Quality control materials, applications, and kits for the detection of Plasmodium falciparum nucleic acid

By integrating the full-length sequence of the Plasmodium falciparum 18S rRNA gene into engineered Escherichia coli, a quality control material for Plasmodium falciparum nucleic acid detection was constructed. This solved the stability and tolerability issues of conventional plasmid DNA quality control materials, achieving high stability and wide applicability in nucleic acid detection.

CN120400388BActive Publication Date: 2026-05-26HANGZHOU INT TRAVEL HEALTH CARE CENT (HANGZHOU CUSTOMS PORT CLINIC) +1
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-18
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing conventional plasmid DNA quality control products are structurally unstable in the detection of Plasmodium falciparum nucleic acid, are easily affected by the external environment, leading to decreased amplification efficiency or false positive and false negative results, and lack effective nucleic acid tolerance.

Method used

Using engineered Escherichia coli carrying a recombinant artificial chromosome containing the full-length 18S rRNA gene of Plasmodium falciparum, a quality control sample for Plasmodium falciparum nucleic acid detection was constructed by integrating the engineered bacteria into the artificial chromosome through homologous recombination. The engineered bacteria's cell wall and cell membrane provide additional protection, improving the stability and tolerance of the nucleic acid.

Benefits of technology

Engineered bacterial quality control samples maintain the integrity of the target gene under adverse conditions such as high temperature and different pH values, exhibiting high stability and PCR amplification efficiency. They are suitable for nucleic acid detection methods such as real-time quantitative PCR and digital PCR, have wide applicability, and can be stored for a long time under low temperature conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120400388B_ABST
    Figure CN120400388B_ABST
Patent Text Reader

Abstract

This invention provides a quality control product, application, and kit for the detection of Plasmodium falciparum nucleic acid. The quality control product contains an engineered Escherichia coli bacterium carrying a genetically engineered recombinant artificial chromosome. The artificial chromosome integrates a target fragment containing the full-length sequence of the Plasmodium falciparum 18S rRNA gene. The full-length sequence of the Plasmodium falciparum 18S rRNA gene is a characteristic homologous sequence of Plasmodium falciparum, as shown in SEQ ID NO:1, which is artificially designed and selected. The quality control product of this invention has better stability and is easy to store. It is not only suitable for PCR detection methods such as real-time quantitative PCR and digital PCR, but also for other types of nucleic acid detection methods, demonstrating broad applicability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and gene detection technology, specifically to a quality control product for detecting nucleic acid in Plasmodium falciparum, its application, and a reagent kit. Background Technology

[0002] Plasmodium is a single-celled eukaryotic organism belonging to the class Apicomplexa, and is the primary pathogen causing malaria. The genus Plasmodium is a group of obligate intracellular parasitic protozoa with broad host adaptability. Its host lineage covers multiple evolutionary branches of vertebrates, including birds, reptiles, rodents, and primates. In human hosts, confirmed pathogenic species of the genus Plasmodium include *Plasmodium falciparum*, *Plasmodium vivax*, *Plasmodium malariae*, and *Plasmodium ovale*. Among these, *Plasmodium falciparum* (PF) is one of the most pathogenic and deadly Plasmodium species.

[0003] The genome of Plasmodium is characterized by its distinctive structure, measuring approximately 20-30 megabase pairs (Mbp) in size and comprising three parts: the nuclear genome, the mitochondrial genome, and the plasmosome genome. The nuclear genome consists of multiple chromosomes, typically 14 linear chromosomes, containing numerous repetitive sequences and regulatory elements. Furthermore, the Plasmodium genome contains abundant non-coding regions and pseudogenes, making its structure quite complex. The Plasmodium nuclear genome contains multiple copies of rRNA genes (rDNA), including the 18S rRNA gene. The 18S rRNA gene is approximately 2,000 base pairs in length, exhibits high sequence identity, and is suitable as a biomarker for detecting Plasmodium infection. Moreover, this gene shows some variation among different Plasmodium species, allowing for differentiation between different species of Plasmodium. For example, the published patent documents with application numbers CN201280072439.4, CN202010113300.6, CN202410346433.6 and CN201610800142.5 all use the 18S rRNA sequence as a target to design universal or typing nucleic acid detection kits for Plasmodium.

