been spent developing 2'-substituted nucleosides, and many 2'-substituted nucleosides have been found to have beneficial properties, such as enhanced nucleoside resistance and enhanced affinity, when incorporated into oligonucleotides.

[0267] III.D.2.a 2'-modified nucleosides

[0268] 2'-sugar-modified nucleosides are nucleosides having a substituent other than H or –OH at the 2'-position (2'-substituted nucleosides) or containing a 2'-linked bivalent group, and include 2'-substituted nucleosides and LNA (2'- to 4'-bivalent bridged) nucleosides. For example, 2'-modified sugars can provide enhanced binding affinity to oligonucleotides (e.g., 2'-sugar-modified nucleosides with enhanced affinity) and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-RNA, arabinonucleic acid (ANA), and 2'-fluoro-ANA nucleosides. For more examples, see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443; Uhlmann, Curr. Opinion in Drug Development, 2000, 3(2), 293-213; and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Shown below are diagrams of some 2'-substituted modified nucleosides.

[0269]

[0270] III.D.2.b Locked nucleic acid nucleosides (LNA).

[0271] LNA nucleosides are modified nucleosides that contain a linker group (referred to as a bivalent or bridge) between C2' and C4' of the ribose ring of the nucleoside (i.e., a 2'- to 4'-bridge), which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNA is incorporated into an oligonucleotide of a complementary RNA or DNA molecule, the locking of the ribose conformation is associated with enhanced hybridization affinity (duplex stability). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex.

[0272] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73 - 76; Seth et al., J. Org. Chem. 2010, Vol. 75(5) pp. 1569 - 81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225 - 1238.

[0273] In some aspects, the modified nucleosides or LNA nucleosides of the ASOs of the present disclosure have the general structure of Formula I or II:

[0274] Wherein

[0275] W is selected from -O-, -S-, -N(R a )-, -C(R a R b )-, especially –O-;

[0276] B is a nucleobase or a modified nucleobase moiety;

[0277] Z is a internucleoside bond to an adjacent nucleoside or a 5'-terminal group;

[0278] Z* is a internucleoside bond to an adjacent nucleoside or a 3'-terminal group;

[0279] R 1 、R 2 、R 3 、R 5 and R 5* are each independently selected from hydrogen, halogen, alkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, alkenoxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, azide, heterocycle, and aryl; and

[0280] X, Y, R a and R b are as defined herein.

[0281] In some aspects, -X-Y-, R ais hydrogen or an alkyl group, specifically hydrogen or methyl. In some aspects of -X-Y-, R b is hydrogen or an alkyl group, specifically hydrogen or methyl. In other aspects of –X-Y-, R a and R b one or both of which are hydrogen. In a further aspect of –X-Y-, R a and R b only one of which is hydrogen. In some aspects of -X-Y-, R a and R b one of which is methyl and the other is hydrogen. In certain aspects of –X-Y-, R a and R b are both methyl at the same time.

[0282] In some aspects, -X-, R a is hydrogen or an alkyl group, specifically hydrogen or methyl. In some aspects of -X-, R b is hydrogen or an alkyl group, specifically hydrogen or methyl. In other aspects of –X-, R a and R b one or both of which are hydrogen. In certain aspects of –X-, R a and R b only one of which is hydrogen. In certain aspects of -X-, R a and R b one of which is methyl and the other is hydrogen. In other aspects of –X-, R a and R b are both methyl at the same time.

[0283] In some aspects, -Y-, R a is hydrogen or an alkyl group, specifically hydrogen or methyl. In certain aspects of -Y-, R b is hydrogen or an alkyl group, specifically hydrogen or methyl. In other aspects of –Y-, R a and R b one or both of which are hydrogen. In certain aspects of –Y-, R a and R b only one of which is hydrogen. In other aspects of -Y-, R a and R b one of which is methyl and the other is hydrogen. In certain aspects of –Y-, R a and R b are both methyl at the same time.

[0284] In certain aspects, R 1 、R 2 、R 3 、R 5 and R 5* are independently selected from hydrogen and alkyl groups, especially hydrogen and methyl. It should be noted that there is an incorrect character "、" in the original text at line 70 which is retained as it is in the translation for the sake of maintaining the original content. You may want to check and correct it in the original source if necessary.

[0285] In certain aspects, R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen simultaneously.

[0286] In certain aspects, R 1 、R 2 、R 3 are hydrogen simultaneously, one of R 5 and R 5* is hydrogen and the other is as defined above, in particular an alkyl group, more particularly a methyl group.

[0287] In certain aspects, R 1 、R 2 、R 3 are hydrogen simultaneously, one of R 5 and R 5* is hydrogen and the other is an azide.

[0288] In certain aspects, -X-Y- is -O-CH2-, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen simultaneously. Such LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352 and WO 2004 / 046160, all of which are hereby incorporated by reference and include LNA nucleosides commonly known in the art such as β-D-oxy-LNA and α-L-oxy-LNA nucleosides.

[0289] In certain aspects, -X-Y- is -S-CH2-, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen simultaneously. Such thio-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference.

[0290] In certain aspects, -X-Y- is -NH-CH2-, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen simultaneously. Such amino-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference.

[0291] In some aspects, -X-Y- is -O-CH2CH2- or -OCH2CH2CH2-, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such LNA nucleosides are disclosed in WO 00 / 047599 and Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, which are hereby incorporated by reference herein, and include substances commonly referred to in the art as 2'-O-4'C-ethylene-bridged nucleic acids (ENA).

[0292] In some aspects, -X-Y- is -O-CH2-, W is oxygen, R 1 、R 2 、R 3 are hydrogen at the same time, one of R 5 and R 5* is hydrogen and the other is not hydrogen, such as an alkyl group, such as a methyl group. Such 5'-substituted LNA nucleosides are disclosed in WO 2007 / 134181, which is hereby incorporated by reference.

[0293] In some aspects, -X-Y- is -O-CR a R b -, where one or both of R a and R b are not hydrogen, especially an alkyl group such as a methyl group, W is oxygen, R 1 、R 2 、R 3 are hydrogen at the same time, one of R 5 and R 5* is hydrogen and the other is not hydrogen, especially an alkyl group such as a methyl group. Such doubly modified LNA nucleosides are disclosed in WO 2010 / 077578, which is hereby incorporated by reference.

[0294] In some aspects, -X-Y- is -O-CH(CH2-O-CH3)- (“2’O-methoxyethyl bicyclic nucleic acid”, Seth et al., J. Org. Chem. 2010, Vol. 75(5) pp. 1569-81).

[0295] In some aspects, -X-Y- is -O-CHR a -, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5*are both hydrogen. Such 6'-substituted LNA nucleosides are disclosed in WO 2010 / 036698 and WO 2007 / 090071, which are hereby incorporated by reference. In such 6'-substituted LNA nucleosides, R a is specifically a C1-C6 alkyl group, such as methyl.

[0296] In certain aspects, -X-Y- is -O-CH(CH2-O-CH3)-, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* are both hydrogen. Such LNA nucleosides are also known in the art as cyclic MOE (cMOE) and are disclosed in WO2007 / 090071.

[0297] In some aspects, -X-Y- is -O-CH(CH3)-.

[0298] In certain aspects, -X-Y- is -O-CH2-O-CH2- (Seth et al., J. Org. Chem 2010, ibid.).

[0299] In certain aspects, -X-Y- is -O-CH(CH3)-, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* are both hydrogen. Such 6'-methyl LNA nucleosides are also known in the art as cET nucleosides and can be (S)-cET or (R)-cET diastereoisomers, as disclosed in WO 2007 / 090071 (β-D) and WO 2010 / 036698 (α-L), both of which are hereby incorporated by reference.

[0300] In certain aspects, -X-Y- is -O-CR a R b -, where neither R a nor R b is hydrogen, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* are both hydrogen. In certain aspects, R a and R b are both alkyl groups, specifically both are methyl groups. Such 6'-disubstituted LNA nucleosides are disclosed in WO 2009 / 006478, which is hereby incorporated by reference.

[0301] In certain aspects, -X-Y- is -S-CHR a -, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such 6'-substituted thio-LNA nucleotides are disclosed in WO 2011 / 156202, which is hereby incorporated by reference. In certain aspects of such 6'-substituted thio-LNA, R a is alkyl, specifically methyl.

[0302] In certain aspects, -X-Y- is -C(=CH2)C(R a R b )-, for example, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such vinyl carbon LNA nucleotides are disclosed in WO 2008 / 154401 and WO 2009 / 067647, both of which are hereby incorporated by reference.

[0303] In certain aspects, -X-Y- is -N(OR a )-CH2-, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. In some aspects, R a is alkyl, such as methyl. Such LNA nucleotides are also referred to as N-substituted LNA and are disclosed in WO 2008 / 150729, which is hereby incorporated by reference.

[0304] In certain aspects, -X-Y- is -O-NCH3- (Seth et al., J. Org. Chem 2010, ibid.).

