Heart patch containing tendon protein C as well as preparation method and application of heart patch

Through the combined application of tenin C cardiac patch and AAV9-cTNT-YAP5SA-GFP virus, local inhibition of YAP signal during adult heart regeneration is achieved, and the problem of myocardial regeneration caused by uncontrolled activation of YAP signal is solved, ensuring the controllability and safety of the heart regeneration process.

CN120392974AActive Publication Date: 2025-08-01SHANGHAI EAST HOSPITAL EAST HOSPITAL TONGJI UNIV SCHOOL OF MEDICINE
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510601565.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2025-08-01
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

There is a lack of effective methods in the prior art to prevent uncontrolled activation of YAP signals during activation of adult heart regeneration, leading to uncontrolled myocardial regeneration and abnormal cardiac enlargement or death.

Method used

The cardiac patch of tenin C was used to prepare a mixture carrier of polylactic acid-caprolactone copolymer and chitosan by electrospinning technology, loading tenin C recombinant protein, local administration inhibits the YAP signaling pathway, and combining AAV9-cTNT-YAP5SA-GFP virus to activate myocardial regeneration to achieve controlled myocardial regeneration.

Benefits of technology

Effectively control the proliferation rate of cardiomyocytes and the scale of cardiac regeneration, avoid abnormal proliferation of myocardial tissue, reduce the risk of abnormal cardiac enlargement and death, and improve the safety and targeting of myocardial regeneration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120392974A_ABST
    Figure CN120392974A_ABST
Patent Text Reader

Abstract

The invention provides application of tendon protein C in preparation of a medicine for promoting controllable regeneration or myocardial repair of myocardium. The invention also provides a heart patch which contains the tendon protein C. The invention also provides a preparation method of the heart patch. The invention also provides application of the heart patch in preparation of a medicine for preventing controllable regeneration or myocardial repair. By applying the method, the safety of myocardial regeneration can be improved, and the burden of the body caused by excessive increase of the heart is avoided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and relates to a patch, specifically a cardiac patch containing tenascin C, and its preparation method and use. Background Art

[0002] The number of patients with cardiovascular diseases shows a sharp growth trend, bringing a heavy burden to the public health system (PMID: 31746111). Adult mammalian cardiomyocytes are terminally differentiated cells with extremely limited proliferation ability. Dead cardiomyocytes are difficult to be effectively replenished, resulting in the permanent loss of myocardial functional units, and ultimately leading to the occurrence and development of heart failure (PMID: 31587963).

[0003] Existing clinical diagnosis and treatment and disease management measures have not fundamentally solved the core problems of insufficient cardiomyocyte quantity and functional failure in heart failure (PMID: 34794691). By reactivating the proliferation of cardiomyocytes, a powerful myocardial regeneration process can be initiated, and the regenerated myocardium can completely replace the damaged myocardial tissue (PMID: 31120819). Hippo / YAP (Yes-associated protein) plays a key role in regulating heart development and cardiomyocyte proliferation (PMID: 25313964; PMID: 31511517; PMID: 29727635). Activating YAP activity can extend the myocardial regeneration window to adulthood and initiate the proliferation and regeneration of adult cardiomyocytes (PMID: 28581498). However, over-activation of YAP has potential risks, which may lead to abnormal enlargement of the heart volume and death (PMID: 30773489). But YAP activity decreases when spatially restricted, thereby preventing excessive proliferation of organ parenchymal cells and maintaining the normal size of the organ (PMID: 37339629). Therefore, there is an urgent need for a safe and feasible strategy to effectively achieve spatial constraint of YAP activity while based on myocardial regeneration and repair caused by YAP activation, so as to achieve controllable heart regeneration. Currently, there is no mature method to prevent the out-of-control activation of YAP signals under the premise of activating adult heart regeneration. The present invention precisely proposes a solution to this technical gap.

[0004] Tenascin-C is a 1.5 million Dalton large hexameric protein. Each chain contains different domains, including an assembly domain (TA), EGF-like repeats (EGF-L), fibronectin type III-like repeats (TNIII), and fibrinogen-like globules (FBG). Tenascin C (TNC) is an extracellular matrix glycoprotein. During early embryonic development, TNC is transiently expressed in multiple sites, but in normal adult tissues, the expression level of TNC is low. The expression distribution and functions of TNC in the embryonic and adult stages have been reported in the literature (PMID: 21712412), but the expression and functions of TNC during myocardial regeneration are still unclear, and the role of epicardially expressed TNC in myocardial regeneration has not been reported. Summary of the Invention

[0005] In view of the above technical problems in the prior art, the present invention provides a cardiac patch containing tenascin C, its preparation method and uses. The cardiac patch containing tenascin C, its preparation method and uses are to solve the technical problem in the prior art that there is no suitable method to prevent the uncontrolled activation of YAP signaling while promoting adult heart regeneration by activating the YAP signaling pathway.

[0006] The present invention provides the use of tenascin C in the preparation of a drug for promoting controllable regeneration of myocardium or myocardial repair.

[0007] The present invention also provides the use of tenascin C in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injuries including myocardial infarction.

[0008] The present invention also provides a cardiac patch containing tenascin C.

[0009] Furthermore, the carrier of the cardiac patch is a mixture of poly(lactic-co-caprolactone) and chitosan, a hydrogel, or a degradable polymer film.

