Naringin and novel application of double-layer packaging compound of naringin

Abstract

The invention discloses novel application of naringin and a naringin double-layer packaging compound. The invention proves application of the naringin or the naringin double-layer packaging compound in preparation of cosmetics for inhibiting RAGE expression, enhancing glyoxal enzyme activity, inhibiting AGEs generation, inhibiting ROS generation or inhibiting melanin secretion. Wherein the naringin double-layer packaging compound is a naringin double-layer packaging compound based on double embedding of cyclodextrin and a biological membrane, the solubility and the stability of the naringin can be improved, the bioavailability can be enhanced, the irritation can be reduced, and the effect of the naringin double-layer packaging compound is obviously superior to that of single naringin.

Description

Technical Field

[0001] The present invention relates to a new use of naringin, in particular to a new use of naringin and its double-layer encapsulated complex. Background Art

[0002] Non-enzymatic glycation (NEG) is a process in which macromolecules with amino groups such as proteins and reducing sugars such as glucose undergo a series of complex reactions under non-enzymatic conditions to finally form irreversible advanced glycation end products (AGEs). During this process, oxidation reactions are involved in the glycosylation reaction, and at the same time, the glycosylation reaction promotes the occurrence of oxidation reactions. Therefore, some of the current methods for inhibiting glycosylation are achieved through antioxidant means.

[0003] The AGE-RAGE signaling pathway refers to a signal transduction pathway in which the glycosylation products (AGEs) of proteins caused by carbohydrates bind to their receptor (RAGE, receptor for advanced glycation end products), thereby triggering a series of reactions.

[0004] Naringin is a dihydroflavonoid glycoside or flavanone glycoside compound naturally present in plants of the Rutaceae family, mainly derived from the fruits of citrus fruits such as pomelo (Citrus grandis), as well as the peels and pulps of fruits such as grapefruit, tangerine, and orange. In current research, it has been found that the structure of naringin contains multiple aromatic hydroxyl groups, which are important sources of various biological effects of naringin such as antioxidant and anti-inflammatory effects, making naringin have strong free radical scavenging and antioxidant capabilities. It has strong scavenging capabilities for DPPH free radicals and hydroxyl free radicals, can inhibit the overexpression of ROS in human immortalized epidermal (HaCaT) cells caused by ultraviolet rays, improve the activities of antioxidant-related enzymes such as SOD and CAT in mouse skin, and activate the Nrf2 pathway to reduce oxidative damage in mouse skin tissues.

[0005] However, there is currently no research on naringin inhibiting the AGE-RAGE signaling pathway by inhibiting RAGE expression or enhancing glyoxalase activity to further achieve anti-glycation and antioxidant effects. Summary of the Invention

[0006] The purpose of the present invention is to provide a new use of naringin and its double-layer encapsulated complex. The present invention proves that naringin has the characteristics of inhibiting the expression of RAGE, AGEs, ROS, and melanin, and enhancing glyoxalase activity.

[0007] Technical solution of the present invention: A new use of naringin or a double-layer encapsulated complex of naringin, wherein the new use is the application of naringin or a double-layer encapsulated complex of naringin in the preparation of a cosmetic for inhibiting RAGE expression, enhancing glyoxalase activity, inhibiting AGEs generation, inhibiting ROS generation or inhibiting melanin secretion.

[0008] In the aforementioned new use, the cosmetic includes any one of lotion, essence, essential oil, lotion, milk, cream or mask.

[0009] In the aforementioned new use, the double-layer encapsulated complex of naringin is a double-layer encapsulated complex of naringin double-embedded by cyclodextrin and biofilm.

[0010] In the aforementioned new use, the mass content of naringin in the double-layer encapsulated complex of naringin is 0.1-10%, and the retention rate is ≥95% after storage at 4°C, 40°C or under light conditions for 4 weeks.

[0011] The present invention also discloses a cosmetic composition, which contains a double-layer encapsulated complex of naringin and also contains a cosmetically acceptable carrier or excipient.

[0012] In the aforementioned cosmetic composition, the added mass of the double-layer encapsulated complex of naringin is 0.01-5%, and the carrier includes glycerol, dipropylene glycol, water or a combination of at least two of them.

[0013] Compared with the prior art, the beneficial effects of the present invention are:

[0014] The present invention discloses that naringin has the effects of inhibiting the expression and activity of AGEs, RAGE, ROS, inhibiting melanin secretion, and enhancing the activity of glyoxalase in the skin, thereby playing an anti-glycation role.

[0015] Through research, it is found that dihydroflavonoid glycosides or flavanone glycoside compounds in Rutaceae plants also have the same efficacy.

[0016] The present invention also provides a double-layer encapsulated complex of naringin, which has the following characteristics:

[0017] 1. Improve solubility and stability: Through the inclusion of cyclodextrin and the action of the outer biofilm, the solubility and stability of naringin are significantly improved, reducing the oxidation, precipitation and degradation of naringin during storage and use;

[0018] 2. Enhance bioavailability: The encapsulation of the biofilm not only improves the biocompatibility of naringin, but also enhances the sustained-release effect of naringin, prolongs the action time of naringin on the skin, and improves the penetration performance and bioavailability of naringin;

[0019] 3. Reducing irritation: The double-layer encapsulation can effectively reduce the irritation of naringin to cells and reduce adverse reactions.