[0305] In certain aspects, -X-Y- is ON(R a )-–N(R a )-O-, -NR a -CR a R b -CR a R b - or –NR a -CR a R b -, W is oxygen, and R 1 、R 2 、R 3 、R5 and R 5* are both hydrogen. In some aspects, R a is an alkyl group, such as methyl. (Seth et al., J. Org. Chem 2010, ibid.).

[0306] In some aspects, R 5 and R 5* are both hydrogen. In other aspects, one of R 5 and R 5* is hydrogen and the other is an alkyl group, such as methyl. In these aspects, R 1 , R 2 and R 3 can specifically be hydrogen, while -X-Y- can specifically be -O-CH2- or -O-CHC(R a )3-, for example -O-CH(CH3)-.

[0307] In some aspects, -X-Y- is -CR a R b -O-CR a R b -, for example -CH2-O-CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* are both hydrogen. In such aspects, R a can specifically be an alkyl group, such as methyl. Such LNA nucleotides are also referred to as conformationally restricted nucleotides (CRNs) and are disclosed in WO 2013 / 036868, which is hereby incorporated by reference.

[0308] In some aspects, -X-Y- is -O-CR a R b -O-CR a R b -, for example -O-CH2-O-CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* are both hydrogen. In some aspects, R a can specifically be an alkyl group, such as methyl. Such LNA nucleotides are also referred to as COC nucleotide LNA and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225 - 1238, which is hereby incorporated by reference.

[0309] Unless otherwise indicated, it should be recognized that LNA nucleosides can be β-D or α-L stereoisomers.

[0310] Certain examples of LNA nucleosides are presented in Scheme 1.

[0311] Scheme 1

[0312]

[0313] As shown elsewhere, in some aspects of the present disclosure, the LNA nucleosides in the oligonucleotides are β-D-oxy-LNA nucleosides.

[0314] III.E. Nuclease-Mediated Degradation

[0315] Nuclease-mediated degradation refers to oligonucleotides that are capable of mediating the degradation of such sequences when forming a duplex with a complementary nucleotide sequence.

[0316] In some aspects, the oligonucleotides can act by nuclease-mediated degradation of the target nucleic acid, wherein the oligonucleotides of the present disclosure are capable of recruiting nucleases, particularly endonucleases, preferably ribonucleases (RNases), such as RNase H. Examples of oligonucleotide designs that act by a nuclease-mediated mechanism are oligonucleotides that typically contain a region of at least 5 or 6 DNA nucleosides and are flanked on one or both sides by affinity-enhanced nucleosides, such as gapmers.

[0317] III.F. RNase H Activity and Recruitment

[0318] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H and induce the degradation of a complementary RNA molecule when forming a duplex with the complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Generally, if the initial rate (measured in picomoles per liter per minute) when providing a complementary target nucleic acid sequence is at least 5%, such as at least 10% or greater than 20%, of the initial rate determined when using an oligonucleotide having the same base sequence as the modified oligonucleotide being tested, provided that the oligonucleotide contains only DNA monomers, wherein all monomers in the oligonucleotide have phosphorothioate linkages, and using the method provided in Examples 91-95 of WO01 / 23613, then the oligonucleotide is considered capable of recruiting RNase H.

[0319] In some aspects, an oligonucleotide is considered to be substantially unable to recruit RNase H if, when provided with a complementary target nucleic acid, the initial rate of RNase H (measured in picomoles per liter per minute) is less than 20% of the initial rate determined when using an oligonucleotide having the same base sequence as the oligonucleotide being tested, such as less than 10%, such as less than 5%, provided that the oligonucleotide contains only DNA monomers, no 2'-substitutions, and has phosphorothioate linkages between all monomers in the oligonucleotide, and the method provided in Examples 91-95 of WO01 / 23613 is used.

[0320] III.G. ASO Design

[0321] The ASOs of the present disclosure can comprise nucleotide sequences that include both nucleosides and nucleoside analogs and can be in the form of gapmers. Examples of gapmer configurations that can be used with the ASOs of the present disclosure are described in U.S. Patent Application Publication No. 2012 / 0322851.

[0322] As used herein, the term "gapmer" refers to an antisense oligonucleotide that comprises a region of an RNase H-recruiting oligonucleotide (the gap) that is flanked at the 5' and 3' ends by one or more affinity-enhanced modified nucleosides (the flanks). The term "LNA gapmer" is a gapmer oligonucleotide in which at least one of the affinity-enhanced modified nucleosides is an LNA nucleoside. The term "mixed wing gapmer" refers to an LNA gapmer in which the flank regions comprise at least one LNA nucleoside and at least one DNA nucleoside or non-LNA modified nucleoside, such as at least one 2'-substituted modified nucleoside, e.g., 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), and 2'-fluoro-ANA nucleosides.

[0323] In some aspects, the ASOs of the present disclosure can be in the form of a copolymer. In some aspects, the ASOs of the present disclosure can be in the form of a homopolymer. In some aspects, in addition to enhancing the affinity of the ASO for the target region, some nucleoside analogs also mediate binding and cleavage by RNases (e.g., RNase H). Since α-L-LNA monomers recruit RNase H activity to some extent, in some aspects, the gap region (e.g., Region B as referred to herein) of an ASO containing α-L-LNA monomers consists of fewer monomers that can be recognized and cleaved by RNase H, and greater flexibility is introduced in copolymer construction.

[0324] In some aspects, the ASOs of the present disclosure are gapmers and contain a contiguous segment of nucleotides (e.g., one or more DNAs) capable of recruiting an RNA enzyme such as RNase H, referred to herein as Region B (B), where Region B is flanked at both the 5' and 3' by regions of nucleoside analogs, Region A (A) and Region C (C), respectively, on the nucleotides of the contiguous segment of Region B. In some aspects, the nucleoside analogs are sugar-modified nucleosides (e.g., high-affinity sugar-modified nucleosides). In certain aspects, the sugar-modified nucleosides of Regions A and C enhance the affinity of the ASO for the target nucleic acid (i.e., affinity-enhanced 2'-sugar-modified nucleosides). In some aspects, the sugar-modified nucleosides are 2'-sugar-modified nucleotides, such as high-affinity 2'-sugar modifications, such as LNA and / or 2'-MOE.

[0325] In a gapmer, the nucleotides of Region B closest to the 5' and 3' are DNA nucleotides and are positioned adjacent to the nucleoside analogs (e.g., high-affinity sugar-modified nucleosides) of Regions A and C, respectively. In some aspects, Regions A and C can be further defined by having nucleoside analogs at the ends furthest from Region B (i.e., at the 5' end of Region A and the 3' end of Region C).

[0326] In some aspects, the ASOs of the present disclosure comprise a nucleotide sequence of formula (5' to 3') A-B-C, where: (A) (the 5' region or first wing sequence) comprises at least one nucleoside analog (e.g., 3-5 LNA units); (B) comprises at least four contiguous nucleosides (e.g., 4-24 DNA units) capable of recruiting an RNA enzyme when forming a duplex with a complementary RNA molecule such as a pre-mRNA or mRNA target); and (C) (the 3' region or second wing sequence) comprises at least one nucleoside analog (e.g., 3-5 LNA units)

[0327] In some aspects, Region A comprises 3-5 nucleoside analogs such as LNA, Region B consists of 6-24 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, or 14) DNA units, and Region C consists of 3 or 4 nucleoside analogs such as LNA. Such designs include (A-B-C) 3-14-3, 3-11-3, 3-12-3, 3-13-3, 4-9-4, 4-10-4, 4-11-4, 4-12-4, and 5-10-5. In some aspects, the ASO has an LLLD n LLL, LLLLD n LLLL or LLLLLD nDesign of LLLLL, where L is a nucleoside analogue, D is DNA, and n can be any integer between 4 and 24. In some aspects, n can be any integer between 6 and 14. In some aspects, n can be any integer between 8 and 12. In some aspects, n is 14. In some aspects, the ASO contains 20 nucleosides, where the ASO has LLLD 14 Design of LLL. In some aspects, the ASO has the design of LLLMMDnMMLLL, LLLMDnMLLL, LLLLMMDnMMLLLL, LLLLMDnMLLLL, LLLLLLMMDnMMLLLLL or LLLLLLMDnMLLLLL, where D is DNA, n can be any integer between 3 and 15, L is LNA, and M is 2'MOE.

[0328] In some aspects, the ASO has a design including the following:

[0329] 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3'

[0330] where "lnN" represents LNA of the specific nucleoside "N"; where "dN" represents DNA of the specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; and where "(s)" represents a phosphorothioate bond.

[0331] In some aspects, the ASO has a design including the following:

[0332] 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-lnT-(s)-ln5MeC 3'

[0333] where "lnN" represents LNA of the specific nucleoside "N"; where "dN" represents DNA of the specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; and where "(s)" represents a phosphorothioate bond.

