Microsatellite marker identification primer, method and application for megaleucus, kessler and guangdong megaleucus

Abstract

The application belongs to the technical field of fish molecular markers, and discloses a microsatellite marker identification primer, method and application for Megalobrama amblycephala, Megalobrama mantsaiensis and Megalobrama hoffmanni. Three pairs of microsatellite marker primers are successfully screened and identified, three kinds of Megalobrama fish and hybrid individuals can be quickly and accurately distinguished, the germplasm identification technology of Megalobrama fish is systematically established, and misjudgment caused by similar morphology is avoided. Compared with the traditional magnetic bead method and linkage map method, the high-throughput sequencing technology is used in the application, which greatly improves the throughput and efficiency of microsatellite marker screening, and high resolution of a single base pair is obtained by combining capillary electrophoresis separation technology, which has high efficiency, comprehensiveness and accuracy, and is strong in operability, and has high result reliability, thereby providing strong technical support for germplasm identification of Megalobrama fish. The method and application for identifying Megalobrama amblycephala, Megalobrama mantsaiensis and Megalobrama hoffmanni are simple in operation, small in error, accurate in result and high in efficiency.

Description

Technical Field

[0001] This invention belongs to the field of fish molecular marker technology, and particularly relates to microsatellite marker identification primers, methods and applications for blunt snout bream, triangular bream and Guangdong bream. Background Technology

[0002] Blunthead bream ( Megalobrama amblycephala (also known as Wuchang fish or grass bream). It has a high, laterally compressed, rhomboid body; short pectoral fins that only reach the base of the pelvic fins; a wide, flat, arched mouth; dorsal fin spines shorter than the head; and a short, nearly square caudal peduncle. It is herbivorous, primarily feeding on aquatic plants, and grows relatively quickly, with optimal growth before the age of 3. It is suitable for aquaculture in still or slow-flowing waters and has high economic value.

[0003] Triangle bream ( Megalobrama terminalis (also known as bream or flat-chested bream). It has a narrower body shape than the blunt-snout bream, nearly rhomboid in shape; long pectoral fins extending beyond the base of the pelvic fins; a narrow, horseshoe-shaped mouth; dorsal fin spines significantly longer than the head; and a long, rectangular caudal peduncle. It is omnivorous with a predominantly herbivorous diet, grows relatively quickly, and is highly adaptable, but exhibits high genetic diversity within the species.

[0004] Guangdong bream ( Megalobrama hoffmanni The bream (also known as the flower bream or true flatfish) has a high, laterally compressed, elongated rhomboid body; a relatively wide mouth with thin horny layers on both the upper and lower jaws; a dorsal fin spine similar in length to the head; and a prominent ventral keel extending to the anus. It is omnivorous, preferring aquatic plants and mollusks. Its flesh is tender and high in fat, making it a prized edible fish, but it is rarely farmed.

[0005] Blunt-snout bream, triangular bream, and Guangdong bream all belong to the genus *Brachys* and are morphologically similar. Among them, blunt-snout bream is known for its advantages in aquaculture, triangular bream is highly adaptable, and Guangdong bream is characterized by its delicious meat. All three are important aquatic resources in my country, and their classification and characteristics are of great significance for fisheries development and germplasm conservation.

[0006] The early developmental stages of the genus *Ctenopharynx* exhibit similar morphologies, making accurate differentiation difficult using traditional morphological methods. Therefore, molecular marker techniques are essential for accurate identification. Microsatellites (SSRs) offer advantages such as stability, ease of identification, and high sensitivity. The key challenge in this field is to establish a systematic germplasm identification technique for *Ctenopharynx* species by rapidly and accurately differentiating them based on morphological differences in various fish traits, thereby providing technical support for the improvement and genetic breeding of *Ctenopharynx* varieties. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a primer, method and application for rapid and accurate identification of three species of bream.

[0008] To solve the above technical problems, the technical scheme provided by the present application is:

[0009] In the first aspect, the present application provides a microsatellite marker identification primer for Megalobrama amblycephala, Megalobrama mantsaiensis and Megalobrama hoffmanni, which comprises any one or several of the following three primer pairs: TTF-3, TTF-20 and TTF-32:

[0010] TTF-3-F: CCACCATAATAATGCAGGTGGTA;

[0011] TTF-3-R: TGTATGCTTCAGCTCATTGAAAA;

[0012] TTF-20-F: CTGAATCTAAGGCACCTGAAAGA;

[0013] TTF-20-R: TTTCTGGTTCATTCATCACACTG;

[0014] TTF-32-F: ACCCCCCTGATTTCACTAGATT;

[0015] TTF-32-R: GGGTTACACCTGACTGCTGAGTA.

[0016] In the second aspect, the present application provides a microsatellite marker identification kit for Megalobrama amblycephala, Megalobrama mantsaiensis and Megalobrama hoffmanni, which comprises the microsatellite marker identification primer.