[0010] The present invention also provides a preparation method of the above cardiac patch, comprising the following steps:

[0011] 1) Weigh poly(lactic-co-caprolactone) and chitosan, and the mass ratio of poly(lactic-co-caprolactone) to chitosan is 6:(2 - 6). Then dissolve the mixture of poly(lactic-co-caprolactone) and chitosan in a mixed solvent of hexafluoroisopropanol and trifluoroacetic acid, and the volume ratio of hexafluoroisopropanol to trifluoroacetic acid is (7 - 12):1. The mass-volume ratio of the mixture of poly(lactic-co-caprolactone) and chitosan to the mixed solvent is (5 - 7) g:100 ml;

[0012] 2) Using the electrospinning technique, a nanofiber membrane of the material described in step 1) is prepared under the parameters of a working voltage of 15 kV, an extrusion rate of 50 μL / min, and a receiving distance of 10 cm, and then obtained as a carrier material through ventilation and drying;

[0013] 3) The dried carrier material is cut into circular pieces with a diameter of 10 mm, sterilized by soaking in an ethanol solution with a volume fraction of 75% for 20 - 30 hours, and washed thoroughly with sterile PBS to remove residual organic solvents, finally obtaining a carrier patch with good biocompatibility;

[0014] 4) The above - mentioned carrier patch is immersed in the TNC recombinant protein solution and incubated to achieve effective protein loading, thereby constructing a bioactive functional cardiac patch.

[0015] The present invention also provides the use of the above - mentioned cardiac patch in the preparation of a drug for promoting the controllable regeneration of myocardium or myocardial repair.

[0016] The present invention also provides the use of the described cardiac patch in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injuries including myocardial infarction.

[0017] The present invention also provides the use of the combination of AAV9 - cTNT - YAP5SA - GFP virus and tenascin - C in the preparation of a drug for promoting the controllable regeneration of myocardium or myocardial repair.

[0018] The present invention also provides the use of the combination of AAV9 - cTNT - YAP5SA - GFP virus and tenascin - C in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injuries including myocardial infarction.

[0019] The present invention also provides the use of the combination of AAV9 - cTNT - YAP5SA - GFP virus and tenascin - C recombinant protein (TNC recombinant protein) in the preparation of a drug for promoting the controllable regeneration of myocardium or myocardial repair.

[0020] The present invention also provides the use of the combination of AAV9 - cTNT - YAP5SA - GFP virus and tenascin - C recombinant protein (TNC recombinant protein) in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injuries including myocardial infarction.

[0021] Furthermore, the sequence of the tenascin - C recombinant protein is as shown in SEQ ID NO.1.

[0022] The cardiac vector of the present invention is a biomaterial loaded with the above-mentioned TNC protein, including but not limited to a mixture of poly(lactic acid-co-caprolactone) (PLCL) and chitosan, hydrogel, degradable polymer film, etc. This biomaterial has good biocompatibility and sustained-release characteristics, and can achieve the stable release and long-term action of the TNC protein. The prepared TNC protein-biopolymer composite is attached to the outer surface of the heart in the form of a covering layer or dressing, and continuously and slowly releases the TNC protein during the cardiac regeneration process, continuously inhibiting the activity of the local YAP signaling pathway. Through the above steps, the present invention can effectively control the proliferation rate of cardiomyocytes and the scale of cardiac regeneration, maintain the size of the regenerated heart within the normal or near-normal range, and avoid the formation of tumors or increased mortality caused by abnormal hyperplasia of myocardial tissue.

[0023] The innovation of the method of the present invention lies in the local administration method of confining the regulatory factor TNC protein that inhibits myocardial regeneration to the surface of the heart for the first time, inhibiting the YAP signaling pathway, and directly acting on the epicardial region, thereby realizing the controllable regeneration of the heart, effectively avoiding the possible side effects of systemic application of the TNC protein, and having extremely high safety, targeting and spatial specificity, preventing the risk of abnormal enlargement or carcinogenesis or even death of the heart induced by excessive cardiac hyperplasia.

[0024] The present invention provides a method for regulating cardiac regeneration by using tenascin C and its derivatives. The present invention discovers for the first time that TNC is an extracellular matrix glycoprotein that can down-regulate the activity of the YAP signaling pathway, and inhibits YAP from entering the nucleus or reducing its transcriptional activity by interacting with ANXA2 or its cofactors. The core of the method of the present invention is to deliver TNC (or its polypeptide fragment, functional analog, etc.) to the surface of the heart with the help of a biomaterial, thereby effectively inhibiting the activity of the local YAP signaling pathway. In this way, the activity of YAP can be precisely regulated spatially specifically during cardiac regeneration, avoiding cardiac hyperplasia and death caused by overactive YAP.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: Through the exogenous regulation of the YAP pathway by tenascin C and its derivatives, the control of the cardiac regeneration rate and degree is achieved. While promoting the necessary YAP activity and the cardiomyocyte regeneration activated by it, this method prevents excessive myocardial regeneration, thereby reducing the risk of abnormal cardiac hyperplasia and death. Especially in the treatment of diseases such as acute and chronic heart failure, myocardial strain, myocardial infarction, myocardial fibrosis, myocarditis and ischemia-reperfusion injury, applying the method of the present invention can improve the safety of myocardial regeneration and avoid the burden on the body caused by excessive enlargement of the heart. The strategy provided by the present invention is safe and feasible, and provides a new intervention means for patients with myocardial injury to prevent the out-of-control of myocardial regeneration. Description of the Drawings

[0026] Figure 1 It is shown that TNC is mainly expressed in the epicardium 1 day after myocardial injury in neonatal mice and not in other cells. One day after myocardial infarction surgery in neonatal mice at P3, immunofluorescence staining of heart tissue, Sham: sham operation group; MI: myocardial infarction operation group; DAPI: blue; TNC: green; WT1: epicardium marker, red; Vimentin: fibroblast marker, red; Scale bar = 50 μm.