[0334] In some aspects, the ASO has a design including the following:

[0335] 5'GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3';

[0336] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol. In some aspects, the ASO has a design including the following:

[0337] 5′GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-lnT-(s)-ln5MeC 3′;

[0338] where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

[0339] Additional gapmer designs are disclosed in WO2004 / 046160, WO 2007 / 146511 and WO2008 / 113832, each of which is hereby incorporated by reference in its entirety.

[0340] III.H. Inter-nucleotide bond

[0341] The monomers of the ASO described herein are coupled together by a linking group. Suitably, each monomer is linked to the adjacent 3'-monomer by a linking group.

[0342] One of ordinary skill in the art will understand that in the context of the present disclosure, the 5'-monomer at the end of an ASO does not contain a 5'-linking group, although it may or may not contain a 5'-terminal group.

[0343] In some aspects, the contiguous nucleotide sequence comprises one or more modified internucleoside linkages. The term "linking group" or "internucleoside linkage" is intended to mean a group capable of covalently coupling two nucleosides together. Non-limiting examples include phosphate groups and phosphorothioate groups.

[0344] The nucleosides of the ASO of the present disclosure or its contiguous nucleoside sequences are coupled together by linking groups. Suitably, each nucleoside is linked to the adjacent 3'-nucleoside by a linking group.

[0345] In some aspects, the internucleoside linkages are modified from their normal phosphodiester to a linkage more resistant to nuclease attack, such as a phosphorothioate that can be cleaved by RNase H, which also allows the antisense inhibitory pathway to reduce the expression of the target gene. In some aspects, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the internucleoside linkages are modified.

[0346] IV. Extracellular vesicles, such as exosomes

[0347] The present disclosure provides EVs (e.g., exosomes) comprising an ASO. The ASO can be any ASO described herein or a functional fragment thereof. In certain aspects, the ASO reduces the level of STAT6 mRNA or STAT6 protein in a target cell.

[0348] In some aspects, the EVs (e.g., exosomes) target tumor cells, dendritic cells, T cells, B cells, macrophages, monocytes, neurons, hepatocytes, Kupffer cells, myeloid cells (e.g., neutrophils, myeloid-derived suppressor cells (MDSCs, e.g., monocytic MDSCs or granulocytic MDSCs), monocytes, macrophages, hematopoietic stem cells, basophils, neutrophils or eosinophils) or any combination thereof. In some aspects, the EVs (e.g., exosomes) target myeloid cells. In some aspects, the EVs (e.g., exosomes) target macrophages. In certain aspects, the EVs (e.g., exosomes) target the liver, heart, lung, brain, kidney, central nervous system, peripheral nervous system, muscle, bone, joint, skin, intestine, bladder, pancreas, lymph node, spleen, blood, bone marrow or any combination thereof.

[0349] In some aspects, EVs (e.g., exosomes) reduce the expression of one or more genes upregulated by STAT6. In some aspects, EVs (e.g., exosomes) promote the differentiation of M2 macrophages. In some aspects, EVs (e.g., exosomes) reduce the differentiation of M1 macrophages.

[0350] As described above, the EVs described herein, such as exosomes, are extracellular vesicles having a diameter of between about 20 nm and 300 nm (e.g., between 40 nm and 200 nm). The size of the EVs (e.g., exosomes) described herein can be measured according to the methods described below.

[0351] In some aspects, the EVs of the present disclosure (e.g., exosomes) comprise a bilayer lipid membrane (“EV, e.g., exosome membrane”), comprising an inner (luminal) surface and an outer surface. In certain aspects, the inner (luminal) surface faces the core (i.e., lumen) of the EV (e.g., exosome). In certain aspects, the outer surface can contact the endosome, multivesicular body, or membrane / cytoplasm of the producer cell or target cell

[0352] In some aspects, the EV (e.g., exosome) membrane comprises lipids and fatty acids. In some aspects, the EV (e.g., exosome) membrane comprises phospholipids, glycolipids, fatty acids, sphingolipids, phosphoglycerides, sterols, cholesterol, and phosphatidylserine.

[0353] In some aspects, the EV (e.g., exosome) membrane comprises an inner leaflet and an outer leaflet. The composition of the inner and outer leaflets can be determined by transbilayer distribution assays known in the art, see, e.g., Kuypers et al., Biochim Biophys Acta 1985 819:170. In some aspects, the composition of the outer leaflet is between about 70% - 90% choline phospholipids, between about 0% - 15% acidic phospholipids, and between about 5% - 30% phosphatidylethanolamine. In some aspects, the composition of the inner leaflet is between about 15% - 40% choline phospholipids, between about 10% - 50% acidic phospholipids, and between about 30% - 60% phosphatidylethanolamine.

[0354] In some aspects, the EV (e.g., exosome) membrane comprises one or more polysaccharides, such as glycans.

[0355] In some aspects, the EVs of the present disclosure (e.g., exosomes) comprise ASO, wherein the ASO is linked to the EV via a scaffold moiety on the outer surface or the luminal surface of the EV.

[0356] In some aspects, the EV (e.g., exosome) comprising ASO comprises an anchoring moiety between the ASO and the exosome membrane, which anchoring moiety optionally comprises a linker. Non-limiting examples of linkers are disclosed elsewhere herein.

[0357] IV.A. Anchoring moiety

[0358] One or more anchoring moieties (AM) can be used to anchor the ASO to the EVs of the present disclosure. In some aspects, the ASO is directly connected to the anchoring moiety or connected through a linker. In some aspects, the ASO can be attached to the anchoring moiety or linker combination through the reaction between a "reactive group" (RG; e.g., amine, thiol, hydroxyl, carboxylic acid or azide) and a "reactive moiety" (RM; e.g., maleimide, succinate, NHS). Several potential synthetic routes are envisioned, such as:

[0359] [AM] - / reactive moiety / + / reactive group / - [ASO]

[0360] [AM] - [linker]n - / reactive moiety / + / reactive group / - [ASO]

[0361] [AM] - / reactive moiety / + / reactive group / - [linker]n - [ASO]

[0362] [AM] - [linker]n - / reactive moiety / + / reactive group / - [linker]n - [ASO]

[0363] The anchoring moiety can be inserted into the lipid bilayer of the EV (e.g., exosome), thereby allowing the exosome to load the ASO. Currently, the main obstacle to the commercialization of exosomes as delivery vehicles for polar ASOs is the very inefficient loading. This obstacle can be overcome by modifying the polar ASO before loading it into the exosome. Thus, as described herein, the modification of the ASO helps to load it into the exosome.

[0364] Compared with the previously reported loading efficiency of introducing unmodified ASO into exosomes by, for example, electroporation or cationic lipid transfection, the method of loading exosomes with modified polar ASO described herein significantly improves the loading efficiency.

[0365] In some aspects, the modification increases the hydrophobicity of the ASO by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold or at least about 10-fold relative to the native (unmodified) ASO. In some aspects, the modification increases the hydrophobicity of the ASO by at least about 1 order of magnitude, at least about 2 orders of magnitude, at least about 3 orders of magnitude, at least about 4 orders of magnitude, at least about 5 orders of magnitude, at least about 6 orders of magnitude, at least about 7 orders of magnitude, at least about 8 orders of magnitude, at least about 9 orders of magnitude or at least about 10 orders of magnitude relative to the native (unmodified) ASO.

[0366] In some aspects, relative to a native (unmodified) ASO, e.g., a corresponding unmodified ASO, the modification increases the hydrophobicity of the ASO by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150%, at least about 175%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or at least about 1000%. The increase in hydrophobicity can be evaluated using any suitable method. For example, hydrophobicity can be determined by measuring the percentage solubility in an organic solvent (e.g., octanol) as compared to solubility in an aqueous solvent (e.g., water).

[0367] In some aspects, the anchoring moiety can be chemically conjugated to the ASO to enhance its hydrophobic characteristics. In an exemplary aspect, the anchoring moiety is a sterol (e.g., cholesterol), GM1, a lipid, a vitamin, a small molecule, a peptide, or a combination thereof. In some aspects, the moiety is a lipid. In some aspects, the anchoring moiety is a sterol (e.g., cholesterol). Additional hydrophobic moieties include, for example, phospholipids, lysophospholipids, fatty acids, or vitamins (e.g., vitamin D or vitamin E).

[0368] In some aspects, the anchoring moiety is conjugated at the terminus of the ASO directly or through one or more linkers (i.e., "terminal modification"). In other aspects, the anchoring moiety is conjugated to other parts of the ASO.

[0369] In some aspects, the ASO can include a detectable label. Exemplary labels include fluorescent labels and / or radioactive labels. In some aspects, when the ASO is fluorescently labeled, the detectable label can be, for example, Cy3. Adding a detectable label to the ASO can be used as a method to label exosomes and track their biodistribution. In other aspects, the detectable label can be directly attached to the exosome, e.g., by labeling exosome lipids and / or exosome peptides.