[0017] The microsatellite marker identification kit further comprises 2x Taq PCR MasterMix and ddH2O containing dyes.

[0018] In the third aspect, the present application provides a method for identifying Megalobrama amblycephala, Megalobrama mantsaiensis and Megalobrama hoffmanni, which comprises the following steps:

[0019] (1) extracting genomic DNA of Megalobrama amblycephala, Megalobrama mantsaiensis or Megalobrama hoffmanni to be tested;

[0020] (2) using the microsatellite marker identification primer or the microsatellite marker identification kit to perform PCR amplification on the DNA in step (1) as a template, and performing TAE buffer agarose gel electrophoresis detection on the PCR amplification product;

[0021] (3) performing non-denaturing polyacrylamide gel electrophoresis (PAGE) detection on the PCR amplification product without a band and with a band size meeting the target in the TAE buffer agarose gel electrophoresis detection in step (2);

[0022] (4) The length polymorphism and genetic diversity information of the PCR amplified product with distinguishability detected by the non-denaturing polyacrylamide gel electrophoresis in step (3) is obtained by capillary electrophoresis (CE); the primer pair TTF-3 amplifies a specific band of the Amur catfish at 130 bp, which distinguishes the Amur catfish from the other two groups; the primer pair TTF-20 amplifies a specific band of the Guangdong catfish at 125 bp, which directly identifies the Guangdong catfish; and the primer pair TTF-32 amplifies a specific band of the Triangular banded fish at 100 bp, which directly identifies the Triangular banded fish.

[0023] The method, further, the reaction system and the amplification procedure of the PCR amplification are as follows:

[0024] 2×Taq PCR MasterMix containing dye 10.0 µL, 94℃, 5~7 min;

[0025] 10 µmol / L of primer-F 0.6~1.0 µL, 94℃, 30 s;

[0026] 10 µmol / L of primer-R 0.6~1.0 µL, 54~60℃, 30 s;

[0027] ddH2O 7.0~7.8 µL, 72℃, 30 s;

[0028] Primer-F, primer-R and ddH2O repeat 30~35 cycles;

[0029] DNA to be tested 1.0~1.8 µL, concentration >100 ng / µL, 72℃, 5~7 min;

[0030] Total system 20.0 µL, stored at 4℃.

[0031] Further, the TAE buffer agarose gel electrophoresis detection adopts 2.0~2.5% mass concentration of agarose gel.

[0032] Further, the non-denaturing polyacrylamide gel electrophoresis detection adopts a gel containing the following components: 13.3 mL of acrylamide / methylene bisacrylamide solution with a mass concentration of 30%, 10 mL of 5×TBE, 25.68 mL of ultrapure water, 1 mL of ammonium persulfate solution with a mass concentration of 10%, and 20 µL of TEMED, with a total volume of 50 mL; in the acrylamide / methylene bisacrylamide solution, the mass ratio of acrylamide to methylene bisacrylamide is 29:1.

[0033] Further, the capillary electrophoresis is performed on a Qsep100 full-automatic nucleic acid protein analysis system.

[0034] In a fourth aspect, the present application provides application of the microsatellite marker identification primer or the microsatellite marker identification kit in identifying Misgurnus anguillicaudatus, Misgurnus fossilis and Misgurnus angulicaudatus.

[0035] In a fifth aspect, the present application provides application of the method in identifying Misgurnus anguillicaudatus, Misgurnus fossilis and Misgurnus angulicaudatus.

[0036] Compared with the prior art, the present application has the following beneficial effects:

[0037] 1. The present application successfully screens and identifies three pairs of microsatellite marker primers, i.e. TTF-3, TTF-20 and TTF-32, which can quickly and accurately distinguish three kinds of Misgurnus fish and their hybrid individuals, and a germplasm identification technology for Misgurnus fish is established, thereby avoiding misjudgment caused by similar morphology. Compared with the traditional magnetic bead method and linkage map method, the present application uses high-throughput sequencing technology to greatly improve the throughput and efficiency of microsatellite marker screening, and combines capillary electrophoresis separation technology to obtain high resolution of single base pair (bp), and has high efficiency, comprehensiveness and accuracy, and strong operability, and the result has high reliability, thereby providing strong technical support for germplasm identification of Misgurnus fish.

[0038] 2. The method and application for identifying Misgurnus anguillicaudatus, Misgurnus fossilis and Misgurnus angulicaudatus have the advantages of simple operation, small error, accurate result and high efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0039] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort based on these drawings.