[0020] Therefore, the efficacy of the naringin double-layer encapsulation complex is significantly better than that of naringin alone, and it improves the solubility, stability and permeability of naringin, solves the problems of its easy oxidation, poor water solubility, high dissolution rate and low bioavailability, and broadens the application prospects of naringin in multiple fields such as medicine, food, and cosmetics. Description of the Drawings

[0021] Figure 1 It is the naringin skin release rate diagram of different samples.

[0022] Figure 2 It is the diagram of the influence of naringin and the naringin double-layer encapsulation complex on ROS reactive oxygen species.

[0023] Figure 3 It is the schematic diagram of the RAGE inhibition rate of different samples.

[0024] Figure 4 Diagram of the influence of the naringin double-layer encapsulation complex on GLO1 activity. Detailed Implementation Modes

[0025] The present invention will be further described below in conjunction with embodiments, but it is not used as a basis for limiting the present invention.

[0026] Embodiment 1:

[0027] A naringin double-layer encapsulation complex, the preparation method is as follows:

[0028] Step 1. Prepare cyclodextrin-naringin nanoparticles:

[0029] S1. Mix β-hydroxypropyl-cyclodextrin and naringin according to a mass ratio of 2:1, add 5 times the mass of glycerol-dipropylene glycol-aqueous solution (the volume ratio of glycerol: dipropylene glycol: water is 2:5:14) as a solvent for dissolution to obtain mixture A;

[0030] S2. Homogenize mixture A with an ultrasonic crushing homogenizer. The working power of the ultrasonic crushing homogenizer is 800 W, the running speed of the ultrasonic crushing homogenizer is 10,000 r / min, the homogenization time is 30 min, and the homogenization temperature is 40 °C to obtain mixture B;

[0031] S3. Homogenize mixture B 3 times with a high-pressure microfluidic homogenizer. The running pressure of the high-pressure microfluidic homogenizer is 40 MPa, and then freeze-dry it at -80 °C with a freeze dryer to remove the solvent to obtain cyclodextrin-naringin nanoparticles;

[0032] Step 2. Prepare biomembrane vesicles;

[0033] a. Inoculate the cultured stable Bacillus subtilis into a fermenter for fermentation culture. The composition of the Bacillus subtilis medium is as follows: 10 g / L peptone, 5 g / L beef extract powder, 8 g / L sodium chloride, 3 g / L inorganic salts, and the rest is water, with a pH of 6.0; the culture temperature of Bacillus subtilis is 40 °C; the inoculation amount of Bacillus subtilis is 5%; the culture rotation speed is 300 r / min; the culture time is 36 h to obtain a fermentation broth.

[0034] b. Filter the fermentation broth through a porous ceramic membrane with a pore size of 300 nm, with a feeding temperature of 35 °C and a feeding pressure of 5 bar; resuspend the retained bacteria with a phosphate buffer solution with a concentration of 0.03 M and a pH of 7.0, and the added mass of the phosphate buffer solution is 10 - 100 times that of the bacteria. Then, break it 3 times through a high-pressure homogenizer under the conditions of a pressure of 80 Mpa and a crushing temperature of 20 °C, and then centrifuge at a speed of 40000 g and a temperature of 3 °C. Take the supernatant and ultra-centrifuge it at a speed of 800000 g and a temperature of 2 °C. Finally, add a glycerol / water mixture (volume ratio of glycerol: water is 6:4) with a mass 100 times that of the precipitate to obtain biofilm vesicles.

[0035] Step Three: Prepare the naringin double-layer encapsulation complex:

[0036] S4. Mix the biofilm vesicles and cyclodextrin-naringin nanoparticles at a mass ratio of 4:1, put them into a granulator for ultrasonic granulation. The operating power of the granulator is 300 W, the granulation time is 1 h, and the granulation temperature is 40 °C to obtain mixture C.

[0037] S5. Homogenize mixture C through a high-pressure microfluidic homogenizer, with a homogenization pressure of 40 Mpa and a homogenization temperature of 25 °C, and cycle 2 times, and then extrude it under high pressure to obtain a homogenized solution; disperse the obtained homogenized solution in a glycerol / dipropylene glycol dispersion (mass ratio of glycerol: dipropylene glycol is 5:1) at a mass ratio of 1:10 to obtain the naringin double-layer encapsulation complex with double embedding based on cyclodextrin and biofilm.

[0038] Comparative Example 1:

[0039] A method for preparing a naringin liposome double-layer encapsulation complex is as follows:

[0040] 1. Mix 500 mL of water, 31.66 g of cyclodextrin, 10.29 g of phospholipid, 2.31 g of cholesterol, and 0.74 g of EDTA disodium, and stir at a speed of 400 r / min in a 50 °C water bath until the solution is clear and transparent. Then add 5.0 g of naringin and stir evenly to obtain a mixed solution.

[0041] 2. The mixed solution was homogenized by a high-pressure microfluidizer at a homogenization pressure of 25 MPa. After homogenization three times, the solution was collected and placed in a freeze dryer for freeze drying. The cold trap temperature was kept below -60°C and the vacuum degree was within 10 Pa. The solution was freeze-dried for 48 hours to obtain the naringin liposome encapsulation complex.

[0042] 1. Stability test:

[0043] The naringin, the complexes of Example 1 and Comparative Example 1 were placed at 4°C and 40°C under light conditions for stability tests, the naringin content was measured, and its retention rate was calculated. The test results are shown in Table 1.