[0370] The different components of the ASO (i.e., the anchoring moiety, linkers and linker combinations, and the ASO) can be linked by amide, ester, ether, thioether, disulfide, phosphoramidate, phosphotriester, phosphorodithioate, methylphosphonate, phosphodiester, or phosphorothioate bonds, or alternatively any or other bonds.

[0371] In some aspects, the different components of the ASO can be linkers using bifunctional linkers (i.e., linkers containing two functional groups), such as N-succinimidyl-3-(2-pyridyldithio)propionate, N-4-maleimidobutyric acid, S-(2-pyridyldithio)cysteamine, iodoacetoxysuccinimide, N-(4-maleimidobutoxy)succinimide, N-[5-(3'-maleimidopropionamido)-1-carboxypentyl]iminodiacetic acid, N-(5-aminopentyl)-iminodiacetic acid, and the like.

[0372] Suitable anchoring moieties capable of anchoring the ASO to the surface of EVs (e.g., exosomes) include, for example, sterols (e.g., cholesterol), lipids, lysophospholipids, fatty acids, or fat-soluble vitamins, as described in detail below.

[0373] In some aspects, the anchoring moiety can be a lipid. The lipid anchoring moiety can be any lipid known in the art, for example, palmitic acid or glycosylphosphatidylinositol. In some aspects, the lipid is a fatty acid, phosphatide, phospholipid (e.g., phosphatidylcholine, phosphatidylserine, or phosphatidylethanolamine), or an analogue thereof (e.g., phosphatidylcholine, lecithin, phosphatidylethanolamine, cephalin, or phosphatidylserine or an analogue or moiety thereof, such as a partially hydrolyzed moiety thereof).

[0374] Generally, the anchoring moiety is chemically attached. However, the anchoring moiety can be attached to the ASO enzymatically. In some aspects, the anchoring moiety can be attached to the ASO by altering cell culture conditions. For example, by using a medium in which myristic acid is limiting, some other fatty acids (including shorter-chain fatty acids and unsaturated fatty acids) can be attached to the N-terminal glycine. For example, in BK channels, myristoylation has been reported to be attached post-translationally to internal serine / threonine or tyrosine residues via a hydroxyester bond.

[0375] The anchoring moiety can be conjugated directly or indirectly to the ASO via a linker combination at any chemically feasible position (e.g., at the 5' and / or 3' end of the ASO). In one aspect, the anchoring moiety is conjugated only to the 3' end of the ASO. In one aspect, the anchoring moiety is conjugated only to the 5' end of the ASO. In one aspect, the anchoring moiety is conjugated at a position that is not the 3' or 5' end of the ASO.

[0376] The following table presents some types of membrane anchors that can be used to practice the methods of the present disclosure:

[0377]

[0378] In some aspects, the anchoring moiety of the present disclosure can comprise two or more types of anchoring moieties disclosed herein. For example, in some aspects, the anchoring moiety can comprise two lipids (e.g., phospholipids and fatty acids), or two phospholipids, or two fatty acids, or a lipid and a vitamin, or cholesterol and a vitamin, etc., which together have 6 - 80 carbon atoms (i.e., an equivalent carbon number (ECN) of 6 - 80).

[0379] IV.A.1. Cholesterol and Other Sterols

[0380] In some aspects, the anchoring moiety comprises a sterol, steroid, hopane, hydroxy steroid, seco - steroid compound, or an analogue thereof having lipophilic properties. In some aspects, the anchoring moiety comprises a sterol, such as a phytosterol, mycosterol, or zoosterol. Exemplary zoosterols include cholesterol and 24S - hydroxycholesterol; exemplary phytosterols include ergosterol (mycosterol), campesterol, sitosterol, and stigmasterol. In some aspects, the sterol is selected from ergosterol, 7 - dehydrocholesterol, cholesterol, 24S - hydroxycholesterol, lanosterol, cycloartenol, fucosterol, saringosterol, campesterol, β - sitosterol, dihydro - β - sitosterol, coprostanol, avenasterol, or stigmasterol. The sterol can be a free sterol, acylated (sterol ester), alkylated (steryl alkyl ether), sulfated (sulfated sterol), or linked to a glycoside moiety (steryl glycoside), and the glycoside moiety itself can be acylated (acylated steryl glycoside).

[0381] In some aspects, the anchoring moiety comprises a steroid. In some aspects, the steroid is selected from dihydrotestosterone, uvaol, hecogenin, diosgenin, progesterone, or cortisol.

[0382] For example, a sterol can be conjugated to an ASO directly or through a linker at an available - OH group of the sterol. Exemplary sterols have the general backbone shown below:

[0383]

[0384] As another example, ergosterol has the following structure:

[0385]

[0386] Cholesterol has the following structure:

[0387]

[0388] Thus, in some embodiments, the free - OH group of a sterol or steroid is used to conjugate an ASO directly or through a linker to the sterol (e.g., cholesterol) or steroid.

[0389] IV.A.2. Fatty Acids

[0390] In some aspects, the anchoring moiety is a fatty acid. In some aspects, the fatty acid is a short-chain, medium-chain, or long-chain fatty acid. In some aspects, the fatty acid is a saturated fatty acid. In some aspects, the fatty acid is an unsaturated fatty acid. In some aspects, the fatty acid is a monounsaturated fatty acid. In some aspects, the fatty acid is a polyunsaturated fatty acid, such as an ω-3 or ω-6 fatty acid.

[0391] In some aspects, the anchoring moiety comprises two fatty acids, each of which is independently selected from fatty acids having a chain of any one of the aforementioned ranges or numbers of carbon atoms. In some aspects, one of the fatty acids is independently a fatty acid having a C6-C21 chain, and one of the fatty acids is independently a fatty acid having a C12-C36 chain. In some embodiments, each fatty acid independently has a chain of 11, 12, 13, 14, 15, 16, or 17 carbon atoms.

[0392] Suitable fatty acids include saturated straight chain fatty acids, saturated branched chain fatty acids, unsaturated fatty acids, hydroxy fatty acids and polycarboxylic acids. In some aspects, such fatty acids have up to 32 carbon atoms.

[0393] IV.A.3. Phospholipids

[0394] In some aspects, the anchoring moiety comprises a phospholipid. Phospholipids are a class of lipids that are a major component of all cell membranes. Due to their amphiphilic nature, phospholipids can form lipid bilayers. The structure of a phospholipid molecule generally consists of two hydrophobic fatty acid "tails" and a hydrophilic "head" composed of phosphate groups. For example, a phospholipid can be a lipid according to the following formula:

[0395]

[0396] Where R p represents a phospholipid moiety, and R1 and R2 represent fatty acid moieties with or without a degree of unsaturation which may be the same or different.

[0397] The phospholipid moiety can, for example, be selected from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0398] IV.A.4. Lysolipids (e.g., lysophospholipids)

[0399] In some aspects, the anchoring moiety comprises a lysolipid (e.g., a lysophospholipid). A lysolipid is a derivative of a lipid in which one or two fatty acyl chains have been removed, typically by hydrolysis. A lysophospholipid is a derivative of a phospholipid in which one or two fatty acyl chains have been removed by hydrolysis.

[0400] In some aspects, the anchoring moiety comprises any of the phospholipids disclosed above, wherein one or both acyl chains have been removed by hydrolysis, and thus the resulting lysophospholipid contains one or no fatty acid acyl chains.

[0401] In some aspects, the anchoring moiety comprises lysoglycerophospholipids, lysosphingolipids, lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, or lysophosphatidylserine.

[0402] IV.A.5. Vitamins

[0403] In some aspects, the anchoring moiety comprises lipophilic vitamins, e.g., folic acid, vitamin A, vitamin E, or vitamin K.

[0404] In some aspects, the anchoring moiety comprises vitamin A. Vitamin A is a group of unsaturated nutritional organic compounds that includes retinol, retinal, retinoic acid, and several provitamin A carotenoids (most notably β-carotene). In some aspects, the anchoring moiety comprises retinol. In some aspects, the anchoring moiety comprises retinoids. Retinoids are a class of chemical compounds that are either isovitamins of vitamin A or are chemically related to vitamin A. In some aspects, the anchoring moiety comprises first-generation retinoids (e.g., retinol, tretinoin, isotretinoin, or alitretinoin), second-generation retinoids (e.g., acitretin or acitretin), third-generation retinoids (e.g., adapalene, bexarotene, or tazarotene), or any combination thereof.

[0405] IV.B. Linker Combinations

[0406] In some aspects, the ASO is linked to a hydrophobic membrane anchoring moiety disclosed herein by a linker combination, which can comprise any combination of cleavable and / or non-cleavable linkers. The primary function of the linker combination is to provide an optimal spacing between the anchoring moiety and the BAM target. For example, in the case of an ASO, the linker combination should reduce steric hindrance and position the ASO such that it can interact with the target nucleic acid (e.g., mRNA or miRNA).