[0040] Figure 1 Fig. 1 is an appearance, surface scale and swim bladder diagram of three kinds of Misgurnus fish in the embodiments of the present application; A: Misgurnus anguillicaudatus appearance diagram; B: Misgurnus anguillicaudatus scale diagram; C: Misgurnus anguillicaudatus swim bladder diagram; D: Misgurnus anguillicaudatus swim bladder enlarged diagram; E: Misgurnus fossilis appearance diagram; F: Misgurnus fossilis scale diagram; G: Misgurnus fossilis swim bladder diagram; H: Misgurnus fossilis swim bladder enlarged diagram; I: Misgurnus angulicaudatus appearance diagram; J: Misgurnus angulicaudatus scale diagram; K: Misgurnus angulicaudatus swim bladder diagram; L: Misgurnus angulicaudatus swim bladder enlarged diagram. Scale bar = 1 cm.

[0041] Figure 2 Fig. 2 is a Misgurnus fish population principal component scatter diagram based on 8 morphological data in the embodiments of the present application; A: Misgurnus fish population first and second principal component scatter diagram based on 8 morphological data; B: Misgurnus fish population first and third principal component scatter diagram based on 8 morphological data.

[0042] Figure 3 are research results of DNA content and chromosome of three Acipenseriformes fishes in the embodiment of the present application; A: flow chart of A. nanci; B: chromosome split phase of A. nanci; C: karyotype of A. nanci; D: flow chart of A. oxyrhynchus; E: chromosome split phase of A. oxyrhynchus; F: karyotype of A. oxyrhynchus; G: flow chart of A. sinensis; H: chromosome split phase of A. sinensis; I: karyotype of A. sinensis. Scale bar 10 μm.

[0043] Figure 4 are distribution and statistics of SSR types of A. sinensis and A. nanci in the embodiment of the present application; A, B: distribution and statistics of SSR types of A. sinensis; C, D: distribution and statistics of SSR types of A. nanci.

[0044] Figure 5 are PAGE maps of TTF-3, TTF-20 and TTF-32 primers in three Acipenseriformes fishes in the embodiment of the present application; A: PAGE map of TTF-3 primer; B: PAGE map of TTF-20 primer; C: PAGE map of TTF-32 primer. Note: M: PBR322 DNA / Msp I standard molecular weight; 1-6: A. sinensis, 7-12: A. oxyrhynchus, 13-18: A. nanci; A. nanci is Hunan original species, A. oxyrhynchus and A. sinensis are Guangdong original species; red arrow indicates specific amplification fragment for distinguishing A. nanci, green arrow indicates specific amplification fragment for distinguishing A. sinensis, and blue arrow indicates specific amplification fragment for distinguishing A. oxyrhynchus.

[0045] Figure 6 are CE amplification maps of TTF-3, TTF-20 and TTF-32 primers in three Acipenseriformes fishes in the embodiment of the present application; A: CE map of TTF-3 primer; B: CE map of TTF-20 primer; C: CE map of TTF-32 primer. Note: M: PBR322 DNA / Msp I standard molecular weight; 1-6: A. sinensis, 7-12: A. oxyrhynchus, 13-18: A. nanci; A. nanci is Hunan original species, A. oxyrhynchus and A. sinensis are Guangdong original species; red arrow indicates specific amplification fragment for distinguishing A. nanci, green arrow indicates specific amplification fragment for distinguishing A. sinensis, and blue arrow indicates specific amplification fragment for distinguishing A. oxyrhynchus.

[0046] Figure 7CE amplification map of TTF-3 and TTF-32 primers in different populations of Acipenseriformes in the embodiment of the application; A: CE map of TTF-3 in different populations of A. schrenckii; B: CE map of TTF-32 in different populations of A. oxyrhynchus. Note: 1-4 in A: populations of Hunan Institute of Aquatic Science (BSB1-4), 5-8: populations of Xiangjiang River in Hunan Province (BSB21-24), 9-12: populations of Liangzi Lake in Hubei Province (BSB41-44), 13-16: populations of Datong Lake Fishery in Hunan Province (BSB51-54); 1-4 in B: populations of ShaoGuang Fishery Technology Promotion Station in Guangdong Province (SJF1-4), 5-8: populations of Hunan Institute of Aquatic Science (SJF21-24), 9-12: populations of Datong Lake Fishery in Hunan Province (SJF41-44), 13-16: populations of Nanshui Reservoir in Guangdong Province (SJF51-54); red arrow indicates specific amplification fragment for distinguishing A. schrenckii, and blue arrow indicates specific amplification fragment for distinguishing A. oxyrhynchus.