[0044] Table 1. Stability results of naringin complexes

[0045]

[0046] The results showed that after four weeks of stability testing, the naringin double-layer encapsulation composite of Example 1 exhibited a naringin retention rate exceeding 95% at both 4°C and 40°C under light conditions, significantly higher than that of Comparative Example 1 and naringin. Therefore, the naringin double-layer encapsulation composite provided by the present invention can effectively improve the stability of naringin.

[0047] 2. Transdermal absorption experiment:

[0048] Naringin, Comparative Example 1, and Example 1 were used as the drugs for the diffusion cell. The skin of a 3-month-old piglet's back was removed, the hair and fat layer were removed, and the skin was repeatedly rinsed with clean water. The skin was cut into appropriate sizes and placed in physiological saline at 4°C for later use. The drug used in the diffusion cell was diluted with isotonic buffer to a concentration of 2 mg / mL and added in an amount of 2 mL. The receiving cell used 8 mL of isotonic phosphate buffer at pH = 7.4. The skin was placed between the two and clamped in the transdermal instrument. The naringin content in the receiving cell was measured regularly, and the skin permeation rate was calculated. The calculation results are shown in Figure 1 shown.

[0049] like Figure 1 As shown, compared with naringin and Comparative Example 1, the naringin double-layer encapsulation composite of Example 1 has a higher skin permeability, can more effectively penetrate the skin into the human body to exert its medicinal effect, and improve the bioavailability of naringin.

[0050] 3. AGEs expression inhibition experiment:

[0051] Experimental consumables and instruments: naringin (homemade), naringin double-layer encapsulation complex (homemade), BSA protein (≥98%, Aladdin), glucose (AR grade, Aladdin), sodium dihydrogen phosphate (AR grade, Aladdin), sodium hydrogen phosphate (AR grade, Aladdin), fluorescence microplate reader (Spark, Tecan Trading Company, Switzerland).

[0052] The experimental grouping is shown in Table 2 as follows:

[0053] Table 2. Grouping of AGEs generation inhibition experiment

[0054]

[0055] Note: The naringin content in the NA group and the WNA group is the same.

[0056] Experimental method: Prepare BSA (30 ppm) and glucose solution (300 ppm) with 0.2 mol / L phosphate buffer (PBS, pH = 7.4). Dilute the drug with PBS to the required concentration. In a laminar flow hood, filter BSA, glucose, and the drug solution to be tested through a 0.22 μm filter membrane respectively, and mix them in equal volumes as the sample group. Replace the drug to be tested with PBS as the blank control. Replace the glucose in the naringin group, Example 1 group, and blank control group with PBS as the corresponding negative control group for each group. Place each group in an incubator at 37°C for incubation. Fluorescent AGEs can be measured after a certain period of time (such as 7 days) as needed. Use a fluorescence microplate reader to measure the fluorescence value in the culture solution at the excitation / emission wavelength (ex / em) of 335 / 385 nm, and calculate the inhibition rate of the drug to be tested on fluorescent AGEs according to Equation (1).

[0057] Inhibition rate / % = (B1 - B0) * 100% / (A1 - A0), Equation (1);

[0058] Generation rate / % = 100% - Inhibition rate / %, Equation (2);

[0059] In Equation (1): A1 is the fluorescence value of the blank control group; A0 is the fluorescence value of the group containing only BSA; B1 is the fluorescence value of the sample group; B0 is the fluorescence value of the corresponding negative control group added with the drug to be tested.

[0060] The experimental results are shown in Table 3 as follows:

[0061] Table 3. Effects of naringin and naringin double-layer encapsulated complex on AGEs generation rate

[0062] Group Blank control group Naringin group Example 1 group Relative production rate (%) 100.00 <![CDATA[81.26 ** > <![CDATA[67.38 ## > Inhibition rate (%) 0 18.74 32.62 Standard deviation (%) 5.92 3.44 6.01

[0063] SPSS statistical software was used to analyze the data in the experiment. The results are expressed as mean ± standard deviation (X ± SD). One-way ANOVA was used for comparison between groups. *, p < 0.05 indicates significant difference, **, p < 0.01, n = 3, compared with the blank control; ##, p < 0.01, n = 3, compared with the naringin group; NS, no significance.

[0064] The results showed that the inhibition rates of the naringin group and the Example 1 group on the relative formation rate of AGEs were 18.74% (**p<0.01) and 32.62% (**p<0.01), respectively. The Example 1 group had a significantly better inhibition rate on the relative formation rate of AGEs than the naringin group, with the inhibition rate increasing by 13.88% (##p<0.01). This indicates that naringin and the naringin double-layer encapsulation complex have a strong inhibitory effect on the glycation reaction of fibroblasts induced by glyoxal, exhibiting anti-glycation efficacy, and that the naringin double-layer encapsulation complex has a superior effect.

[0065] IV. RAGE expression inhibition experiment:

[0066] Experimental instruments and reagents: high-precision spectrophotometer (Merinton SMA4000); microplate reader (CMax Plus, Meigu Molecular Instruments (Shanghai) Co., Ltd.); quantitative PCR instrument (CFX connect Real-Time PCR System), and the supporting analysis software is BIO-RAD CFX Manager.