[0407] The linker may be susceptible to cleavage ("cleavable linker"), thereby facilitating the release of the bioactive molecule. Thus, in some aspects, the linker combinations disclosed herein can comprise cleavable linkers. Under conditions where the bioactive molecule remains active, such cleavable linkers may be susceptible to, for example, acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage. Alternatively, the linker can be substantially resistant to cleavage ("non-cleavable linker"). In some aspects, the cleavable linker comprises a spacer. In some aspects, the spacer is PEG.

[0408] In some aspects, the linker combination comprises at least 2, at least 3, at least 4, at least 5, or at least 6 or more different linkers disclosed herein. In some aspects, the linkers in the linker combination can be linked by an ester bond (e.g., phosphodiester or phosphorothioate).

[0409] In some aspects, the linker is a direct bond between the anchoring moiety and the BAM (e.g., ASO).

[0410] IV.B.1. Non-cleavable Linkers

[0411] In some aspects, the linker combination comprises a "non-cleavable linker". A non-cleavable linker is any chemical moiety (e.g., a bioactive molecule and an anchoring moiety; a bioactive molecule and a cleavable linker; an anchoring moiety and a cleavable linker) that is capable of covalently linking two or more components of a modified bioactive molecule of the present disclosure in a stable manner and does not fall into the category of cleavable linkers listed above. Thus, the non-cleavable linker is substantially resistant to acid-induced cleavage, photo-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage.

[0412] Furthermore, non-cleavable means the ability of a chemical bond in or adjacent to the linker to withstand cleavage induced by an acid, a photo-labile cleavage agent, a peptidase, an esterase, or a chemical or physiological compound that cleaves disulfide bonds under conditions where the cyclic dinucleotide and / or the antibody do not lose their activity. In some aspects, the bioactive molecule is attached to the linker via another linker (e.g., a self-immolative linker).

[0413] In some aspects, the linker combination comprises a non-cleavable linker that comprises, for example, tetraethylene glycol (TEG), hexaethylene glycol (HEG), polyethylene glycol (PEG), succinimide, or any combination thereof. In some aspects, the non-cleavable linker comprises a spacer subunit to link the bioactive molecule to the non-cleavable linker.

[0414] In some aspects, one or more non-cleavable linkers comprise smaller units (e.g., HEG, TEG, glycerol, C2-C12 alkyl, etc.) linked together. In one aspect, the bond is an ester bond (e.g., phosphodiester or phosphorothioate) or other bond.

[0415] IV.B.1.a. Ethylene Glycols (HEG, TEG, PEG)

[0416] In some aspects, the linker combination comprises a non-cleavable linker, wherein the non-cleavable linker comprises polyethylene glycol (PEG) characterized by the formula: R 3 -(O-CH2-CH2) n - or R 3 -(0-CH2-CH2) n -O-, wherein R3 is hydrogen, methyl or ethyl, and the value of n is from 2 to 200. In some aspects, the linker comprises a spacer, wherein the spacer is PEG.

[0417] In some aspects, the PEG linker is oligoethylene glycol, e.g., diglycol, triglycol, tetraethylene glycol (TEG), pentaethylene glycol or hexaethylene glycol (HEG) linker.

[0418] In some aspects, the value of n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199 or 200.

[0419] In some aspects, n is between 2 and 10, between 10 and 20, between 20 and 30, between 30 and 40, between 40 and 50, between 50 and 60, between 60 and 70, between 70 and 80, between 80 and 90, between 90 and 100, between 100 and 110, between 110 and 120, between 120 and 130, between 130 and 140, between 140 and 150, between 150 and 160, between 160 and 170, between 170 and 180, between 180 and 190, or between 190 and 200.

[0420] In some specific aspects, the value of n is 3 to 200, 3 to 20, 10 to 30, or 9 to 45.

[0421] In some aspects, the PEG is branched PEG. The branched PEG has 3 to 10 PEG chains emanating from a central core group.

[0422] In certain embodiments, the PEG moiety is monodisperse polyethylene glycol. In the context of the present disclosure, monodisperse polyethylene glycol (mdPEG) is a PEG having a single, defined chain length and molecular weight. mdPEG is typically produced by separation from a polymerization mixture by chromatography. In certain formulas, the monodisperse PEG moiety is designated by the abbreviation mdPEG.

[0423] In some aspects, the PEG is star PEG. The star PEG has 10 to 100 PEG chains emanating from a central core group.

[0424] In some aspects, the PEG is comb PEG. The comb PEG has multiple PEG chains typically grafted to a polymer backbone.

[0425] In certain aspects, the molar mass of the PEG is between 100 g / mol and 3000 g / mol, specifically between 100 g / mol and 2500 g / mol, more specifically about 100 g / mol to 2000 g / mol. In certain aspects, the molar mass of the PEG is between 200 g / mol and 3000 g / mol, specifically between 300 g / mol and 2500 g / mol, more specifically about 400 g / mol to 2000 g / mol.

[0426] In some aspects, the PEG is PEG 100 、PEG 200 、PEG 300 、PEG 400 、PEG 500 、PEG 600 、PEG 700 、PEG800 , PEG 900 , PEG 1000 , PEG 1100 , PEG 1200 , PEG 1300 , PEG 1400 , PEG 1500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 2600 , PEG 2700 , PEG 2800 , PEG 2900 or PEG 3000 . In one particular aspect, the PEG is PEG 400 . In another particular aspect, the PEG is PEG 2000 .

[0427] In some aspects, the linker combinations of the present disclosure can include several PEG linkers, e.g., cleavable linkers flanked by PEG, HEG or TEG linkers.

[0428] In some aspects, the linker combination includes (HEG)n and / or (TEG)n, where n is an integer between 1 and 50, and each unit is connected, for example, by a phosphate ester linker, a phosphorothioate bond, or a combination thereof.

[0429] In some aspects, the ASO has a design including the following:

[0430] 5' GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3';

[0431] Where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

[0432] In some aspects, the ASO has a design comprising the following:

[0433] 5′ GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-lnT-(s)-ln5MeC 3′;

[0434] Where "lnN" represents LNA of a specific nucleoside "N"; where "dN" represents DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

[0435] In some aspects, the ASO has a design comprising the following:

[0436]

[0437] IV.B.1.b. Glycerol and polyglycerol (PG)

[0438] In some aspects, the linker combination comprises a non-cleavable linker, the non-cleavable linker comprising by formula ((R3—O—(CH2—CHOH—CH2O) n—) the glycerol unit or polyglycerol (PG) described, where R3 is hydrogen, methyl or ethyl, and the value of n is from 3 to 200. In some aspects, the value of n is from 3 to 20. In some aspects, the value of n is from 10 to 30.

[0439] In some aspects, the PG linker is a diglycerol, triglycerol, tetraglycerol (TG), pentaglycerol or hexaglycerol (HG) linker.

[0440] In some aspects, the linker combination comprises (glycerol)n and / or (HG)n and / or (TG)n, where n is an integer between 1 and 50, and each unit is connected, for example, by a phosphate ester linker, a phosphorothioate bond or a combination thereof.

[0441] In some aspects, the linker combination comprises at least one aliphatic (alkyl) linker, such as propyl, butyl, hexyl or C2-C12 alkyl, such as C2-C10 alkyl or C2-C6 alkyl.

[0442] IV.B.2. Cleavable Linkers

[0443] In some aspects, the different components of the ASO disclosed herein can be linked by a cleavable linker. The term "cleavable linker" refers to a linker that contains at least one bond or chemical bond that can be broken or cleaved. As used herein, the term cleavage refers to the breaking of one or more chemical bonds in a relatively large molecule in a manner that produces two or more relatively smaller molecules. Cleavage can be mediated, for example, by a nuclease, peptidase, protease, phosphatase, oxidase or reductase, or by specific physicochemical conditions (such as redox environment, pH, presence of reactive oxygen species or light of a specific wavelength).

[0444] In some aspects, the term "cleavable" as used herein refers to, for example, a linker that can be rapidly degraded, such as phosphodiester and disulfide, while the term "non-cleavable" refers to, for example, a more stable bond, such as a nuclease-resistant phosphorothioate.

[0445] In some aspects, the cleavable linker is a dinucleotide or trinucleotide linker, disulfide, imine, thioacetal, val-cit dipeptide or any combination thereof.

[0446] In some aspects, the cleavable linker comprises valine-alanine-p-aminobenzyl carbamate or valine-citrulline-p-aminobenzyl carbamate.

[0447] IV.B.2.a. Redox-Cleavable Linkers

[0448] In some aspects, the linker combination comprises a redox-cleavable linker. As a non-limiting example, one type of cleavable linker is a redox-cleavable linking group that is cleaved upon reduction or oxidation.

[0449] In some aspects, the redox-cleavable linker contains a disulfide bond, i.e., the redox-cleavable linker is a disulfide-cleavable linker.

[0450] The redox-cleavable linker can be reduced, for example, by intracellular thiols, oxidases, or reductases.