[0047] Figure 8 Appearance, swim bladder, PAGE and CE amplification map of hybrid individual in the embodiment of the application; A: appearance map of hybrid individual; B: scale map of hybrid individual; C: swim bladder map of hybrid individual; D: enlarged swim bladder map of hybrid individual; E: PAGE map of TTF-32 primer; F: CE map of TTF-3 and TTF-32 primers. Note: M in E, F: PBR322 DNA / Msp I standard molecular weight; Acipenseriformes in E, F: wild populations of Xiangjiang River in Hunan Province; 5, 6, 10, 22 individuals in E: hybrid individuals found in wild populations of Acipenseriformes; 1-10 in F: CE map of TTF-3 primer, 11-20: CE map of TTF-32 primer, 21, 23, 24, 27 individuals: hybrid individuals; red arrow indicates specific amplification fragment of A. schrenckii, and purple arrow indicates specific amplification fragment of A. oxyrhynchus. DETAILED DESCRIPTION

[0048] In order to facilitate the understanding of the present application, the following will combine the description of the drawings and the preferred embodiments to make a more comprehensive and detailed description of the present application, but the protection scope of the present application is not limited to the following specific embodiments.

[0049] Unless otherwise defined, all the professional terms used in the following have the same meaning as generally understood by those skilled in the art. The professional terms used in the present application are only for the purpose of describing the specific embodiments, and are not intended to limit the protection scope of the present application.

[0050] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0051] Embodiment:

[0052] Microsatellite-labeled identification primers for blunt snout bream, triangular bream and Guangdong bream, microsatellite-labeled identification kit, method for identifying blunt snout bream, triangular bream and Guangdong bream and its application.

[0053] 1. Morphological analysis of three species of bream

[0054] This invention collected 360 blunt snout bream from the Xiangjiang River Basin in Hunan Province and Liangzi Lake in Hubei Province, and 240 triangular bream and 120 Guangdong bream from the Pearl River Basin and Nanshui Reservoir in Guangdong Province, totaling three species of bream (referred to as BSB, SJF, and GDF in this article, respectively). They were cultured at the Ministry of Education Engineering Research Center for "Polyploid Fish Reproduction and Breeding Technology" of the College of Life Sciences, Hunan Normal University. Sufficient oxygen was provided using an aerator, and the water temperature was adjusted to a suitable level. Sufficient feed was provided at approximately 9:00 AM and 5:00 PM daily.

[0055] 1.1 External Features

[0056] Morphological characteristics of three species of bream: Figure 1 As shown, the scale characteristics of different bream species vary. The blunt-snout bream is bluish-gray, with grayish-white scales at the base and grayish-black edges, exhibiting longitudinal black stripes. Figure 1 (A, B); The triangular bream is grayish-black, with slightly lighter-colored central scales and grayish-black edges on its lateral scales. Figure 1 (E, F); while the base of the scales on the sides of the Guangdong bream has distinctive and relatively obvious black spots (E, F); Figure 1 (I,J). The swim bladders of all bream species are divided into three chambers, with the posterior chamber being the smallest. The length ratio of the middle chamber to the anterior chamber varies (Table 1). In the triangular bream, the anterior chamber (0.76±0.10) is larger than the middle chamber. Figure 1 The swim bladders of *Brucea buxiflora* (1.52±0.14) and *Brucea scutellaria* (1.20±0.10) showed that the middle chamber was larger than the anterior chamber. Figure 1 (C,D,K,L).

[0057] To eliminate the influence of fish size on the absolute values ​​of measurable traits, morphometric analysis was performed using the standardized ratio method (Table 2), and countable traits were statistically analyzed (Table 3). The body height / body length ratio of *Brachys edulis* (0.41±0.02) was significantly higher than that of *Brachys triangularis* (0.34±0.02) and *Brachys dongnanensis* (0.34±0.02). P <0.05), indicating a higher dorsal profile; the caudal peduncle length / caudal peduncle height of the Guangdong bream (1.10±0.09) was significantly longer than that of the triangular bream (0.91±0.07) and the blunt-snout bream (0.77±0.03). P <0.05) means it has a relatively long tail shank.

[0058] Table 1. Statistics on swim bladder length of three species of bream

[0059]

[0060] Table 2. The index of quantifiable traits of three Megalobrama species

[0061]

[0062] Note: a , b and c represent significant difference (P<0.05). P <0.05).

[0063] Table 3. The index of countable traits of three Megalobrama species

[0064]

[0065] 1.2 Morphological analysis

[0066] Based on eight morphological indexes, the principal component analysis of three Megalobrama species was conducted, and the contribution rates of the first three were 48.061%, 23.24%, and 11.336%, respectively, with the cumulative contribution rate of 82.636%, which could reflect the information contained in the comprehensive index (Table 4). In the first principal component, body height / body length, eye diameter / head length, and caudal peduncle length / caudal peduncle height played a major role (body shape characteristics); in the second principal component, total length / body length, caudal peduncle length / body length, and tail fin length / caudal peduncle length played a major role (tail characteristics); and in the third principal component, head length / body length and snout length / head length played a major role (head characteristics).