[0067] A375 cell line (human melanoma cells, purchased from Prenocell), DMEM basal medium (purchased from Prenocell), special grade fetal bovine serum (purchased from Prenocell), penicillin-streptomycin solution (×100, purchased from Prenocell), AGEs (glucose-BSA, homemade), thiazolyl blue (MTT) (purchased from Aladdin), naringin, the naringin double-layer encapsulation complex of Example 1, high-purity total RNA rapid extraction kit (purchased from Generay), reverse transcription kit HiScript-IIQ RT SuperMix for qPCR (purchased from Vazyme), qPCR reagent ChamQ SYBR Color qPCR Master Mix (purchased from Vazyme), and experimental primers were synthesized and purified by Shanghai Sunny Biotechnology Co., Ltd.

[0068] The experimental groups are shown in Table 4:

[0069] Table 4. RAGE expression experimental groups

[0070]

[0071] Note: The naringin content in the naringin group is the same as that in the Example 1 group.

[0072] 4.1A375 cytotoxicity test experiment:

[0073] MTT cytotoxicity test grouping and concentration gradient: calibration group, blank group (blank medium), naringin group (0.0005%, 0.001%, 0.002%, 0.004%, 0.005%, 0.008%) (m / m), naringin double-layer encapsulation complex group of Example 1 (0.01%, 0.02%, 0.04%, 0.08%, 0.1%, 0.16%) (m / m).

[0074] Experimental method: Passage A375 cells to a T25 cell culture flask until the culture density reaches over 80%, digest with trypsin, centrifuge to collect cells, resuspend with cell culture medium, and dilute it with the medium to 1×10 5 cells / mL. Add the medium containing 1×10 5 cells / mL of A375 cells evenly into a 96-well plate, 100 μL per well, and continue to culture in a cell incubator at 37 °C and 5% CO2 for 24 h; discard the original medium in the 96-well plate, add 100 μL of blank medium to each well in the blank group, and set 5 parallel replicates; for the naringin group and the naringin double-layer encapsulation complex group, add the corresponding diluted gradient concentration medium containing naringin or naringin double-layer encapsulation complex to each well, and set 5 parallel replicates for each concentration; add 100 μL of PBS to the wells without cells in the calibration group and set 5 parallel replicates; continue to culture for 24 h.

[0075] After completion, discard the original medium, wash each well 3 times with PBS, add 120 μL of 1 mg / mL MTT diluted with the medium to each well, and continue to culture for 6 h; after completion, discard the original medium in the 96-well plate, wash each well three times with PBS, add 150 μL of DMSO to each well, fully dissolve the crystals, and detect the OD 490nm to calculate the cell survival rate.

[0076]

[0077] In formula (3), Ax: absorbance at 490 nm of the well incubated with naringin or naringin double-layer encapsulation complex; A: absorbance at 490 nm of the calibration well; A0: absorbance at 490 nm of the blank well.

[0078] The results of the cytotoxicity experiment are shown in Tables 5 and 6.

[0079] Table 5. Effects of naringin on the viability of A375 cells

[0080]

[0081] Table 6. Effects of naringin on the viability of A375 cells

[0082]

[0083] According to the results of cytotoxicity experiments, at all experimental concentrations, naringin and the naringin double-layer encapsulation complex of Example 1 had a certain growth-promoting effect on the cell viability of A375 cells. In summary, for subsequent experiments, the experimental concentrations were selected as naringin 0.005% (m / m) and the naringin double-layer encapsulation complex 0.1% (m / m).

[0084] 4.2 RAGE relative expression inhibition experiment:

[0085] Digest and passage A375 cells into a 60 mm cell-specific culture dish, and culture them in a cell incubator at 37 °C and 5% CO2 until the density reaches over 70%. Add cell culture medium containing 0.01% (m / m) AGEs to each group and culture for 24 h to construct a glycosylation model; after completion, discard the original culture medium, wash three times with PBS respectively, and add cell culture medium containing 0.005% (m / m) naringin and 0.1% (m / m) naringin double-layer encapsulation complex respectively, and continue to culture in a cell incubator at 37 °C and 5% CO2 for 24 h. After completion, digest the cells with trypsin, collect the cells, and resuspend and wash three times with PBS.

[0086] Extract total RNA from the samples by the Trizol-centrifugal column method: Digest and collect 1 - 5×10 7 cells, transfer them into a 1.5 ml centrifuge tube, add 1 ml of Trizol, mix well, and let stand at room temperature for 5 min. Add 200 μL of chloroform, shake vigorously for 30 s, and let stand at room temperature for 3 - 5 min; centrifuge at 12000 rpm for 10 min at 4 °C; aspirate the upper aqueous phase into another centrifuge tube, add 200 μL of absolute ethanol, and mix well; transfer all the above solutions (including the precipitate) to the Gen Clean column placed in a 2 mL collection tube, let stand at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min; discard the waste liquid, add 600 μL of BufferRWA, centrifuge at 12000 rpm at room temperature for 30 s; discard the waste liquid, put the column back into the collection tube, and centrifuge at 12000 rpm at room temperature for 1 min; transfer the column to a RNase-free 1.5 mL centrifuge tube, carefully add 30 μL of DEPC-H2O to the center of the column membrane, place at 55 - 80 °C for 2 minutes; centrifuge at 12000 rpm at room temperature for 1 min. (H2O, TE or 0.5% SDS must be treated with DEPC and autoclaved).