[0004] Nucleic acid testing is currently one of the most important methods for diagnosing malaria, especially polymerase chain reaction (PCR) technology, which is widely used due to its high sensitivity and specificity. However, in actual testing, the accuracy of the results may be affected by factors such as complex sample sources, cumbersome procedures, and inconsistent reagent quality. Therefore, establishing reliable quality control standards is crucial to ensuring the accuracy and reproducibility of test results.

[0005] Traditional quality control materials often use conventional plasmid DNA. Conventional plasmid DNA consists of small, circular, double-stranded DNA molecules carried by *E. coli* and is commonly used as a positive control. However, these conventional plasmid DNAs have limitations. First, the topological structure of conventional plasmid DNA (such as supercoiled structures) is easily affected by external environmental factors (such as temperature, pH, and enzymatic digestion), leading to structural instability. Second, during PCR testing, plasmid DNA may experience reduced amplification efficiency or false positive and false negative results due to structural abnormalities. Summary of the Invention

[0006] The purpose of this invention is to address the shortcomings of using conventional plasmid DNA to prepare quality control products, and to provide a quality control product for the detection of Plasmodium falciparum nucleic acid, which improves its stability and nucleic acid tolerance, and is easy to store.

[0007] Therefore, the present invention adopts the following technical solution:

[0008] The quality control material for detecting Plasmodium falciparum nucleic acid is characterized by containing an engineered Escherichia coli strain carrying a genetically engineered recombinant artificial chromosome, wherein the artificial chromosome integrates a target fragment containing the full-length sequence of the Plasmodium falciparum 18S rRNA gene, and the full-length sequence of the Plasmodium falciparum 18S rRNA gene is preferably the artificially designed and selected Plasmodium falciparum consensus sequence shown in SEQ ID NO:1.

[0009] In the method for preparing the engineered bacteria carrying the recombinant artificial chromosome of Plasmodium 18S rRNA gene fragment, the shuttle plasmid vector used is the shuttle plasmid vector pBac-N-EGFP (from Beyotime Biotechnology, catalog number D2805). This vector was originally used for the construction of artificial chromosomes, the packaging of baculovirus pseudoviruses, and the expression of proteins using the target gene. However, in this application, it is only used for the construction of artificial chromosomes. The full-length Plasmodium 18S rRNA gene fragment is homologously integrated into the artificial chromosome of Escherichia coli engineered bacteria through homologous recombination mediated by this shuttle plasmid vector. The construction method includes: using a seamless ligation method to ligate the Plasmodium 18S rRNA gene fragment to the shuttle plasmid vector pBac-N-EGFP, and further transforming the obtained recombinant shuttle plasmid vector into host bacteria for screening to obtain engineered bacteria carrying the recombinant artificial chromosome of Plasmodium 18S rRNA gene fragment.

[0010] In this invention, the engineered bacterial culture obtained is heat-inactivated and then diluted with phosphate buffer to form engineered bacterial quality control products containing different concentrations of recombinant artificial chromosomes containing Plasmodium 18S rRNA gene fragments. These quality control products have the following characteristics: the preparation process of the engineered bacterial quality control products retains the cell wall and cell structure of the engineered bacteria, providing a protective layer against degradation by exogenous nucleases for the internal nucleic acids, and the characteristic attribute that nucleic acid extraction is required for PCR amplification. They also have good homogeneity and stability when stored at -20°C to room temperature. The copy number concentration of the Plasmodium 18S rRNA target gene carried by the recombinant artificial chromosome in the engineered bacterial quality control products is determined by digital PCR.

[0011] The quality control material for detecting Plasmodium falciparum nucleic acid can be used in the following scenarios:

[0012] Quality control of positive detection concordance rate and accuracy in high and low concentration ranges of real-time quantitative PCR.

[0013] Establish a standard curve that meets the requirements of real-time quantitative PCR quantitative detection specifications.

[0014] This quality control sample is used for performance validation of nucleic acid extraction kits. By testing this quality control sample, the extraction efficiency and quality of the nucleic acid extraction kit can be evaluated.

[0015] It should be understood that the application of the quality control product for detecting Plasmodium falciparum nucleic acid of the present invention is not limited to this, and any commercial application of the quality control product for detecting Plasmodium falciparum nucleic acid of the present invention is within the protection scope of the present invention.

[0016] According to another aspect of the present invention, the present invention further provides a nucleic acid detection kit for Plasmodium falciparum, the kit comprising the above-mentioned quality control materials, PCR reaction solution, Taq enzyme, and primers and probes with sequences as shown in SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. The quality control materials are preferably room temperature storable, and the Taq enzyme is also preferably room temperature storable, facilitating the transportation and use of the kit. The quality control materials contained in the kit can be serially diluted at least six times (10-fold) to establish a standard curve that meets the requirements of real-time quantitative PCR, achieving accurate quantitative detection.