[0067] According to the above three principal components, a scatter plot was drawn (Fig. 2). Figure 2 On the first principal component, M. acutirostris was located on one side, which was obviously distinguished from M. helfrichii and M. yali populations, while M. helfrichii and M. yali were partially overlapped and difficult to distinguish, indicating that the higher body height characteristics of M. acutirostris were more prominent in the first principal component related to body shape characteristics. On the second principal component, the distribution of each Megalobrama species had a certain overlap, and a small part of M. helfrichii and M. yali did not overlap, indicating that M. yali had longer caudal peduncle characteristics in the second principal component related to tail characteristics. On the third principal component, the distribution of each Megalobrama species had overlap, indicating that the head characteristics of the three Megalobrama species were not significantly different.

[0068] Table 4. Principal component loadings of eight morphological data of three Megalobrama species populations

[0069]

[0070] 1.3 Ploidy analysis of Megalobrama species

[0071] The comparison of DNA content and chromosome morphology and number of three Megalobrama species is shown in Table 5. Figure 3No significant difference in DNA content was observed (P > 0.05). P Chromosomes were prepared by peripheral blood cell culture (PBC) (Fig. 1A, B, C, D, E, F, G, H, I), and the results showed that the chromosome numbers of the three populations were consistent, all of which were 48, i.e. diploid (2n = 48). Karyotype analysis showed that the karyotype of the three species was as follows: B. botogooensis: 24m + 20sm + 4st; B. jordani: 24m + 20sm + 4st; B. dorei: 26m + 18sm + 4st, mainly with median and submedian centromeres. Figure 3

[0072] The above research on the morphological characteristics of the three species of Acipenseriformes has preliminarily realized the rapid differentiation of the three species of Acipenseriformes. However, the morphology of the early developmental stage of Acipenseriformes is similar, and it is difficult to accurately distinguish by traditional morphological methods, so it is necessary to assist certain molecular marker technology to realize accurate identification. Microsatellite (SSR) has the advantages of stability, easy identification, high sensitivity, etc. Therefore, based on high-throughput sequencing of transcriptome, polyacrylamide gel electrophoresis (PAGE) and capillary electrophoresis technology (CE) to screen and identify microsatellite molecular markers, and combined with the morphological differences of different fish traits, the three species of Acipenseriformes can be rapidly and accurately distinguished, and a systematic germplasm identification technology of Acipenseriformes can be established, which can provide technical support for the improvement and genetic breeding of Acipenseriformes.

[0073] 2. Molecular genetic markers of Acipenseriformes

[0074] 2.1 Experimental materials

[0075] At least 30 samples of B. botogooensis (BSB), 30 samples of B. jordani (SJF) and 30 samples of B. dorei (GDF) were selected from each different population of the three species of Acipenseriformes cultured by the present application, wherein the different populations of B. botogooensis were derived from Hunan Provincial Institute of Aquatic Science, Hunan Datong Lake Fishery, Hunan Xiangjiang River Basin, Hubei Province Liangzi Lake, the different populations of B. jordani were derived from Hunan Provincial Institute of Aquatic Science, Hunan Datong Lake Fishery, Guangdong Province Shaoguan Fishery Technology Extension Station, Guangdong Province Nanshui Reservoir, were anesthetized with MS-222 (200 mg / L) for 5 min, and an appropriate amount of tail fin was cut and stored in alcohol (4°C).

[0076] 2.2 Experimental method

[0077] 2.2.1 Preparation of genomic DNA

[0078] The genomic DNA of B. botogooensis (BSB), B. jordani (SJF) and B. dorei (GDF) was extracted by Beijing Tiangen Reagent Kit, and the specific operation steps were as follows:

[0079] (1) Cut a small amount of fin of the fish into a centrifuge tube and add 200 µL GA solution, shake vortex for 15 s, and mix well;​

[0080] (2) Add 20 μΐ of Proteinase K solution to the centrifuge tube of step (1), mix well, and place in a 56°C water bath until the fish tail fin tissue is completely lysed (Note: This digestion process takes about 1 h, and needs to be mixed every 20-30 min);

[0081] (3) Add 200 μΐ of GB buffer to the centrifuge tube of step (2), mix well by inverting, and place in a 70°C water bath for 10 min (Note: After this step, the liquid in the centrifuge tube should be clear);

[0082] (4) Add 200 μΐ of anhydrous ethanol to the centrifuge tube of step (3), shake and centrifuge;

[0083] (5) Place the CB3 adsorption column into the collection tube, and transfer all the solution of step (4) including the flocculent precipitate into the CB3, centrifuge for 30 s (at 12000 rpm), and discard the waste liquid;

[0084] (6) Add 500 μΐ of GD to the adsorption column of step (5), centrifuge for 30 s (at the same speed), and discard the waste liquid;

[0085] (7) Add 600 μΐ of PW to the adsorption column of step (6), centrifuge for 30 s (at the same speed), and discard the waste liquid;

[0086] (8) Repeat step (7) once;

[0087] (9) Centrifuge the CB3 adsorption column and the collection tube of step (8) for 2 min (at the same speed), discard the collection tube, and dry the adsorption column;

[0088] (10) Transfer the completely dried CB3 adsorption column of step (9) to a new centrifuge tube, and carefully drop about 80 μΐ of eluent on the adsorption membrane, stand for 4 min, and centrifuge for 2 min (at the same speed);

[0089] (11) To improve the amount of DNA, transfer the liquid collected in the above centrifuge tube to the adsorption column above it again, stand and centrifuge at the same speed, discard the adsorption column, and temporarily store the collected liquid in a -4°C refrigerator.