[0027] Figure 2 This is the method for constructing epicardium-specific Tnc gene knockout mice. The knockout efficiency of epicardium cell-specific Tnc gene knockout mice was verified at the RNA level. N = 3, P < 0.05 indicates that the difference is statistically significant.

[0028] Figure 3 Epicardium cell-specific knockout of the Tnc gene promotes myocardial cell proliferation after myocardial infarction in neonatal mice. Compared with wild-type mice, the ability of myocardial cell proliferation in mice with epicardium cell-specific knockout of the Tnc gene is enhanced after myocardial infarction surgery. WT (Wild type): wild-type mice; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ):Epicardium cell-specific Tnc gene knockout mice. DAPI: blue; α-SA (α-sarcomeric actinin): green, myocardial cell marker; Ki67: red, cell proliferation marker; PH3 (Phospho-Histone H3): red, cell mitosis marker; Edu: red, used to detect cell proliferation. N = 3, Scale bar = 50 μm, P < 0.05 indicates that the difference is statistically significant.

[0029] Figure 4 Epicardium cell-specific knockout of the Tnc gene leads to abnormal enlargement of the heart after myocardial injury. Representative pictures of H&E staining show that compared with wild-type mice, the heart of mice with epicardium cell-specific Tnc gene knockout is abnormally enlarged after myocardial infarction surgery. Compared with wild-type mice, the heart weight / body weight ratio of mice with epicardium cell-specific Tnc gene knockout is significantly increased after myocardial infarction surgery. WT: wild-type mice; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ):Epicardium cell-specific Tnc gene knockout mice; HW / BW: heart weight / body weight. Scale bar = 2 mm. N = 3, P < 0.05 indicates that the difference is statistically significant.

[0030] Figure 5 This is the number of myocardial cells in the myocardial tissue section of the largest cross-section of the heart. WT: wild-type mice; Wt1-CreERT2-Tncfl / fl (Wt1-Tnc fl / fl ):Epicardial cell-specific Tnc gene knockout mice. CMs: Cardiomyocytes; N = 3, P < 0.05 indicates a statistically significant difference.

[0031] Figure 6 Epicardial cell-specific knockout of the Tnc gene leads to disordered arrangement of cardiomyocytes after myocardial injury. Representative immunofluorescence images show that compared with wild-type mice, the arrangement of cardiomyocytes in mice with epicardial cell-specific knockout of the Tnc gene is more disordered after myocardial infarction. WT: Wild-type mice; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ):Epicardial cell-specific Tnc gene knockout mice. DAPI: Blue; α-SA, Green; WGA (Wheat germ agglutinin): Red, staining of cardiomyocyte membrane; Scale bar = 50 μm. N = 3, P < 0.05 indicates a statistically significant difference.

[0032] Figure 7 TNC inhibits YAP nuclear entry. A, Western Blot shows that TNC significantly inhibits YAP nuclear entry. N = 3. B, Immunofluorescence staining shows that TNC significantly inhibits YAP nuclear entry. Control: PBS-treated group, TNC: TNC recombinant protein-stimulated group. DAPI: Blue; α-SA, Green; Active-YAP: Red. Scale bar = 20 μm. N = 5, P < 0.05 indicates a statistically significant difference.

[0033] Figure 8 TNC inhibits the proliferation ability of cardiomyocytes. Representative immunofluorescence images show that compared with the control group, the proliferation ability of cardiomyocytes in the TNC recombinant protein-treated group is significantly decreased. DAPI: Blue; α-SA: Green; Ki67: Red. Control: PBS-treated group; TNC: TNC recombinant protein-stimulated group. Scale bar = 50 μm. N = 4, P < 0.05 indicates a statistically significant difference.

[0034] Figure 9 Epicardial cell-specific knockout of the Tnc gene leads to a significant increase in YAP signal in the nuclei of cardiomyocytes. Representative immunofluorescence images show that compared with wild-type mice, the YAP signal in the nuclei of cardiomyocytes in mice with epicardial cell-specific knockout of the Tnc gene is significantly increased. WT: Wild-type mice; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ):Epicardial cell-specific Tnc gene knockout mice. DAPI: Blue; α-SA: Green; Active-YAP: Red; Scale bar = 50 μm.

[0035] Figure 10 Because ANXA2 is an interaction protein of TNC. A, The protein identification table indicates that ANXA2 is one of the interaction proteins of TNC. B, The secondary structure display of ANXA2 protein mass spectrometry.