[0017] The quality control material for detecting Plasmodium falciparum nucleic acid provided by this invention inserts the optimized full-length 18S rRNA gene sequence of Plasmodium into the artificial chromosome of engineered bacteria, enabling it to stably replicate and propagate within the engineered bacteria. This engineered bacteria form of quality control material has the following significant technical advantages:

[0018] (1) The engineered bacterial artificial chromosome for malaria parasite nucleic acid detection involved in this invention better simulates the nucleic acid extraction process in real samples than plasmids and synthetic DNA, and is more suitable for use as a quality control product for nucleic acid detection;

[0019] (2) Compared with plasmids, the engineered bacteria artificial chromosome prepared by this invention is less prone to nucleic acid topological structures (such as supercoiled structures), is suitable for inserting long fragments, and has high stability. Even under high temperature, different pH values ​​or other adverse conditions, the engineered bacteria can still maintain the integrity of the target gene and its PCR amplification efficiency.

[0020] (3) Each engineered bacterium carries only 1-2 copies of artificial chromosome, and the exogenous DNA is not easily rearranged or lost, making it more stable compared to the hundreds of copies of a general plasmid;

[0021] (4) The presence of the cell wall and cell membrane of the engineered bacteria of the present invention provides an extra protective layer for the internal nucleic acid, making it less susceptible to degradation by exogenous nucleases during the preparation process, which is far superior to the plasmid form.

[0022] (5) Engineered bacteria can be used to obtain a large number of target quality control products through simple culture and amplification. In addition, engineered bacteria can be stored for a long time at low temperature without losing their activity, which is convenient for large-scale production and transportation.

[0023] (6) Quality control products in the form of engineered bacteria are not only applicable to PCR detection (such as real-time quantitative PCR, digital PCR, etc.), but can also be used in other types of nucleic acid detection methods, and have wide applicability. Attached Figure Description

[0024] Figure 1 This is an electrophoresis diagram of the amplification of the target gene PF-18S-M fragment in Example 2 of the present invention.

[0025] Figure 2 This is a bacterial culture PCR electrophoresis image of the pBac-PF-18S-M plasmid vector in Example 2 of the present invention.

[0026] Figure 3 The image shows the pBac-PF-18S-M plasmid vector constructed in Example 2 of this invention, with only elements relevant to this application labeled.

[0027] Figure 4 This is an electrophoresis diagram of PCR amplification of the DNA of the engineered bacteria carrying artificial chromosomes in Example 3 of the present invention.

[0028] Figure 5 This is the PCR sequencing identification result of the engineered bacterial DNA carrying artificial chromosomes in Example 3 of the present invention.

[0029] Figure 6 The results of the treatment of Plasmodium falciparum quality control material and plasmid nuclease in Example 6 of this invention are shown.

[0030] Figure 7This is the verification result of the extraction and monitoring capability of Plasmodium falciparum quality control material and plasmid (E6 copies / mL) in Example 7 of the present invention.

[0031] Figure 8 This is the verification result of the extraction and monitoring capability of Plasmodium falciparum quality control material and plasmid (E3 copies / mL) in Example 7 of the present invention.

[0032] Figure 9 The results show the statistical results of the Ct values ​​of the quality control samples and plasmids of Plasmodium falciparum engineered bacteria in Example 8 of this invention, which are stored at 4°C.

[0033] Figure 10 The results show the statistical results of the Ct values ​​of the quality control samples and plasmids of Plasmodium falciparum engineered bacteria in Example 8 of this invention, which are stored at 25°C.

[0034] Figure 11 The results show the statistical results of the Ct values ​​of the quality control samples and plasmids of Plasmodium falciparum engineered bacteria in Example 8 of this invention, stored at 37°C.

[0035] Figure 12 The results show the linearity and amplification efficiency of the engineered Plasmodium falciparum strain and plasmid in Example 9. Detailed Implementation

[0036] The following describes embodiments of the present invention, but the present invention is not limited thereto. The present invention is not limited to the various configurations described below, and various modifications can be made within the scope of the claims. Embodiments and examples obtained by appropriately combining the technical means disclosed in different embodiments and examples are also included in the technical scope of the present invention.

[0037] definition:

[0038] In this invention, the range of values ​​represented by "value A ~ value B" or "value A - value B" refers to the range that includes the endpoint values ​​A and B.