[0090] Detect the concentration and quality of the extracted DNA by using an enzyme marker and TAE electrophoresis, and store the DNA (A260 / 280 = 1.8-2.0; electrophoresis is a clear and complete bright band without tailing) meeting the requirements of subsequent experiments in a -20°C refrigerator for later use.

[0091] 2.2.2 Microsatellite source and primer design

[0092] The present application obtains the transcriptome sequences of the fish of Kessler's gudgeon and yellowhead catfish based on Illumina Novaseq 6000 platform by using high-throughput sequencing technology, and detects the Unigene by using MISA (http: / / pgrc.ipk-gatersleben.de / misa / ) for SSR. According to the conservation and specificity of the two ends of SSR, 77 pairs of SSR specific primers are designed for the present application, and the microsatellite sequences are amplified by PCR technology. Part of the primer information is shown in Table 5, and all the primers are synthesized by Shanghai Shengong.

[0093] Table 5 Primers required for the experiment (the sequences are shown in SEQ No. 1-26)

[0094]

[0095] 2.2.3 PCR reaction system and amplification program

[0096] The qualified DNA in step 2.2.1 is used as a template, the reaction system (20 μL) and the program in Table 6 are used for PCR amplification, and the product is detected by 2.0-2.5% TAE electrophoresis.

[0097] Table 6 PCR reaction system and amplification program

[0098]

[0099] 2.2.4 Gel electrophoresis detection of PCR product

[0100] 2.2.4.1 Agarose gel electrophoresis detection

[0101] (1) Prepare 2.0-2.5% concentration agarose gel and place it in a TAE-containing electrophoresis tank;

[0102] (2) Carefully add the PCR amplification product in step 2.2.3 to the loading well of the agarose gel (liquid should be carefully discharged to avoid sample dispersion to other loading wells);

[0103] (3) Electrophoresis separation for about 15-20 min;

[0104] (4) Adjust the gel image to be clear by using gel imaging analysis system, take a picture and save it, and observe the size of the PCR amplification product band and whether there is a distinguished band.

[0105] 2.2.4.2 Non-denaturing PAGE electrophoresis detection

[0106] The product with the target band size in the TAE electrophoresis in step 2.2.4.1 is detected on a non-denaturing PAGE, and the specific operation is as follows:

[0107] (1) Sealing plate: melt an appropriate amount of 1.5% agarose gel in a microwave oven, and inject the agarose gel into the surrounding of a set of clean glass plates assembled in a rubber sleeve while hot with a syringe, seal to prevent glue leakage, and fix the sealed glass plate on the electrophoresis tank;

[0108] (2) Prepare 8% gel: acrylamide / methylene bisacrylamide 30% solution (29:1) 13.3 mL, 5xTBE 10 mL, ultrapure water 25.68 mL, 10% ammonium persulfate solution 1 mL, TEMED 20 µL, total volume 50 mL;

[0109] (3) Make gel: quickly inject the newly prepared gel in step (2) into the gel tank with a syringe without needle (pay attention to remove air bubbles), insert the comb (1.5 mm, 24 holes), and stand for 45~60 min;

[0110] (4) Empty running: after the gel is completely solidified, remove the comb, pour 1xTBE buffer to cover the gel, and arrange the comb holes to be neat and complete, then connect the positive and negative electrodes and turn on the power, 280 V, 300 mA, empty running for 20 min to remove impurities in the gel;

[0111] (5) Sample loading: after the empty running is completed, turn off the power, and suck 2.5 µL of PCR product, add it to the comb holes in turn, and load 1.7 µL of DNA Marker I (Tiangen pBR322 DNA / Msp I) at the desired position;

[0112] (6) Electrophoresis: 280 V, 300 mA, electrophoresis for about 1.5~2 h, and when the indicator band approaches the bottom of the gel, it represents that the electrophoresis is completed;

[0113] (7) Water washing: turn off the power, pour out the 1xTBE electrophoresis buffer in the electrophoresis instrument (the buffer can be reused), remove the gel glass plate, and rinse with tap water for 20~30 s to cool it down;

[0114] (8) Fixing: place the gel in 10% glacial acetic acid solution (about 500 mL) for 10 min to fix the band;

[0115] (9) Silver staining: transfer the gel to 0.1% AgNO3 (about 500 mL) solution for 10 min, and shake the vessel smoothly during the period to make the gel stain uniformly;

[0116] (10)Rinse: The gel was transferred to a container containing ultrapure water (about 1000 mL), and gently shaken to wash 2 times;

[0117] (11)Color development: The gel was transferred to a color developing solution (1.2% NaOH + 0.4% formaldehyde), and the developing time was adjusted according to the actual situation to ensure clear bands, and the staining should not be too deep to affect observation;

[0118] (12)After color development, the gel was placed on a white background for photography, and the microsatellite banding was recorded.