[0036] Figure 11 The Co-IP experiment verifies that ANXA2 is an interaction protein of TNC. TNC O / E: Overexpression of the TNC gene.

[0037] Figure 12 Because TNC can promote the enrichment of ANXA2 on the myocardial cell membrane. N = 3, P < 0.05, indicating that the difference is statistically significant.

[0038] Figure 13 Because knocking down Anxa2 can reverse the decrease in YAP nuclear entry caused by TNC. A. Western Blot shows that TNC significantly inhibits YAP nuclear entry, while gene silencing of Anxa2 significantly reverses this effect. N = 3. B. Immunofluorescence staining shows that TNC significantly inhibits YAP nuclear entry, while gene silencing of Anxa2 significantly reverses this effect. DAPI: blue; α-SA: green; Active-YAP: red. Control: PBS-treated group; TNC: TNC recombinant protein-stimulated group; TNC + Anxa2 siRNA: TNC recombinant protein-stimulated plus Anxa2 gene silencing group. Scale bar = 20 μm. N = 5, P < 0.05 indicates that the difference is statistically significant.

[0039] Figure 14 Because knocking down Anxa2 can reverse the ability of TNC to inhibit cardiomyocyte proliferation. Representative immunofluorescence images show that knocking down Anxa2 can reverse the ability of TNC to inhibit cardiomyocyte proliferation. DAPI: blue; α-SA: green; Ki67: red. Control: PBS-treated group; TNC: TNC recombinant protein-stimulated group; TNC + Anxa2 siRNA: TNC recombinant protein-stimulated plus Anxa2 gene silencing group. Scale bar = 50 μm. N = 3, P < 0.05 indicates that the difference is statistically significant.

[0040] Figure 15 Because a cardiac patch is covered on the heart surface after myocardial infarction surgery in mice.

[0041] Figure 16 The construction diagram of AAV9-cTNT-YAP5SA-GFP with cardiomyocyte-specific expression of YAP5SA.

[0042] Figure 17The overexpression group of YAP5SA and the group of YAP5SA overexpression combined with TNC cardiac patch can promote the proliferation of adult mouse cardiomyocytes: Compared with the AAV9-cTNT-GFP group, the cardiomyocyte proliferation ability in the AAV9-cTNT-YAP5SA-GFP group and the AAV9-cTNT-YAP5SA-GFP+TNC group was significantly increased after myocardial infarction in mice. AAV9-cTNT-GFP: The group injected with AAV9-cTNT-GFP via vein; AAV9-cTNT-YAP5SA-GFP: The group injected with AAV9-cTNT-YAP5SA-GFP via vein; AAV9-cTNT-YAP5SA-GFP+TNC: The group injected with AAV9-cTNT-YAP5SA-GFP via vein and supplemented with TNC recombinant protein patch. DAPI: blue; α-SA: green; Ki67: red. N = 5, five independent fields were randomly selected; P < 0.05 indicates that the difference is statistically significant. Scale bar = 50 μm.

[0043] Figure 18 WGA staining showed the degree of cardiomyocyte disorder. Representative immunofluorescence images showed that compared with AAV9-cTNT-GFP mice, the degree of myocardial disorder was significantly increased after myocardial infarction in AAV9-cTNT-YAP5SA-GFP mice. However, compared with the AAV9-cTNT-YAP5SA-GFP group, the degree of myocardial disorder was significantly decreased in the AAV9-cTNT-YAP5SA-GFP+TNC group. AAV9-cTNT-GFP: The group injected with AAV9-cTNT-GFP via vein; AAV9-cTNT-YAP5SA-GFP: The group injected with AAV9-cTNT-YAP5SA-GFP via vein; AAV9-cTNT-YAP5SA-GFP+TNC: The group injected with AAV9-cTNT-YAP5SA-GFP via vein and supplemented with TNC recombinant protein patch. DAPI: blue; WGA: green; Scale bar = 50 μm. N = 5, five independent fields were randomly selected, and P < 0.05 indicates that the difference is statistically significant.

[0044] Figure 19 Representative H&E staining pictures are shown. Compared with the AAV9-cTNT-GFP group of mice, the infarct area was significantly decreased 1 week after myocardial infarction in the AAV9-cTNT-YAP5SA-GFP+TNC group of mice. AAV9-cTNT-GFP: The group injected with AAV9-cTNT-GFP via vein; AAV9-cTNT-YAP5SA-GFP+TNC: The group injected with AAV9-cTNT-YAP5SA-GFP via vein and supplemented with TNC recombinant protein patch, and the scale bar is 2 mm.

[0045] Figure 20Shown in the representative Masson's staining figure, compared with the mice in the AAV9-cTNT-GFP group, the cardiac scar area of the mice in the AAV9-cTNT-YAP5SA-GFP+TNC group was significantly decreased 1 week after myocardial infarction. AAV9-cTNT-GFP: intravenous injection of AAV9-cTNT-GFP group; AAV9-cTNT-YAP5SA-GFP+TNC: intravenous injection of AAV9-cTNT-YAP5SA-GFP supplemented with TNC recombinant protein patch group, scale bar is 2mm. Detailed implementation mode

[0046] Example 1: Study the effect of epicardial-expressed TNC on myocardial regeneration and myocardial repair

[0047] (1.1) Experimental animals: Wt1-CreERT2-Tnc fl / fl Newborn mice (mice with epicardial-specific knockout of Tnc) (WT1-CreERT2 was purchased from Shanghai Model Organisms Center, Inc.; catalog number: NM-KI-200127; Tnc fl / fl mice (purchased from Ciyuan Biologics Co., Ltd.; catalog number: T009233) and corresponding Wt1-CreERT2-Tnc wt / wt littermate mice (the same as above) and Wt1-CreERT2; RFP ki / wt epicardial cell tracer mice (RFP tracer mice); R26-CAG-LSL-tdTomato mice (purchased from Shanghai Model Organisms Center, Inc.; catalog number: NM-KI-225042).