[0087] Determination of RNA purity and quantification of RNA: Using the corresponding solvent as a control, take 2 μL of the RNA solution and detect it with Merinton SMA4000, observe the ratios of A260 / A280, A260 / A230 and the continuous wavelength absorption peak, and calculate the concentration of the RNA solution to judge the quality of RNA extraction: if A260 / A280 > 2.0 and < 2.3, it can meet the requirements for subsequent RT-qPCR.

[0088] Prepare the RT reaction solution according to the following components (on ice): 5× II qRT SuperMix 4 μL; Total RNA ≤ 1000 ng; RNase Free dH2O up to 20 μL. Mix well, centrifuge briefly, incubate in a dry bath at 50 °C for 15 min; terminate the reaction at 85 °C for 2 min; store the cDNA at -20 °C.

[0089] Fluorescent quantitative PCR amplification: The primer sequences are shown in Table 7 below:

[0090] Table 7. Primer sequences

[0091] Primer name Primer sequence (5'→3') Number of bases HomoGAPDHF GGAGCGAGATCCCTCCAAAAT 21 HomoGAPDHR GGCTGTTGTCATACTTCTCATGG 23 HomoRAGEF ACGGCTGGTGTTCCCAATAA 20 HomoRAGER TGTTCCTTCACAGATACTCCCTTC 24

[0092] PCR amplification reaction system: 2×ChamQ SYBR Color qPCR Master Mix, 10 μL; forward primer, 10 μM × 0.6 μL; reverse primer, 10 μM × 0.6 μL; Template cDNA, 8.8 μL; ddH2O, up to 20 μL.

[0093] qPCR experimental parameters: 1: 95.0 °C, 30 s; 2: 95.0 °C, 10 s; 3: 60.0 °C, 30 s Plate Read; 4: GOTO 2, 40 cycles; 5: Melting curve 70 °C to 95 °C: Increment 0.5 °C for 5 s Plate Read.

[0094] Using GAPDH as the internal reference and RAGE as the target gene, use the 2 -ΔΔCt method to calculate the relative expression levels of the RAGE gene in each group.

[0095] Relative expression level of RAGE

[0096] In Equation (4), R: Relative expression level of RAGE in the model group; Rn: Relative expression levels of RAGE in the naringin group and Example 1 group.

[0097] The experiments used SPSS statistical software to analyze the data. The results are expressed as mean ± standard deviation (X ± SD). One-way ANOVA was used for comparison between groups. *, p < 0.05 indicates significant difference, **, p < 0.01, n = 3, compared with the blank control; #, p < 0.05, n = 3, ##, p < 0.01, compared with the model group; NS, no significance.

[0098] The test results of the relative expression level of RAGE are shown in Table 8 and Figure 3 as follows:

[0099] Table 8. Test results of relative RAGE expression

[0100]

[0101]

[0102] Note: The naringin content in the naringin group and the Example 1 group is the same.

[0103] Compared with the blank control group, the relative RAGE expression in the model group increased significantly (**p < 0.01), indicating that the stimulation conditions were effective; compared with the model group, the relative RAGE expression in the 0.005% (m / m) naringin group decreased significantly, with a decrease rate of 27.19% (#p < 0.05); compared with the model group, the relative RAGE expression in the 0.1% (m / m) Example 1 group decreased significantly, with a decrease rate of 32.69% (#p < 0.05).

[0104] It shows that both the sample naringin and the naringin double-layer encapsulation complex have the effect of inhibiting RAGE expression, and the inhibitory effect of the naringin double-layer encapsulation complex is better than that of naringin.

[0105] V. ROS expression inhibition experiment:

[0106] Experimental consumables and instruments: 60 mm cell culture dishes (NEST), human dermal fibroblasts HDF (Cell Bank of the Chinese Academy of Sciences), ROS reactive oxygen species kit (Beyotime), PBS (cell culture grade, purchased from Biosharp), complete medium for dermal fibroblasts (purchased from Wuhan Punosai Biotechnology Co., Ltd.), naringin (self-made), naringin double-layer encapsulation complex of Example 1 (self-made), AGEs (self-made), glucose (Aladdin), BSA protein (≥95%, purchased from Aladdin), fluorescence inverted microscope (ICX41, Sunny Optical Technology (Group) Co., Ltd.).

[0107] 5.1 HDF cell toxicity test:

[0108] MTT cell toxicity test grouping and concentration gradient: calibration group, blank group (blank medium), naringin (10 ppm, 20 ppm, 40 ppm, 80 ppm, 160 ppm), naringin double-layer encapsulation complex of Example 1 (200 ppm, 400 ppm, 800 ppm, 1600 ppm, 3200 ppm);

[0109] Passage human dermal fibroblasts to a T25 cell culture flask until the culture density reaches more than 80%, digest with trypsin, centrifuge to collect cells, resuspend with cell medium, and dilute to a cell number of 1×10 5 cells / mL; the cell number of 1×10 5Add the medium at a concentration of

[0110] After completion, discard the original medium, wash each well 3 times with PBS, add 120 μL of 1 mg / mL MTT diluted with the medium to each well, and continue culturing for 6 h; after completion, discard the original medium in the 96-well plate, wash each well three times with PBS, add 150 μL of DMSO to each well, dissolve the crystals thoroughly, and detect the OD with an ELISA reader. 490nm , and calculate the cell survival rate according to Equation (3).

[0111] The results of the cytotoxicity experiment are shown in Tables 9 and 10.