[0451] IV.B.2.b. Reactive oxygen species (ROS)-cleavable linker

[0452] In some aspects, the linker combination can include a cleavable linker that can be cleaved by reactive oxygen species (ROS) (such as superoxide (O₂⁻) or hydrogen peroxide (H₂O₂)) generated, for example, by an inflammatory process (such as activated neutrophils). In some aspects, the ROS-cleavable linker is a thioacetal-cleavable linker. See, for example, U.S. Patent No. 8,354,455B2, the entire content of which is incorporated herein by reference.

[0453] IV.B.2.c. pH-dependent cleavable linker

[0454] In some aspects, the linker is an "acid-labile linker" that contains an acid-cleavable linking group, which is a linking group that is selectively cleaved under acidic conditions (pH < 7).

[0455] As a non-limiting example, the acid-cleavable linking group is cleaved in an acidic environment (e.g., about 6.0, 5.5, 5.0 or lower). In some aspects, the pH is about 6.5 or lower. In some aspects, the linker is cleaved by an agent such as an enzyme that can act as a general acid, such as a peptidase (which can be substrate-specific) or a phosphatase. Inside the cell, certain low-pH organelles (such as endosomes and lysosomes) can provide a cleavage environment for the acid-cleavable linking group. Although the pH of human serum is 7.4, the average pH in cells is slightly lower, in the range of about 7.1 to 7.3. Endosomes also have an acidic pH in the range of 5.5 to 6.0, and lysosomes are at a more acidic pH of about 5.0. Thus, in the art, pH-dependent cleavable linkers are sometimes referred to as endosome-labile linkers.

[0456] Additional examples can be found in U.S. Patent Nos. 9,790,494B2 and 8,137,695B2, the contents of which are incorporated herein by reference in their entirety.

[0457] IV.B.2.d. Enzymatically cleavable linker

[0458] In some aspects, the linker combination can include linkers that can be cleaved by intracellular or extracellular enzymes (e.g., proteases, esterases, nucleases, amidases). The range of enzymes that can cleave a particular linker in the linker combination depends on the particular bond and chemical structure of the linker. Thus, peptide linkers can be cleaved, for example, by peptidases, linkers containing ester bonds can be cleaved, for example, by esterases; linkers containing amide bonds can be cleaved, for example, by amidases; and so on.

[0459] IV.B.2.e. Protease-cleavable linkers

[0460] In some aspects, the linker combination includes protease-cleavable linkers, i.e., linkers that can be cleaved by endogenous proteases. Only certain peptides are readily cleaved inside or outside cells. See, for example, Trout et al., 79 Proc. Natl. Acad. Sci. USA, 626-629 (1982) and Umemoto et al., 43 Int. J. Cancer, 677-684 (1989). The cleavable linker can contain a cleavage site that includes α-amino acid units and peptide bonds, which are amide bonds chemically between the carboxylate of one amino acid and the amino group of a second amino acid. Other amide bonds, such as the bond between a carboxylate and the α-amino group of lysine, are understood not to be peptide bonds and are considered non-cleavable.

[0461] IV.B.2.f. Esterase-cleavable linkers

[0462] Some linkers are cleaved by esterases (“esterase-cleavable linkers”). Only certain esters can be cleaved by esterases and amidases present inside or outside cells. Esters are formed by the condensation of a carboxylic acid and an alcohol. Simple esters are those produced with simple alcohols (such as fatty alcohols, small cyclic and small aromatic alcohols). Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester-cleavable linking groups have the general formula -C(O)O- or -OC(O)-.

[0463] IV.B.2.g. Phosphatase-cleavable linkers

[0464] In some aspects, the linker combination can include a phosphate-based cleavable linking group that is cleaved by an agent that degrades or hydrolyzes a phosphate group. Examples of agents that cleave intracellular phosphate groups are enzymes such as intracellular phosphatases. Examples of phosphate group linking groups are —O—P(O)(ORk)—O—, —O—P(S)(OR k )—O—, —O—P(S)(SR k )—O-, -S-P(O)(OR k )-O-, -O-P(O)(OR k )-S-, -S-P(O)(OR k)-S-, -O-P(S)(OR k )-S-, -SP(S)(OR k )-O-, -OP(O)(R k )-O-, -OP(S)(R k )-O-, -SP(O)(R k )-O-, -SP(S)(R k )-O-, -SP(O)(R k )-S- or -OP(S)(R k )-S-.

[0465] In each aspect, R k is any one of the following: NH2, BH3, CH3, C 1-6 alkyl, C 6-10 aryl, C 1-6 alkoxy and C 6-10 aryloxy. In some aspects, C 1-6 alkyl and C 6-10 aryl are unsubstituted. Additional non-limiting examples are: -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S- or -O-P(O)(OH)-O-.

[0466] IV.B.2.h. Photoactivatable Cleavable Linker

[0467] In some aspects, the combined linker comprises a photoactivatable cleavable linker, e.g., a nitrobenzyl linker or a linker comprising a nitrobenzyl reactive group.

[0468] IV.B.2.i. Self-Cleaving Linker

[0469] In some aspects, the linker combination comprises a self-cleaving linker. In some aspects, the self-cleaving linker in the EVs (e.g., exosomes) of the present disclosure undergoes 1,4 elimination after enzymatic cleavage of the protease-cleavable linker. In some aspects, the self-cleaving linker in the EVs (e.g., exosomes) of the present disclosure undergoes 1,6 elimination after enzymatic cleavage of the protease-cleavable linker. In some aspects, the self-cleaving linker is, for example, a p-aminobenzyl (pAB) derivative, such as p-aminobenzyl carbamate (pABC), p-aminobenzyl ether (PABE), p-aminobenzyl carbonate, or a combination thereof.

[0470] In some aspects, the cleavable linker is valine-alanine-p-aminobenzyl carbamate or valine-citrulline-p-aminobenzyl carbamate.

[0471] IV.B.3. Reactive Moiety (RM)

[0472] The ASOs of the present disclosure are produced by chemical synthesis or by chemical reactions between its components. For example, in some aspects, an anchoring moiety comprising a reactive group (e.g., maleimide) can react with an ASO comprising a maleimide-reactive group to produce a hydrophobic modified ASO of the present disclosure, wherein the anchoring moiety can be inserted into the lipid bilayer of the membrane of the exosome, thereby attaching the ASO to the surface of the exosome.

[0473] IV.C. Scaffold Moiety

[0474] One or more scaffold moieties can be expressed in EVs. In some aspects, one or more scaffold moieties are used to anchor ASOs to the EVs of the present disclosure. In other aspects, in addition to ASOs, one or more scaffold moieties are used to anchor proteins or molecules to EVs. Thus, the EVs of the present disclosure comprise an anchoring moiety linking an ASO and a scaffold moiety linking a protein or molecule, such as a targeting moiety. In some aspects, the ASO is linked to the scaffold moiety. In some aspects, the EVs comprise more than one scaffold moiety. In some aspects, a first ASO is linked to a first scaffold moiety and a second ASO is linked to a second scaffold moiety. In some aspects, the first scaffold moiety and the second scaffold moiety are the same type of scaffold moiety, e.g., both the first scaffold moiety and the second scaffold moiety are scaffold X protein. In some aspects, the first scaffold moiety and the second scaffold moiety are different types of scaffold moieties, e.g., the first scaffold moiety is scaffold Y protein and the second scaffold moiety is scaffold X protein. In some aspects, the first scaffold moiety is scaffold Y disclosed herein. In some aspects, the first scaffold moiety is scaffold X disclosed herein. In some aspects, the second scaffold moiety is scaffold Y disclosed herein. In some aspects, the second scaffold moiety is scaffold X disclosed herein.

[0475] In some aspects, the EVs contain one or more scaffold moieties that can anchor the ASO to the EV (e.g., exosome) (e.g., on the luminal surface or the outer surface). In certain aspects, the scaffold moiety is a polypeptide (“scaffold protein”). In certain aspects, the scaffold protein contains an exosomal protein or a fragment thereof. In other aspects, the scaffold moiety is a non-polypeptide moiety. In some aspects, the scaffold protein includes various membrane proteins enriched on the exosomal membrane, such as transmembrane proteins, integrin proteins, and peripheral proteins. It can include various CD proteins, transporter proteins, integrins, lectins, and cadherins. In certain aspects, the scaffold moiety (e.g., scaffold protein) contains Scaffold X. In other aspects, the scaffold moiety (e.g., exosomal protein) contains Scaffold Y. In additional aspects, the scaffold moiety (e.g., exosomal protein) contains both Scaffold X and Scaffold Y.

[0476] In some aspects, the EVs (e.g., exosomes) of the present disclosure contain modified membranes in their compositions. For example, the membrane composition can be modified by altering the protein, lipid, or glycan content of the membrane.

[0477] In some aspects, surface-engineered EVs (e.g., exosomes) are produced by chemical and / or physical methods, such as PEG-induced fusion and / or sonication fusion. In other aspects, surface-engineered EVs (e.g., exosomes) are produced by genetic engineering. EVs (e.g., exosomes) produced by genetically modified producer cells or progeny of genetically modified cells can contain modified membrane compositions. In some aspects, surface-engineered EVs (e.g., exosomes) have a higher or lower density (e.g., higher number) of scaffold moieties (e.g., exosomal proteins, e.g., Scaffold X), or include variants or fragments of the scaffold moiety.