[0048] (1.2) Experimental model: Use Tamoxifen-inducible gene knockout Wt1-CreERT2-Tnc fl / fl mice. After the mice were born, specific knockout of the Tnc gene in epicardial cells was achieved by administering Tamoxifen. Left coronary artery ligation was performed on the newborn mice 3 days after birth.

[0049] (1.3) Experimental groups: WT sham operation group; Wt1-CreERT2-Tnc fl / fl sham operation group; WT myocardial infarction operation group; Wt1-CreERT2-Tnc fl / fl myocardial infarction operation group.

[0050] (1.4) Detection indexes

[0051] (1.4.1) Analyze the expression of TNC during myocardial regeneration: Use Wt1-CreERT2; RFP ki / wtEpicardial cell-tracing mice, left coronary artery ligation was performed on neonatal and adult mice, and heart tissues were collected after myocardial infarction and in the sham operation group. Through TNC and WT1 immunofluorescence staining, the spatial distribution characteristics of TNC during myocardial regeneration were observed.

[0052] (1.4.2) Measurement of heart weight and total number of cardiomyocytes: Heart tissues were collected 4 weeks after left coronary artery ligation in each group, and the ratio of heart weight to body weight of each group of mice was calculated to evaluate heart weight. Heart tissue sections of different heart cross-sections were stained with α-SA and DAPI, and through whole-slide scanning, combined with the image automatic segmentation technology of CellPose based on deep machine learning, the number of cardiomyocytes was quantitatively analyzed.

[0053] (1.4.3) Evaluation of cardiomyocyte hypertrophy: Heart tissues were collected 4 weeks after left coronary artery ligation in each group, and the degree of cardiomyocyte hypertrophy was evaluated by WGA staining.

[0054] (1.4.4) Evaluation of cardiomyocyte proliferation ability: Heart tissues were collected 1 week after left coronary artery ligation in each group, and cardiomyocyte proliferation was evaluated by Ki67, Brdu, and pH3 immunofluorescence staining.

[0055] (1.4.5) Evaluation of myocardial repair degree and scar tissue condition: Heart tissues were collected 4 weeks after left coronary artery ligation in each group, and the degree of myocardial repair and the proportion of scar tissue after left coronary artery ligation were evaluated by H&E and Masson's staining.

[0056] (1.4.6) Evaluation of cardiomyocyte disarray degree: Heart tissues were collected 4 weeks after left coronary artery ligation in each group, and the degree of cardiomyocyte disarray was evaluated by α-SA and WGA immunofluorescence staining. The average cardiomyocyte alignment direction was analyzed using the FibrilTool tool of Image J software to evaluate the degree of cardiomyocyte disarray.

[0057] (1.5) Experimental results: One day after modeling, immunofluorescence staining showed that one day after myocardial injury, TNC was specifically highly expressed in the epicardium and not in other heart cells ( Figure 1 ). Specific Tnc gene knockout mice (Wt1-CreERT2-Tnc fl / fl ) ( Figure 2 ) results showed that epicardium-specific knockout of the Tnc gene led to enhanced cardiomyocyte proliferation ability after myocardial infarction in neonatal mice ( Figure 3 ), and at the same time, it also caused abnormal enlargement of heart weight and volume ( Figure 4 ). Epicardium-specific knockout of the Tnc gene led to an increase in the total number of cardiomyocytes ( Figure 5) The heart showed a phenomenon of excessive hyperplasia. The degree of myocardial cell disorder was evaluated by analyzing the average alignment direction of the long axis of myocardial cells. The results showed that the deletion of epicardial Tnc led to an increase in the degree of myocardial cell misalignment ( Figure 6 ), indicating that the specific knockout of the Tnc gene in the epicardium led to abnormal and disordered hyperplasia of the myocardium.

[0058] Example 2: Studying the molecular biological mechanism of the effect of epicardially expressed TNC on myocardial regeneration and myocardial repair

[0059] (2.1) In vitro experiment part.

[0060] (2.1.1) Cells: Primary neonatal rat cardiomyocytes

[0061] Method for extracting primary neonatal rat cardiomyocytes:

[0062] 1) Use sterile scissors to quickly remove the hearts of P1–P3 mice (purchased from Shanghai Jiesijie Experimental Animal Co., Ltd.), and rinse them in ice-cold PBS to remove blood.

[0063] 2) Remove the pericardium and excess tissue, retain the ventricular part, and cut the heart into small pieces about 1 mm 3 for standby.

[0064] 3) Place the myocardial tissue pieces in a digestion solution containing 100 mg / ml collagenase IV and 60 u / ml DNase, place them in a 37°C water bath, digest for 8–10 minutes each time, and gently pipette.