[0112] Table 9. Effects of Naringin on the Survival Rate of Human Dermal Fibroblasts

[0113] Naringin concentration (ppm) 10 20 40 80 160 Cell survival rate (%) 112.02 112.19 115.43 114.11 110.55 Standard deviation (%) 8.55 3.62 6.58 6.62 11.5

[0114] Table 10. Effects of Naringin Double-Layer Encapsulation Complex on the Survival Rate of Human Dermal Fibroblasts

[0115] Naringin double-layer encapsulated complex concentration (ppm) 200 400 800 1600 3200 Cell survival rate (%) 111.27 105.64 108.32 115.90 107.51 Standard deviation (%) 5.30 3.31 7.14 7.09 7.25

[0116] According to the results of the cytotoxicity experiment, when the added concentration of naringin is 10 ppm - 160 ppm and the added concentration of naringin double-layer encapsulation complex is 200 ppm - 3200 ppm, it has a certain growth promotion effect on the cell viability of human dermal fibroblasts. In summary, select 50 ppm for the naringin concentration and 1000 ppm for the naringin double-layer encapsulation complex concentration for subsequent experiments.

[0117] 5.2 ROS Reactive Oxygen Species Experiment:

[0118] The experimental groups are shown in Table 11.

[0119] Table 11. ROS Reactive Oxygen Species Experiment Grouping

[0120]

[0121]

[0122] Human dermal fibroblasts (HDF cells) were used in the experiment. The HDF cells were cultured and passaged normally. When the growth density reached over 80%, they were digested and centrifuged to collect the cells. The cells were plated in a confocal bottom cell culture dish and continued to be cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. For the above cell culture dishes, the original culture medium was discarded, and the cells were washed three times with PBS. Then, the HDF cell culture medium containing 100 ppm AGEs was added to each dish and cultured for another 24 h to construct a glycosylation model. For the above cell culture dishes, the original culture medium was discarded, and the cells were washed three times with PBS. Then, naringin and naringin double-layer encapsulation complexes with a concentration gradient were added to each dish. After the above cell culture was completed, the DCFH-DA fluorescent probe was diluted by an appropriate multiple with serum-free medium. 1 mL of serum-free medium containing DCFH-DA was added to each dish of cells, and they were cultured in an incubator for 20 - 30 min. After that, they were washed three times with PBS for 3 min each time. Confocal fluorescence microscopy was used to observe and take cell fluorescence photos at an excitation wavelength of 488 nm. The fluorescence intensity was positively correlated with the intracellular ROS level of the cells. The experimental result images were processed using Image-J, and semi-quantitative analysis was performed on each group.

[0123] The effects of naringin and naringin double-layer encapsulation complexes on ROS are shown in Figure 2 and Table 12.

[0124] Table 12. Relative fluorescence intensity of naringin and naringin double-layer encapsulation complexes - ROS

[0125] Group Blank control AGEs NA WNA Relative fluorescence intensity 1.000 <![CDATA[3.686 ** > <![CDATA[1.434 ## > <![CDATA[1.063 ## > Standard deviation (%) 7.06 14.29 4.92 2.01

[0126] SPSS statistical software was used to analyze the data in the experiment. The results were expressed as mean ± standard deviation (X ± SD). One-way ANOVA was used for comparison between groups. p < 0.05 indicated significant differences, **, p < 0.01, n = 3, compared with the blank control; ##, p < 0.01, n = 3, compared with the model group; NS, no significance.

[0127] It can be seen from Figure 2 and Table 12 that the ROS fluorescence intensity in the AGEs group was significantly higher than that in the blank control group, with an increase rate of 268.6% (**p < 0.01). The ROS fluorescence intensity in the naringin group and the naringin double-layer encapsulation complex group was significantly lower than that in the AGEs group, with a decrease of 61.10% (##p < 0.01) and 71.16% (##p < 0.01) respectively. This indicates that naringin and naringin double-layer encapsulation complexes have an inhibitory effect on the secretion of ROS in human dermal fibroblasts induced by AGEs glycosylation damage, and the effect of the naringin double-layer encapsulation complex group is significantly better than that of the naringin group, with a 10.06% improvement in the inhibitory effect on ROS.

[0128] VI. Melanin expression inhibition test:

[0129] Experimental consumables and instruments: naringin (homemade), naringin double-layer encapsulation complex of Example 1 (homemade), 60 mm cell culture dish (NEST), 1640 cell culture medium (purchased from Gibco), DMEM cell culture medium (purchased from Gibco), trypsin (Biyuntian), PBS buffer (cell culture grade, purchased from biosharp), premium fetal bovine serum purchased from Wuhan Punuosai Biotechnology Co., Ltd.), microplate reader (CMax Plus, Meigu Molecular Instruments (Shanghai) Co., Ltd., USA), cell lysate (Biyuntian), B16 melanocytes (Cell Bank, Chinese Academy of Sciences).