[0478] For example, surface (e.g., Scaffold X)-engineered EVs can be produced by cells (e.g., HEK293 cells) transformed with an exogenous sequence encoding a scaffold moiety (e.g., exosomal protein, e.g., Scaffold X) or a variant or fragment thereof. EVs including the scaffold moiety expressed by the exogenous sequence can include modified membrane compositions.

[0479] Various modifications or fragments of the scaffold moiety can be used in aspects of the present disclosure. For example, scaffold moieties modified to have enhanced affinity for a binder can be used to produce surface-engineered EVs that can be purified using the binder. Scaffold moieties modified to more effectively target to the EV and / or the membrane can be used. Scaffold moieties modified to contain the minimal fragment required for specific and effective targeting to the exosomal membrane can also be used.

[0480] The scaffold moiety can be engineered to express as a fusion molecule, such as a fusion molecule of scaffold X and an ASO. For example, the fusion molecule can comprise a scaffold moiety linked to an ASO disclosed herein (e.g., scaffold X, e.g., PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, an ATP transporter, or a fragment or variant thereof).

[0481] In some aspects, scaffold X comprises a prostaglandin F2 receptor negative regulator (PTGFRN polypeptide). The PTGFRN protein can also be referred to as CD9 ligand 1 (CD9P-1), protein F containing Glu-Trp-Ile EWI motif (EWI-F), prostaglandin F2-α receptor regulatory protein, prostaglandin F2-α receptor-associated protein, or CD315. The full-length amino acid sequence of the human PTGFRN protein (Uniprot accession number Q9P2B2) is shown as SEQ ID NO:301 in Table 2. The PTGFRN polypeptide contains a signal peptide (amino acids 1 to 25 of SEQ ID NO:301), an extracellular domain (amino acids 26 to 832 of SEQ ID NO:301), a transmembrane domain (amino acids 833 to 853 of SEQ ID NO:301), and a cytoplasmic domain (amino acids 854 to 879 of SEQ ID NO:301). The mature PTGFRN polypeptide consists of SEQ ID NO:301 without the signal peptide, i.e., amino acids 26 to 879 of SEQ ID NO:301.

[0482] Table 2. Exemplary scaffold X protein sequences

[0483]

[0484]

[0485] IV.D. Targeting moiety

[0486] In some aspects, EVs, (e.g., exosomes), comprise a targeting moiety, such as an exogenous targeting moiety. In some aspects, the exogenous targeting moiety comprises a peptide, an antibody or an antigen-binding fragment thereof, a chemical compound, an RNA aptamer, or any combination thereof. In some aspects, the targeting moiety comprises a microprotein, a designed ankyrin repeat protein (darpin), an anticalin, an adnectin, an aptamer, a peptidomimetic molecule, a natural ligand of a receptor, a camelid nanobody, or any combination thereof. In some aspects, the exogenous targeting moiety comprises a full-length antibody, a single-domain antibody, a heavy-chain only antibody (VHH), a single-chain antibody, a shark heavy-chain only antibody (VNAR), a scFv, an Fv, a Fab, a Fab', an F(ab')2, or any combination thereof. In some aspects, the antibody is a single-chain antibody.

[0487] In some aspects, the targeting moiety targets the exosomes to the liver, heart, lung, brain, kidney, central nervous system, peripheral nervous system, muscle, bone, joint, skin, intestine, bladder, pancreas, lymph node, spleen, blood, bone marrow, or any combination thereof. In some aspects, the targeting moiety targets the exosomes to tumor cells, dendritic cells, T cells, B cells, macrophages, neurons, hepatocytes, Kupffer cells, myeloid cells (e.g., neutrophils, monocytes, macrophages, or MDSCs (e.g., monocytic MDSCs or granulocytic MDSCs)), hematopoietic stem cells, or any combination thereof.

[0488] In some aspects, the targeting moiety is linked to the EV (e.g., exosome) via a scaffold protein. In some aspects, the scaffold protein is any scaffold protein disclosed herein. In some aspects, the scaffold protein is Scaffold X. In some aspects, the scaffold protein is Scaffold Y.

[0489] IV.E. Connector

[0490] As described above, the extracellular vesicles (EVs) (e.g., exosomes and nanovesicles) of the present disclosure can include one or more linkers that link a molecule of interest (e.g., an ASO) to the EV (e.g., to the outer surface or the lumen surface). In some aspects, the ASO is linked to the EV directly or via a scaffold moiety (e.g., Scaffold X or Scaffold Y). In certain aspects, the ASO is linked to the scaffold moiety via a linker. In certain aspects, the ASO is linked to a second scaffold moiety via a linker.

[0491] In certain aspects, the ASO is linked to the outer surface of the exosome via Scaffold X. In additional aspects, the ASO is linked to the lumen surface of the exosome via Scaffold X or Scaffold Y. The linker can be any chemical moiety known in the art.

[0492] As used herein, the term "linker" refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence) or refers to a non-polypeptide (e.g., an alkyl chain). In some aspects, two or more linkers can be linked in series. When multiple linkers are present, each linker in the linker can be the same or different. Generally, the linker provides flexibility or prevents / improves steric hindrance. The linker is generally not cleaved; however, in certain aspects, such cleavage may be desirable. Thus, in some aspects, the linker can include one or more protease cleavage sites, and the one or more protease cleavage sites can be located within the sequence of the linker or flank the linker at either end of the linker sequence.

[0493] In some aspects, the linker is a peptide linker. In some aspects, the peptide linker can comprise at least about two, at least about three, at least about four, at least about five, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95 or at least about 100 amino acids. v

[0494] In some aspects, the peptide linker is synthetic, i.e., not naturally occurring. In one aspect, the peptide linker comprises a peptide (or polypeptide) (e.g., a natural or non-naturally occurring peptide) that contains an amino acid sequence that joins or genetically fuses a first linear sequence of amino acids to a second linear sequence of amino acids that is not naturally joined or genetically fused thereto. For example, in one aspect, the peptide linker can comprise a non-naturally occurring polypeptide that is a modified form of a naturally occurring polypeptide (e.g., containing mutations such as additions, substitutions or deletions).

[0495] The linker may be cleavable ("cleavable linker"), thereby facilitating the release of the bioactive molecule (e.g., ASO).

[0496] In some aspects, the linker is a "reduction-sensitive linker". In some aspects, the reduction-sensitive linker contains a disulfide bond. In some aspects, the linker is an "acid-labile linker". In some aspects, the acid-labile linker contains a hydrazone. Suitable acid-labile linkers also include, for example, cis-aconityl linkers, acylhydrazide linkers, thiocarbamoyl linkers or any combination thereof.

[0497] In some aspects, the linker comprises a non-cleavable linker.

[0498] In some aspects, the linker comprises acryloyl phosphoramidite (e.g., Acrydite TM ), adenylation, azide (NHS ester), digoxin (NHS ester), cholesterol-TEG, I-LINKER TM , amino modifiers (e.g., amino modifier C6, amino modifier C12, amino modifier C6 dT or Uni-Link TM amino modifier), alkyne, 5'-hexynyl, 5-octadiynyl dU, biotinylation (e.g., biotin, biotin (azide), biotin dT, biotin-TEG, dual biotin, PC biotin or desthiobiotin), thiol modification (thiol modifier C3 S-S, dithiol or thiol modifier C6 S-S) or any combination thereof.

[0499] In some aspects, the linker comprises terpenes such as nerolidol, farnesol, limonene, linalool, geraniol, carvone, fenchone, or menthol; lipids such as palmitic acid or myristic acid; cholesterol; oleyl; retinyl; cholesterol residue; cholic acid; adamantaneacetic acid; 1-pyrenebutanoic acid; dihydrotestosterone; 1,3-di-O-(hexadecyl)glycerol; geranyloxyhexyl; hexadecylglycerol; borneol; 1,3-propanediol; heptadecyl; O3-(oleoyl)lithocholic acid; O3-(oleoyl)chenodeoxycholic acid; dimethoxytriamine; phenoxazine, maleimide moiety, glucosidase type, CL2A-SN38 type, folic acid; carbohydrates; vitamin A; vitamin E; vitamin K, or any combination thereof.

[0500] IV.F. Engineered EVs Comprising a Tropism Moiety

[0501] In some aspects, the EVs (e.g., exosomes) disclosed herein can be surface-engineered to modulate their properties, e.g., biodistribution, e.g., by incorporating an immunoaffinity ligand or a cognate receptor ligand. For example, the EVs (e.g., exosomes) disclosed herein can be surface-engineered to direct them to specific cell types such as Schwann cells, sensory neurons, motor neurons, meningeal macrophages, or tumor cells, or can be surface-engineered to enhance their migration to specific compartments such as migration to the CNS (to improve intrathecal compartment retention) or migration to the tumor microenvironment.