[0039] In this invention, the numerical range indicated by "above" or "below" refers to the numerical range that includes the stated number.

[0040] In this invention, the word "may" has both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the case where the event occurs and the case where the event does not occur.

[0041] In this invention, the terms “a”, “an”, or “the” can mean “one”, “one or more”, “at least one”, or “one or more”.

[0042] In this invention, the terms "comprising," "having," "including," or "containing" can mean included or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising," "having," "including," or "containing" can also mean closed-ended, excluding additional, uncited elements or method steps.

[0043] In this invention, the term "about" can mean that a value includes the standard deviation of the error of the apparatus or method used to determine that value. The numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains a standard deviation due to the aforementioned testing apparatus or method. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this invention are modified with "about". Here, "about" generally means that the actual value is within ±10%, ±5%, ±1%, or ±0.5% of a particular value or range.

[0044] In this invention, "target gene" refers to the gene targeted by nucleic acid detection. For example, when nucleic acid detection is performed using PCR, the target gene includes the gene fragment to be amplified by PCR.

[0045] In this invention, a "vector" is a replicon, such as a plasmid, bacteriophage, virus, artificial chromosome, or granule, to which another DNA segment (i.e., an "insertion") may be attached to the replicon to induce replication of the attached segment in the cell. Further, the vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; (2) a structural or coding sequence transcribed into mRNA and translated into protein; and (3) a transcriptional subunit containing appropriate transcription and translation initiation and termination sequences.

[0046] In this invention, the shuttle plasmid vector pBac-N-EGFP (from Beyotime Biotechnology, catalog number D2805) is originally used for the construction of artificial chromosomes, packaging of baculovirus pseudoviruses, and protein expression using target genes. However, in this application, it is only used to mediate the homologous recombination and integration of target fragments into the artificial chromosome of engineered Escherichia coli. This vector has the E. coli replication origin and selection marker, and can survive and replicate in E. coli. Furthermore, "engineered bacteria carrying artificial chromosomes" refers to engineered E. coli bacteria carrying the 18S homologous sequence of the Plasmodium falciparum (PF) target gene.

[0047] In this invention, "consistent sequence" or "optimized sequence" or "consistent optimized sequence" refers to a representative nucleotide sequence generated by performing site-specific statistical analysis on a set of functional or evolutionarily related nucleotide sequences using multiple sequence alignment (MSA) technology.

[0048] In this invention, "standard curve conforming to the requirements of real-time quantitative PCR quantitative detection specifications" refers to...

[0049] By serially diluting standards of known concentrations (such as plasmid DNA or purified PCR products), and then amplifying them using real-time quantitative PCR, a linear relationship curve is established between the cycle threshold (Ct value) and the logarithm of the initial template concentration. This standard curve must meet the requirements of the specification "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods: qPCR and dPCR" (GB / T42077-2022), namely, a linear correlation coefficient (R²) > 0.99 and an amplification efficiency (E) within the range of 0.9 to 1.1, to verify the accuracy, sensitivity, and quantitative reliability of the detection system.

[0050] Unless otherwise defined, other technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0051]

[0052] The nucleotide sequence of primer PF-18S-MF (SEQ ID NO:2): TCCAGGGTCCTAGATCTGAATTCTAATGATCCTTCCGCAGGTTCAC.

[0053] The nucleotide sequence of primer PF-18S-MR (SEQ ID NO:3): CTCTAGTACTTCTCGACAAGCTTAACCTGGTTGATCTTGCCAGT.

[0054] pUC / M13-F primer sequence (SEQ ID NO:4): CCCAGTCACGACGTTGTAAAACG.

[0055] pUC / M13-R primer sequence (SEQ ID NO:5): AGCGGATAACAATTTCACACAGG.

[0056] The upstream primer sequence for fluorescent PCR (SEQ ID NO:6): TATGCTTTTATTGCTTTTGAGAGG.

[0057] The downstream primer sequence for fluorescent PCR (SEQ ID NO:7): GCTTATTCATATTTGTTATTCCATGCTG.

[0058] The probe sequence for fluorescent PCR (SEQ ID NO:8): CATGACTACCCGTCTGTTATGAACACTT.