[0130] 6.1B16 Cytotoxicity Test Experiment:

[0131] MTT cytotoxicity test groups and concentration gradient: calibration group, blank group (blank culture medium), naringin (10 ppm, 20 ppm, 40 ppm, 80 ppm, 160 ppm), naringin double-layer encapsulation complex (200 ppm, 400 ppm, 800 ppm, 1600 ppm, 3200 ppm);

[0132] B16 melanocytes were passaged into T25 cell culture flasks and cultured to a density of more than 80%. The cells were digested with trypsin, collected by centrifugation, resuspended in cell culture medium, and diluted to a cell count of 1×10 5 cells / mL; the cell count was 1×10 5 Cells were uniformly added to a 96-well plate at a concentration of 100 μL / mL. 100 μL of culture medium was added to each well of the plate and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. The original culture medium of the 96-well plate was discarded. 100 μL of blank culture medium was added to each well of the blank group, and five replicate wells were set up. A gradient concentration of culture medium containing naringin was added to each well of the naringin group. A gradient concentration of culture medium containing the naringin double-layer encapsulation complex was added to each well of the naringin double-layer encapsulation complex group, and five replicate wells were set up for each concentration. 100 μL of PBS was added to the cell-free wells of the correction group, and five replicate wells were set up for 24 h.

[0133] After the incubation, discard the original culture medium, wash each well with PBS three times, add 120 μL of 1 mg / mL MTT diluted in culture medium to each well, and continue incubation for 6 h. After the incubation, discard the original culture medium of the 96-well plate, wash each well with PBS three times, add 150 μL of DMSO to each well to fully dissolve the crystals, and detect the OD value with a microplate reader. 490nm , the cell survival rate was calculated according to formula (3).

[0134] The results of the cytotoxicity experiments are shown in Tables 13 and 14.

[0135] Table 13. Effect of naringin on the survival rate of B16 melanocytes

[0136] Naringin concentration (ppm) 10 20 40 80 160 Cell survival rate (%) 104.15 103.62 102.22 103.46 96.14 Standard deviation (%) 2.89 2.62 5.86 3.58 2.10

[0137] Table 14. Effect of Naringin Double-Layer Encapsulation Complex on the Survival Rate of B16 Melanocytes

[0138] Naringin double-layer encapsulated complex concentration (ppm) 200 400 800 1600 3200 Cell survival rate (%) 106.59 105.24 102.61 101.22 94.62 Standard deviation (%) 3.63 2.59 2.96 4.86 4.02

[0139] According to the results of the cytotoxicity experiment, when the addition amount of naringin was 10 ppm - 80 ppm and the addition concentration of naringin double-layer encapsulation complex was 200 ppm - 1600 ppm, no inhibitory effect on the growth rate of B16 melanocytes was observed. When the addition concentration of naringin reached 160 ppm, the survival rate of B16 cells decreased to 96.14%; when the addition concentration of naringin double-layer encapsulation complex reached 3200 ppm, the survival rate of B16 cells decreased to 94.62%. In summary, 50 ppm of naringin concentration and 1000 ppm of naringin double-layer encapsulation complex concentration were selected for subsequent experiments.

[0140] 6.2 Melanin Content Test Experiment:

[0141] The experimental grouping is shown in Table 15:

[0142] Table 15. Grouping of Melanin Secretion Inhibition Experiment

[0143]

[0144] Note: The naringin content in the NA group and the WNA group is the same.

[0145] Experimental method: Culture B16 melanoma cells in 1640 medium until the density exceeds 80%, passage them into 60-mm culture dishes, and continue to culture until the density reaches 70%. A total of four groups were set up in the experiment, namely the blank control group, the AGEs group, the naringin (NA) group, and the naringin double-encapsulated complex (WNA) group, with 3 parallels in each group. Take the above cell culture dishes, discard the original medium, wash them three times with PBS. Add DMEM medium containing 50 ppm naringin to each dish in the naringin group, and add DMEM medium containing 1000 ppm naringin double-encapsulated complex to each dish in the naringin double-encapsulated complex group, and continue to culture for 24 h. Replace the blank DMEM medium in the blank control group and the AGEs group. After completion, replace the DMEM medium containing 100 ppm AGEs in the naringin group, the naringin double-encapsulated complex group, and the AGEs group respectively, and continue to culture for 24 h. After the above cell culture is completed, wash them three times with PBS, digest with trypsin, centrifuge and collect the cells into a 2-mL centrifuge tube, resuspend and wash them three times with PBS, centrifuge, and collect the cell precipitate. Add 0.3 mL of cell lysate to each centrifuge tube, vortex slightly to fully dissolve the melanin in the cells. Take 150 μL of each of the above solutions and place them in a 96-well culture plate, and detect the absorbance of each well at 490 nm with an enzyme-labeling instrument. The melanin content is positively correlated with the absorbance value, and calculate the melanin secretion inhibition rate according to formula (5).

[0146]

[0147] In formula (5): B: Relative melanin secretion amount in the AGEs group; Bx: Relative melanin secretion amount in the NA group or the WNA group;

[0148] The results of B16 cell melanin secretion are shown in Table 16.

[0149] Table 16. Relative melanin secretion amount of B16 melanoma cells

[0150] Group Blank control AGEs NA WNA Relative secretion amount 1.000 1.352* <![CDATA[1.073 ## > <![CDATA[0.915 ## > Standard deviation (%) 6.50 9.42 7.11 4.91 Secretion inhibition rate (%) / / 20.64 32.32

[0151] SPSS statistical software was used to analyze the data in the experiment. The results are expressed as mean ± standard deviation (X±SD). One-way ANOVA was used for comparison between groups. *, p < 0.05, n = 3, compared with the blank control; ##, p < 0.01, n = 3, compared with the model group; NS, no significance.