[0119] 2.2.4.3 Capillary electrophoresis detection

[0120] The microsatellite sequence was amplified by PCR technology, and the PCR product with distinguishability detected by step 2.2.4.2 was placed on a Qsep100 automatic nucleic acid protein analysis system for capillary electrophoresis to obtain the length polymorphism and genetic diversity information.

[0121] 2.3 Experimental results

[0122] 2.3.1 High-throughput sequencing data analysis

[0123] MISA (default parameters) was used to analyze the SSRs of the Unigene of the Guangdong Catfish and the Amur Catfish, and the distribution characteristics and rules of the data obtained were analyzed, such as the SSR position, the SSR core repeat sequence (SSR motif), and the SSR type, as shown in Table 1. Figure 4 The single-base repeat (p1) in the Guangdong Catfish SSRs accounted for 64.11%, the double-base repeat (p2) accounted for 22.32%, the three-base repeat (p3) accounted for 11.36%, the four-base repeat (p4) accounted for 1.87%, the five-base repeat (p5) accounted for 0.28%, and the six-base repeat (p6) accounted for 0.06% (Table 1 of A, B). Figure 4 The single-base repeat (p1) in the Amur Catfish accounted for 40.10%, the double-base repeat (p2) accounted for 35.58%, the three-base repeat (p3) accounted for 20.17%, the four-base repeat (p4) accounted for 2.42%, the five-base repeat (p5) accounted for 1.11%, and the six-base repeat (p6) accounted for 0.62% (Table 1 of C, D). Figure 4

[0124] 2.3.2 Polyacrylamide gel (PAGE) microsatellite identification analysis

[0125] ​Based on the transcriptome high-throughput sequencing, 77 pairs of microsatellite primers were screened, and 60 pairs of primers were verified to have stable amplification in the three groups of Misgurnus, with a success rate of 78%. Thirteen pairs of microsatellite primers (BF-4, BF-5, BF-6, BF-7, BF-24, BF-29, BF-31, TTF-3, TTF-8, TTF-10, TTF-20, TTF-23, TTF-32) had high interspecific compatibility and good polymorphism characteristics. Among them, three specific microsatellite primers (TTF-3, TTF-20, TTF-32) could be used to distinguish the Misgurnus groups, and each primer could at least amplify specific fragments in one group to distinguish from other groups. Figure 5 For example, primer TTF-3 amplified a specific band of Misgurnus anguillicaudatus at 130 bp, which distinguished Misgurnus anguillicaudatus from the other two groups; primer TTF-20 amplified a specific band of Misgurnus anguillicaudatus at 125 bp, which directly identified Misgurnus anguillicaudatus; and primer TTF-32 amplified a specific band of Misgurnus fossilis at 100 bp, which directly identified Misgurnus fossilis.

[0126] 2.3.3 Capillary electrophoresis microsatellite identification analysis

[0127] The PCR amplification products were further verified by capillary electrophoresis (Qsep100 automatic nucleic acid protein analysis system) to complete the SSR molecular marker identification, which could accurately distinguish the three groups of Misgurnus (Misgurnus anguillicaudatus, Misgurnus anguillicaudatus, Misgurnus fossilis). Figure 6 It also verified the stability of TTF-3 and TTF-32 microsatellite primers in different river basin groups ( Figure 7 ), and further confirmed the reliability of using polyacrylamide gel electrophoresis to screen specific primers.

[0128] 2.3.4 Hybrid individuals based on microsatellite molecular markers

[0129] Using this method, individual hybrid individuals were found in the wild Misgurnus population in Xiangjiang River Basin of Hunan Province ( Figure 8 ). Its morphological characteristics were between Misgurnus anguillicaudatus and Misgurnus fossilis, and was closer to Misgurnus fossilis, with no obvious white spots on the body scales, and the middle part was slightly lighter with gray-black edges ( Figure 8 A, B); the swim bladder was larger than the prolocule in Misgurnus anguillicaudatus and Misgurnus anguillicaudatus ( Figure 8 C, D); and it showed specific bands of Misgurnus anguillicaudatus and Misgurnus fossilis in PAGE and CE identification ( Figure 8 E, F).