[0065] 4) After each round of digestion, collect the supernatant and immediately add a medium containing 10% FBS to terminate the reaction. Repeat digestion 5–6 times and combine all supernatants.

[0066] 5) Filter the combined cell suspension through a 70 μm sieve and centrifuge, then resuspend it in DMEM containing 10% FBS.

[0067] 6) Place the cell suspension in a culture dish and incubate at 37°C for 2 hours to promote the prior adhesion of fibroblasts.

[0068] 7) Transfer the cardiomyocytes in the supernatant to a culture plate pre-coated with 10 μg / mL Laminin and continue culturing.

[0069] (2.1.2) siRNA used in the experiment:

[0070] ANXA2 siRNA and its control empty siRNA, (purchased from GenePharma Co., Ltd.);

[0071] ANXA2 siRNA sense strand: CCAGUAUGAUGCUUCGGAA(dT)(dT)(SEQ ID NO.5);

[0072] ANXA2 siRNA antisense strand: UUCCGAAGCAUCAUACUGG(dT)(dT)(SEQ ID NO.6).

[0073] (2.1.3) Identification of the interaction between TNC and ANXA2: Proteomics analysis was performed using liquid chromatography-tandem mass spectrometry (LC-MS / MS) technology to screen for potential interacting proteins of TNC; the interaction between TNC and ANXA2 was verified by co-immunoprecipitation (Co-IP) experiments.

[0074] (2.1.4) Studying the TNC / ANXA2 / YAP signaling axis: Using TNC recombinant protein (MCE, USA, product number: HY-P700833) (the sequence is shown in SEQ ID NO.1 (EGF superfamily domain)), co-cultured with primary neonatal mouse cardiomyocytes, and the expression levels, activity states and subcellular localization of ANXA2 / YAP in each group were analyzed by WB.

[0075] (2.1.5) Analyzing whether TNC regulates cardiomyocyte proliferation mediated by ANXA2 / YAP: Using TNC recombinant protein, co-cultured with primary neonatal mouse cardiomyocytes, and the proliferation of cardiomyocytes in each group was analyzed by immunofluorescence staining of Ki67.

[0076] (2.2) In vivo experiment part

[0077] (2.2.1) Experimental animals: same as (1.1)

[0078] (2.2.2) Experimental model: same as (1.2)

[0079] (2.2.3) Experimental groups: WT myocardial infarction surgery group; Wt1-CreERT2-Tnc fl / fl 10 in the myocardial infarction surgery group; Wt1-CreERT2-Tnc fl / fl myocardial infarction surgery group.

[0080] (2.2.4) Detection indicators

[0081] (2.2.4.1) Analyzing the YAP signaling pathway: Analyzing the subcellular localization and activity level of the YAP signaling pathway in cardiomyocytes by Western-Blotting and immunofluorescence staining.

[0082] (2.2.4.2) Other detection indicators: same as (1.4)

[0083] (2.3) Experimental results: In vitro experiments of the present invention show that TNC inhibits the YAP activity and cell proliferation of cardiomyocytes ( Figures 7-8 ), and the YAP fluorescence staining results of myocardial tissues show that Wt1-CreERT2-Tnc fl / fl shows enhanced YAP signals in the myocardial cell nuclei compared with those in the WT wild-type control mice ( Figure 9 ), suggesting that TNC expressed by the epicardium restricts YAP activity through specific spatiotemporal distribution, thereby anchoring the cardiac boundary and realizing the spatial constraint mechanism for myocardial regeneration. Mass spectrometry results screened out Annexin A2 (ANXA2) binding to TNC ( Figure 10 ), and co-immunoprecipitation experiments confirmed the binding of TNC and ANXA2 ( Figure 11 ), suggesting that TNC may regulate downstream signaling pathways mediated by ANXA2. TNC can promote the aggregation of ANXA2 expressed by cardiomyocytes on the cell membrane ( Figure 12 ), and reduce the nuclear translocation of YAP. Knockdown of ANXA2 can reverse the decrease in YAP nuclear entry caused by TNC ( Figure 13 ). Knockdown of ANXA2 can reverse the inhibitory effect of TNC on cardiomyocyte proliferation ( Figure 14 ). It is thus proved that TNC expressed by the epicardium causes the aggregation of YAP to the cell membrane, blocks YAP nuclear translocation, down-regulates YAP activity, and thus inhibits cardiomyocyte proliferation under the mediation of ANXA2.

[0084] Example 3: Combine the AAV9 gene therapy method for myocardial targeting activation of YAP with the technology of a cardiac patch carrying TNC to explore a new method to achieve controllable regeneration of adult myocardium

[0085] (3.1) Experimental animals: Wild-type C57BL / 6J mice were purchased from Shanghai Jiesijie Experimental Animal Co., Ltd., 8 weeks old, all male or all female.

[0086] (3.2) Construction of a cardiomyocyte-targeted AAV vector: Construct and amplify myocardiotropic AAV9, and clone the myocardial-specific promoter cTNT and YAP5SA into the AAV9 vector, as Figure 16 . AAV9-cTNT-YAP5SA-GFP and its control empty vector AAV9 (from Heyuan Biotech Co., Ltd.).