[0152] As can be seen from Table 16, the relative melanin secretion levels of B16 cells in the blank control group, AGEs group, naringin group, and naringin double-layer encapsulation complex group were 1.000, 1.352, 1.073, and 0.915, respectively. Compared with the blank control group, the melanin secretion level in the AGEs group was significantly increased, with a promotion rate of 35.2% (*p < 0.05). The melanin secretion levels in the naringin group and naringin double-layer encapsulation complex group were significantly lower than that in the AGEs group. The inhibition rate in the naringin group was 20.64% (##p < 0.01), and the inhibition rate in the naringin double-layer encapsulation complex group was 32.32% (##p < 0.01). The inhibition rate of the naringin double-layer encapsulation complex group on melanin secretion by melanocytes was significantly higher than that of the naringin group, with an improvement of 11.68%. This indicates that naringin has a significant inhibitory effect on the melanin secretion-related pathway activated by AGEs, and naringin and naringin double-layer encapsulation complex can significantly inhibit melanin secretion by B16 cells, achieving the effects of anti-glycation and whitening.

[0153] VII. Experiment on glyoxalase 1 (GLO1) detoxification system:

[0154] Experimental instruments and reagents: 3D epidermal model Skinovo (JenoFly), epidermal model culture medium (JenoFly), cell expansion system (JenoFly), cell incubator (Thermo), multi-functional microplate reader (ThermoFisher), methylglyoxal (Sigma-Aldrich), glyoxalase 1 activity detection kit (Sigma-Aldrich).

[0155] The experimental grouping is shown in Table 17:

[0156] Table 17. Experimental grouping of GLO1 detoxification system

[0157]

[0158] Test method: Conduct the experiment according to Table 17. Culture in a culture medium containing 5 mmol / L MGO at 37°C, 5% CO2, and 95% humidity. At the end of the time action, take out 3 epidermal models from each group, and detect the GLO1 activity after lysis.

[0159] GLO1 Activity Detection Method: Prepare 2 EP tubes for each epidermal model, denoted as the detection tube and the blank tube respectively. Add 40 μL of model lysate to the detection tube and the blank tube respectively. Add 160 μL of detection working solution to each test tube and incubate at room temperature for 20 min. Add 70 μL of 4 mol / L perchloric acid solution to each blank tube, vortex and mix well, and then incubate on ice for 15 min. Add 70 μL of 4 mol / L perchloric acid solution to each test tube, vortex and mix well, and then incubate on ice for 15 min. Add 160 μL of detection working solution to each blank tube, vortex and mix well, and then incubate on ice for 15 min. Centrifuge at 14000 rpm for 5 min, take 200 μL of the clarified supernatant and add it to a 96-well plate, and read the OD 240 . Calculate the GLO1 enzyme activity of each well according to formula (6).

[0160] Enzyme activity = 175 × [(OD 240 ) of the detection tube - (OD 240 ) of the blank tube] × 1.35 units / L, formula (6).

[0161] The test results are shown in Table 18 and Figure 4 as follows.

[0162] Table 18. GLO1 Enzyme Activity Detection Results

[0163]

[0164] The data of the experiment were analyzed using SPSS statistical software. The results were expressed as mean ± standard deviation (X ± SD). One-way ANOVA was used for comparison between groups. *, p < 0.05 indicated significant difference, **, p < 0.01, n = 3, compared with the blank group; ##, p < 0.01, n = 3, compared with the model group; NS, no significance.

[0165] The experimental results showed that the GLO1 activity of the 3D epidermal model treated with MGO was significantly decreased compared with that of the blank group (**p < 0.01), indicating that the model was successfully established. It could be seen from the positive control group that the standard drug aminoguanidine could significantly improve the GLO1 enzyme activity, and the improvement rate was 172.5% (##p < 0.01). The data of the naringenin group showed that naringenin had a significant effect on improving the GLO1 enzyme activity, and the improvement rate was 433.8% (##p < 0.01), which was significantly better than that of the positive control, indicating that naringenin could enhance the GLO1 enzyme activity in the skin and thus reduce the accumulation of AGEs.

[0166] It should be understood that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. For those skilled in the art, the technical solutions described in the above embodiments can be modified, or some of the technical features can be equivalently replaced; and all such modifications and replacements should fall within the protection scope of the appended claims of the present invention.

Claims

1. A new use of naringin or a double-layer encapsulated complex of naringin, characterized in that: The new use is the application of naringin or the double-layer encapsulated complex of naringin in the preparation of cosmetics for inhibiting the expression of RAGE, enhancing the activity of glyoxalase, inhibiting the generation of AGEs, inhibiting the generation of ROS or inhibiting the secretion of melanin.

2. The new use according to claim 1, characterized in that: The cosmetics include any one of lotion, essence, essential oil, lotion, milk, cream or mask.

3. The new use according to claim 1, characterized in that: The double-layer encapsulated complex of naringin is a double-layer encapsulated complex of naringin double-embedded by cyclodextrin and biomembrane.

4. The new use according to claim 1, wherein: The mass content of naringin in the double-layer encapsulated complex of naringin is 0.1-10%, and the retention rate is ≥95% after storage at 4°C, 40°C or under light conditions for 4 weeks.

5. A cosmetic composition, characterized in that: The double-layer encapsulated complex of naringin described in any one of claims 1-4 is included, and a cosmetically acceptable carrier or excipient is also included.

6. The cosmetic composition according to claim 5, characterized in that: The added mass of the double-layer encapsulated complex of naringin in the cosmetic composition is 0.01-5%, and the carrier includes glycerol, dipropylene glycol, water or a combination of at least two of them.

Images