[0130] 2.4 Discussion

[0131] The application takes three populations of Acipenseriformes as experimental objects, and based on high-throughput sequencing of transcriptome, polyacrylamide gel electrophoresis (PAGE) and capillary electrophoresis technology (CE), successfully screens and identifies three pairs of microsatellite markers TTF-3, TTF-20 and TTF-32, which can quickly and accurately distinguish three kinds of Acipenseriformes and their hybrid individuals, and establishes a germplasm identification technology for Acipenseriformes, avoiding misjudgment caused by similar morphology. Compared with the traditional magnetic bead method and linkage map method, the application uses high-throughput sequencing technology to greatly improve the throughput and efficiency of microsatellite marker screening, and combines capillary electrophoresis separation technology to obtain high resolution of single base pair (bp), which has high efficiency, comprehensiveness and accuracy, and strong operability, and high result reliability, and provides strong technical support for germplasm identification of Acipenseriformes.

[0132] In addition, in the screening process of microsatellite sites, it is found that the genetic relationship difference between the Acipenser schrenckii and the Acipenser oxyrhynchus is smaller, and the genetic relationship difference between the Acipenser sinensis and the two is relatively far. This is consistent with the result of the external feature discussion. The application provides a germplasm identification method for the current situation of mixed germplasm of Acipenseriformes in China, solves the problem that the early development stage of Acipenseriformes is similar in morphology and difficult to accurately identify by traditional morphological methods. It provides a new perspective for understanding the genetic diversity and genetic relationship of Acipenseriformes, and provides theoretical support for germplasm improvement and biodiversity protection.

Claims

1. A microsatellite marker identification primer for Megalobrama amblycephala, Misgurnus anguillicaudatus and Pelteobagrus vachlii, characterized in that, Three groups of primer pairs including TTF-3, TTF-20 and TTF-32: TTF-3-F: CCACCATAATAATGCAGGTGGTA; TTF-3-R: TGTATGCTTCAGCTCATTGAAAA; TTF-20-F: CTGAATCTAAGGCACCTGAAAGA; TTF-20-R: TTTCTGGTTCATTCATCACACTG; TTF-32-F: ACCCCCCTGATTTCACTAGATT; TTF-32-R: GGGTTACACCTGACTGCTGAGTA.

2. A microsatellite marker identification kit for Megalobrama amblycephala, Misgurnus anguillicaudatus and Acrossocheilus fasciatus, characterized in that, It comprises the microsatellite marker identification primer of claim 1.

3. The microsatellite marker identification kit according to claim 2, characterized in that, It also comprises 2x Taq PCR MasterMix containing dye and ddH2O.

4. A method for identifying Acipenser sturio, Acipenser oxyrhynchus and Acipenser sinensis, characterized in that, It comprises the following steps: (1) extracting genomic DNA of Megalobrama amblycephala, Misgurnus anguillicaudatus and Akysis vachellus to be tested; (2) using the microsatellite marker identification primer of claim 1 or the microsatellite marker identification kit of any one of claims 2-3 to perform PCR amplification on the DNA in step (1) as a template, and performing TAE buffer agarose gel electrophoresis detection on the PCR amplification product; (3) performing non-denaturing polyacrylamide gel electrophoresis detection on the PCR amplification product without a band and with a band size meeting the target in the TAE buffer agarose gel electrophoresis detection of step (2); (4) performing capillary electrophoresis on the PCR amplification product with a degree of differentiation in the non-denaturing polyacrylamide gel electrophoresis detection of step (3) to obtain length polymorphism and genetic diversity information; the primer pair TTF-3 amplifies a specific band of M. amblycephala at 130 bp, which distinguishes M. amblycephala from the other two groups; the primer pair TTF-20 amplifies a specific band of A. vachellus at 125 bp, which directly identifies A. vachellus; and the primer pair TTF-32 amplifies a specific band of M. anguillicaudatus at 100 bp, which directly identifies M. anguillicaudatus.

5. The method of claim 4, wherein, The TAE buffer agarose gel electrophoresis detection uses agarose gel with a mass concentration of 2.0-2.5%.

6. The method of claim 4, wherein, The gel used in the non-denaturing polyacrylamide gel electrophoresis detection comprises the following components: 13.3 mL of acrylamide / methylene bisacrylamide solution with a mass concentration of 30%, 10 mL of 5x TBE, 25.68 mL of ultrapure water, 1 mL of ammonium persulfate solution with a mass concentration of 10%, and 20 µL of TEMED; in the acrylamide / methylene bisacrylamide solution, the mass ratio of acrylamide to methylene bisacrylamide is 29:

1.

7. The method of claim 4, wherein, The capillary electrophoresis is performed on a Qsep100 full-automatic nucleic acid protein analysis system.

8. Use of the microsatellite marker identification primer of claim 1 or the microsatellite marker identification kit of any one of claims 2-3 in identifying M. amblycephala, M. anguillicaudatus and A. vachellus.

9. Use of the method of any one of claims 4-7 in identifying M. amblycephala, M. anguillicaudatus and A. vachellus.

Images