[0087] The preparation method of AAV9-cTNT-YAP5SA-GFP virus is as follows:

[0088] 1) Select the GL3058 pcAAV-cTNTo-ZsGreen1-WPRE empty plasmid (from Heyuan Biotech Co., Ltd.) containing the AAV inverted terminal repeats (ITRs) and carrying the cardiomyocyte-specific promoter cTNT as the viral packaging backbone;

[0089] 2) Using molecular cloning techniques, insert the YAP gene fragment (SEQ ID NO.2) with five serine mutations (S61A, S109A, S127A, S164A, S381A) downstream of the promoter. At the same time, GFP and YAP5SA are linked by the P2A sequence to achieve co-expression of the two proteins;

[0090] 3) After completing the plasmid construction, use Sanger sequencing to confirm the correctness of the inserted fragment and the mutation sites;

[0091] Forward sequencing primer for verifying Flag-YAP5SA overexpression: AGGTGTCCACTCCCAGTTCA (SEQ ID NO.3); Reverse sequencing primer for verifying Flag-YAP5SA overexpression: CACCACGCACAGGTTGAT (SEQ ID NO.4).

[0092] 4) Co-transfect the following three plasmids into HEK293T cells (purchased from ATCC, USA): 1) The AAV plasmid of YAP5SA constructed in steps 1)-3), pHelper (providing adenovirus helper function), pAAV2 / 9 (providing the cap (capsid) and rep (replication) genes of AAV9);

[0093] 5) Collect the cells and culture medium 72 hours after transfection, and obtain the total amount of virus through freeze-thaw lysis;

[0094] 6) Purify by iodixanol density gradient centrifugation;

[0095] 7) Use qPCR to detect the virus titer.

[0096] (3.3) Fabrication of cardiac patches: Preparation of cardiac patches carrying recombinant TNC protein: Poly(lactic-co-caprolactone) (PLCL) and chitosan were dissolved in a mixed solvent of hexafluoroisopropanol / trifluoroacetic acid (9:1, v / v) at a mass ratio of 6:4 to prepare a PLCL / chitosan composite solution with a total concentration of 6% (w / v) (6 g:100 ml). Through electrospinning technology, nanofiber membranes were prepared under the optimized parameters of a working voltage of 15 kV, an extrusion rate of 50 μL / min, and a receiving distance of 10 cm, and then dried by ventilation to obtain the carrier material. The dried fiber membranes were cut into circular pieces with a diameter of 10 mm, sterilized by soaking in 75% ethanol solution for 24 hours, and washed thoroughly with sterile PBS to remove residual organic solvents, finally obtaining carrier patches with good biocompatibility. In experimental applications, the patches were impregnated in the TNC recombinant protein solution and incubated overnight at 4°C to achieve effective protein loading, thereby constructing a functional cardiac patch with biological activity, such as Figure 15 .

[0097] (3.4) Models and treatments: The left anterior descending coronary artery ligation was used to simulate the acute myocardial infarction model.

[0098] (3.5) Experimental groups: Empty vector control group (intravenous injection or intramyocardial injection of different titers of empty vector adeno-associated virus AAV9); experimental group overexpressing YAP5SA (SEQ ID NO.2) (intravenous injection or intramyocardial injection of different titers of adeno-associated virus AAV9 expressing YAP5SA); experimental group overexpressing YAP5SA and adhering to the cardiac patch carrying recombinant TNC protein (intravenous injection or intramyocardial injection of different titers of adeno-associated virus AAV9 expressing YAP5SA and adhering to the cardiac patch carrying recombinant TNC protein).

[0099] (3.6) Detection indicators: Same as (1.4)

[0100] (3.7) Experimental results: The cardiac patches containing TNC prepared by the electrospinning technology of the present invention can firmly adhere to the outer surface of the heart ( Figure 15 ). The present invention constructed an AAV9 virus carrying the cardiomyocyte-specific promoter cTNT and the coding sequence of YAP5SA ( Figure 16 ). Immunofluorescence staining of myocardial tissues showed that the YAP5SA overexpression group and its combination with the TNC cardiac patch group promoted cardiomyocyte proliferation 3 days after myocardial infarction, while almost no proliferating cardiomyocytes were detected in the control AAV9-cTNT-GFP group ( Figure 17 ). The myocardial arrangement in the cardiac patch group was more regular, while the myocardial cell arrangement in the group without using the patch was significantly disordered ( Figure 18)。The results of the control AAV9-cTNT-GFP group and the AAV9-cTNT-YAP5SA+TNC group one week after myocardial infarction collected in this invention show that the AAV9-cTNT-YAP5SA+TNC group has reduced the myocardial infarction area and scar area compared with the control AAV9-cTNT-GFP group( Figures 19-20 ), suggesting that the cardiac patch containing TNC combined with overexpression of YAP5SA has the potential effect of promoting adult myocardial regeneration and repair, and reducing the risk brought by overactivation of YAP.

[0101] Experimental conclusion:

[0102] The experimental results of this invention fully prove the effectiveness and innovation of this invention. First of all, animal experiments confirm that TNC expressed by epicardial cells spatially specifically restricts the activity of the YAP signaling pathway, prevents overactivation of YAP activity, and contributes to the controllable regeneration of the myocardium.