[0502] In some aspects, the EVs (e.g., exosomes) comprise (i) an ASO disclosed herein and (ii) a biodistribution modifier or a targeting moiety. In some aspects, the biodistribution modifier or the targeting moiety comprises a single-domain antigen-binding moiety such as, e.g., VHH and / or vNAR. As used herein, the terms “biodistribution modifier” and “targeting moiety” are used interchangeably and refer to an agent capable of altering the distribution of extracellular vesicles (e.g., exosomes, nanovesicles) in vivo or in vitro (e.g., in a mixed culture of different types of cells). In some aspects, the targeting moiety alters the tropism of the EVs (e.g., exosomes), i.e., the targeting moiety is a “tropism moiety”. As used herein, the term “tropism moiety” refers to a targeting moiety that, when expressed on an EV (e.g., exosome), alters and / or enhances the natural movement of the EV. For example, in some aspects, the tropism moiety can promote the uptake of EVs (e.g., exosomes) by specific cells, tissues, or organs.

[0503] EVs (e.g., exosomes) exhibit preferential uptake in discrete cell types and tissues, and their tropism can be directed by adding proteins that interact with receptors on the surface of target cells to their surface. The tropic moiety can comprise biomolecules such as proteins, peptides, lipids, or carbohydrates, or synthetic molecules. For example, in some aspects, the tropic moiety can comprise an affinity ligand, e.g., an antibody (such as an anti-CD19 nanobody, anti-CD22 nanobody, anti-CLEC9A nanobody, or anti-CD3 nanobody), a VHH domain, a phage display peptide, a fibronectin domain, a camelid nanobody, and / or a vNAR. In some aspects, the tropic moiety can comprise, e.g., a synthetic polymer (e.g., PEG), a natural ligand / molecule (e.g., CD40L, albumin, CD47, CD24, CD55, CD59), and / or a recombinant protein (e.g., XTEN).

[0504] V. PD-1 antagonist;

[0505] Certain aspects of the present disclosure relate to methods of treating or preventing a disease or condition in a subject in need thereof, the method comprising administering to the subject (i) an extracellular vesicle comprising an ASO and (ii) a PD-1 antagonist. In some aspects, the PD-1 antagonist blocks or reduces PD-1 signaling. In certain aspects, the PD-1 antagonist inhibits the interaction between PD-1 and PD-L1. Any PD-1 antagonist can be used in the methods disclosed herein. In some aspects, the PD-1 antagonist comprises a polypeptide (e.g., an antibody, an antigen-binding portion of an antibody, a ligand, or any combination thereof), a small molecule, a nucleic acid molecule (e.g., miRNA, siRNA, an antisense oligonucleotide, or any combination thereof), or any combination thereof.

[0506] In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof that specifically binds to PD-1 (e.g., human PD-1). In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof that specifically binds to PD-L1 (e.g., human PD-L1). In some aspects, the PD-1 antagonist comprises an antibody or an antigen-binding portion thereof that specifically binds to PD-L2 (e.g., human PD-L2). Many therapeutic anti-PD-1 and anti-PD-L1 antibodies are known in the art, and any one or more of such antibodies are suitable for the methods disclosed herein. In some aspects, the anti-PD-1 antibody comprises an antibody selected from nivolumab, pembrolizumab, PDR001, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, GLS-010, AM-0001, STI-1110, AGEN2034, MGA012, IBI308, and any combination thereof. In some aspects, the anti-PD-1 antibody comprises nivolumab. In some aspects, the anti-PD-1 antibody comprises pembrolizumab. In some aspects, the anti-PD-1 antibody comprises PDR001. In some aspects, the anti-PD-1 antibody comprises MEDI-0680. In some aspects, the anti-PD-1 antibody comprises cemiplimab. In some aspects, the anti-PD-1 antibody comprises JS001. In some aspects, the anti-PD-1 antibody comprises BGB-A317. In some aspects, the anti-PD-1 antibody comprises INCSHR1210. In some aspects, the anti-PD-1 antibody comprises TSR-042. In some aspects, the anti-PD-1 antibody comprises GLS-010. In some aspects, the anti-PD-1 antibody comprises AM-0001. In some aspects, the anti-PD-1 antibody comprises STI-1110. In some aspects, the anti-PD-1 antibody comprises AGEN2034. In some aspects, the anti-PD-1 antibody comprises MGA012. In some aspects, the anti-PD-1 antibody comprises IBI308. In some aspects, the anti-PD-1 antibody comprises a bispecific antibody that comprises one or more anti-PD-1 antibodies listed herein.

[0507] In some aspects, the anti-PD-L1 antibody comprises an antibody selected from atezolizumab, durvalumab, avelumab, STI-1014, CX-072, KN035, LY3300054, CK-301, BMS-936559, and any combination thereof. In some aspects, the anti-PD-L1 antibody comprises atezolizumab. In some aspects, the anti-PD-L1 antibody comprises durvalumab. In some aspects, the anti-PD-L1 antibody comprises avelumab. In some aspects, the anti-PD-L1 antibody comprises STI-1014. In some aspec...

Claims

1. A method for preventing or treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a dose of one or more antisense oligonucleotides (ASOs) that target the STAT6 transcript, wherein each of the one or more ASOs comprises a continuous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg; wherein the ASO comprises the nucleotide sequence set forth in SEQ ID NO:185; and wherein the ASO has a design comprising LLLD 14 LLL, where L is LNA and D is DNA.

2. A method for increasing or enhancing an immune response in a subject in need thereof, which comprises administering to the subject a dose of one or more antisense oligonucleotides (ASOs) that target the STAT6 transcript, wherein each of the one or more ASOs comprises a continuous nucleotide sequence that is 10 to 30 nucleotides in length and that is complementary to a nucleic acid sequence within the STAT6 transcript; wherein the amount of the one or more ASOs in the dose is at least about 0.01 mg to at least about 240 mg; wherein the ASO comprises the nucleotide sequence set forth in SEQ ID NO:185; and wherein the ASO has a design comprising LLLD 14 LLL, where L is LNA and D is DNA.

3. The method according to claim 1 or 2, wherein each internucleoside bond in the ASO is a phosphorothioate bond.

4. The method according to claim 1 or 2, wherein each cytosine is 5'-methyl-cytosine.

5. The method according to any one of claims 1 to 4, wherein the ASO has a design comprising the following: 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3' where "lnN" represents a locked nucleic acid (LNA) of a specific nucleoside "N"; where "dN" represents a DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; and where "(s)" represents a phosphorothioate bond.

6. The method according to any one of claims 1 to 5, wherein the ASO has a design comprising the following: 5' GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3'; where "lnN" represents LNA of the specific nucleoside "N"; where "dN" represents DNA of the specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

7. The method according to any one of claims 1 to 6, wherein the ASO has a design comprising:

8. An antisense oligonucleotide (ASO) comprising the nucleotide sequence shown in SEQ ID NO: 185, wherein said ASO has a design comprising LLLD 14 LLL, where L is LNA and D is DNA.

9. The ASO according to claim 8, wherein each internucleoside bond in the ASO is a phosphorothioate bond.

10. The ASO according to claim 8 or 9, wherein each cytosine is 5'-methyl-cytosine.

11. The ASO according to any one of claims 8 to 10, wherein the ASO has a design comprising: 5'lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3' where "lnN" represents LNA of the specific nucleoside "N"; where "dN" represents DNA of the specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; and where "(s)" represents a phosphorothioate bond.

12. The ASO according to any one of claims 8 to 11, wherein the ASO has a design comprising: 5'GenChTEG-(o)-HEG-(o)-lnG-(s)-ln5MeC-(s)-lnA-(s)-dA-(s)-dG-(s)-dA-(s)-dT-(s)-d5MeC-(s)-d5MeC-(s)-d5MeC-(s)-dG-(s)-dG-(s)-dA-(s)-dT-(s)-dT-(s)-d5MeC-(s)-dG-(s)-lnG-(s)-ln5MeU-(s)-ln5MeC 3'; where "lnN" represents LNA of the specific nucleoside "N"; where "dN" represents the DNA of a specific nucleoside "N"; where "5MeC" represents 5-methyl-cytosine; where "5MeU" represents 5-methyl-uridine; where "(s)" represents a phosphorothioate bond; where "GenChTEG" represents tetraethylene glycol cholesteryl ester; and where "HEG" represents hexaethylene glycol.

13. The ASO according to any one of claims 8 to 12, wherein the ASO has a design comprising the following:

Citation Information

Patent Citations

  • Preparation of therapeutic exosomes using membrane proteins

    US10195290B1

  • Oral delivery of therapeutically effective LNA oligonucleotides

    US20120322851A1

  • Anti-PD1 Antibodies and their Use as Therapeutics and Diagnostics

    US20150079109A1

  • Churn.

    US677684A

  • Human monoclonal antibodies to programmed death ligand 1 (PD-L1)

    US7943743B2