[0103] Compared with the AAV9-cTNT-GFP group, the AAV9-cTNT-YAP5SA-GFP group and the AAV9-cTNT-YAP5SA-GFP+TNC group can promote the proliferation of adult cardiomyocytes. The experimental results show that the AAV9-cTNT-YAP5SA-GFP group shows excessive and disordered hyperplasia of the myocardium. More seriously, a higher mortality rate appears in the animals of this group, suggesting that overactivation of YAP causes a significant burden on the body. Compared with the AAV9-cTNT-YAP5SA-GFP group, the AAV9-cTNT-YAP5SA-GFP+TNC group (the production method of the TNC-coated patch is as follows: place 10 circular patches with a diameter of 10 mm in 1 ml of TNC recombinant protein solution with a concentration of 20 μg / ml, and incubate overnight at 4°C. After overnight incubation, aspirate the TNC recombinant protein solution, detect the residual TNC protein concentration in the solution, and determine whether the TNC recombinant protein is completely adsorbed by the patch) has a stable and orderly myocardial regeneration process, more regular myocardial arrangement, and a moderate volume of the regenerated myocardial tissue. No dead animals appeared during the experimental observation period.

[0104] From the above experimental data, it can be seen that TNC protein and its structural domain play a significant role in spatially specifically inhibiting the YAP signal and ensuring the controllable regeneration of the myocardium. This method effectively avoids the adverse consequences brought by overactivation of YAP, and does not significantly hinder the proliferation of adult cardiomyocytes caused by YAP activation to repair damaged and necrotic myocardium, thus successfully verifying the feasibility and safety of this invention at the experimental level. These data fully support the various limitations of the claims of this invention and provide strong scientific basis for this invention.

Claims

1. Use of tenascin C in the preparation of a drug for promoting controlled regeneration of myocardium or myocardial repair.

2. Use of tenascin C in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injury including myocardial infarction.

3. A heart patch, characterized in that, Contains tenascin C.

4. The cardiac patch according to claim 3, wherein, The carrier of the cardiac patch is a mixture of poly(lactic-co-caprolactone) and chitosan, hydrogel or a degradable polymer film.

5. The preparation method of a cardiac patch according to claim 4, characterized in that, Comprises the following steps: 1) Weigh poly(lactic-co-caprolactone) and chitosan, and the mass ratio of poly(lactic-co-caprolactone) to chitosan is 6:(2 - 6). Then dissolve the mixture of poly(lactic-co-caprolactone) and chitosan in a mixed solvent of hexafluoroisopropanol and trifluoroacetic acid, and the volume ratio of hexafluoroisopropanol to trifluoroacetic acid is (7 - 12):

1. The mass-volume ratio of the mixture of poly(lactic-co-caprolactone) and chitosan to the mixed solvent is (5 - 7) g:100 ml; 2) Using electrospinning technology, prepare a nanofiber membrane of the material described in step 1) under the parameters of a working voltage of 15 kV, an extrusion rate of 50 μL / min and a receiving distance of 10 cm, and then obtain the carrier material through ventilation and drying; 3) Cut the dried carrier material into circular pieces with a diameter of 10 mm, sterilize by soaking in an ethanol solution with a volume fraction of 75% for 20 - 30 hours, and wash with sterile PBS to finally obtain a carrier patch carrier with good biocompatibility; 4) Immerse the above carrier patch carrier in a tenascin C recombinant protein solution and incubate to achieve effective protein loading, thereby obtaining a functional cardiac patch with biological activity.

6. The preparation method of a cardiac patch according to claim 5, characterized in that, The sequence of the tenascin C recombinant protein is as shown in SEQ ID NO.

1.

7. Use of the cardiac patch according to claim 3 or 4 in the preparation of a drug for promoting controlled regeneration of myocardium or myocardial repair.

8. Use of the cardiac patch according to claim 3 or 4 in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injury including myocardial infarction.

9. Use of the combination of AAV9-cTNT-YAP5SA-GFP virus and tenascin C in the preparation of a drug for promoting controlled regeneration of myocardium or myocardial repair.

10. Use of the combination of AAV9-cTNT-YAP5SA-GFP virus and tenascin C in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injury including myocardial infarction.

11. Use of the combination of AAV9-cTNT-YAP5SA-GFP virus and tenascin C recombinant protein in the preparation of a drug for promoting controlled regeneration of myocardium or myocardial repair.

12. Use of the combination of AAV9-cTNT-YAP5SA-GFP virus and tenascin C recombinant protein in the preparation of a drug for preventing excessive myocardial regeneration or treating myocardial injury including myocardial infarction.

13. The use according to claim 11 or 12, characterized in that, The sequence of the tenascin C recombinant protein is as shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • Compositions and methods for augmentation and regeneration of living tissue in a subject

    CN102123745A

  • Method for preparing chitosan-silk fibroin composite nano-fiber multifunctional patch for promoting myocardial tissue regeneration and monitoring stem cells

    CN104189958A

  • Myocardial infarction prognosis risk index detection device and establishment method of myocardial infarction prognosis early warning model

    CN109374901A

  • Degradable drug-loaded controlled-release myocardial repair patch with multilevel structure

    CN110013567A

  • Scaffold for cardiac patch

    US20150246157A1