[0059] The method for preparing artificial chromosomes of engineered bacteria is as follows:

[0060] (1) Obtaining the full-length identical sequence of 18S rRNA from Plasmodium falciparum (PF) and digesting and recovering the pBac vector

[0061] First, the full-length 18S rRNA gene of PF was optimized and analyzed. The obtained consistent sequence was named PF-18S-M, which is the sequence shown in SEQ ID NO:1, with a length of 2150 bp. The fragment was amplified using specific primers (named PF-18S-MF / R, sequences shown in SEQ ID NO:2 and SEQ ID NO:3) and Q5 enzyme (NEB, catalog number M0493L). Simultaneously, the pBac-N-EGFP vector (Beyotime Biotech, catalog number D2805) was digested with EcoRI and Hind III restriction endonucleases. The digestion system consisted of 5 μL of 10×M buffer, 1 μL each of EcoRI and Hind III restriction endonucleases, 1.5 μg of plasmid, and ddH2O added to a 50 μL reaction volume. Digestion was carried out at 37°C for 3 h. The amplified fragments PF-18S-M and the pBac-N-EGFP linear vector were purified and recovered using a Takara gel extraction kit (Takara BioInc, catalog number 9762).

[0062] (2) Ligation of the 18S rRNA fragment of the PF gene with the pBac-N-EGFP linear vector

[0063] The purified and recovered PF-18S-M fragment was seamlessly ligated into the pBac linear vector to construct the pBac-PF-18S-M plasmid vector. The ligation system consisted of 2 μL of 5×In-Fusion HD Enzyme Premix, 2 μL of pBac linear vector, 2 μL of the gel-recovered PF-18S-M fragment, and 4 μL of ddH2O, forming a 10 μL reaction mixture. Ligation was carried out at 50°C for 15 min. (The In-Fusion HD Enzyme Premix was sourced from Takara Bio Inc., catalog number 638911).

[0064] (3) Transformation and extraction of pBac-PF-18S-M plasmid vector

[0065] DH5α (Takara Bio Inc., catalog number 9057) was selected as the competent strain. This competent strain was transformed using the aforementioned ligation product and inoculated into ampicillin (Amp)-resistant LB agar plates, incubated overnight at 32-37 °C. Clones that survived and amplified due to the Amp resistance tag on the plasmid were considered successfully transformed. The plasmid was isolated using alkaline lysis extraction, purified by ion-exchange column chromatography, TE buffer elution, and endotoxin removal. Positive clones were identified using PCR. After successful sequencing identification, the next experimental step was performed.

[0066] (4) Construction of artificial chromosomes of engineered bacteria

[0067] The pBac-PF-18S-M plasmid vector was added to *E. coli* DH10Bac competent cells (Beyotime Biotechnology Co., Ltd., catalog number D0346) containing the vector bMON14272 and a helper plasmid (used to express the transposable protein necessary for transposition). Transformation of this strain with the pBac recombinant plasmid resulted in transposition between the mini-Tn7 element in the pBac recombinant plasmid and the mini-attTN7 element on the vector bMON14272, thus forming a recombinant artificial chromosome. Site-specific transposition disrupts the host's lacZα gene, allowing for blue-white screening of recombinant clones. Homologous recombination was then performed in DH10Bac bacterial cells after a treatment involving ice bath-heat shock-ice bath followed by shaking at 37°C for 4 hours. The cultured bacterial suspension was evenly spread onto LB fixation medium containing Kan, tetracycline, gentamicin, X-Gal, and IPTG (Shanghai Sangon Biotech Co., Ltd., catalog number B541007), and incubated at an incubator to screen for homologous recombinant artificial chromosome clones. Positive white monoclonal colonies were picked and incubated on LB liquid medium containing Kan, tetracycline, and gentamicin at 37°C to obtain engineered bacteria carrying homologous recombinant artificial chromosomes.

[0068] DNA was extracted from engineered bacteria carrying artificial chromosomes using the Omega BAC / PAC Large Basic Plasmid Extraction Kit (Omega Bio-Tek, catalog number D2156). The DNA was used as a template, and PCR amplification and sequencing of the bacterial strain were performed using pUC / M13-F (sequence shown in SEQ ID NO:4) and pUC / M13-R (sequence shown in SEQ ID NO:5) as primers. After successful PCR identification and sequencing alignment, the bacterial strain was preserved, and glycerol-containing bacteria were prepared for further experiments.

[0069] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified, specific conditions in the examples are performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all materials and instruments used are conventional products that can be purchased.

[0070] Example 1: Malaria parasite sequence optimization

[0071] 1.1 Selection and design of 18S rRNA gene sequences of Plasmodium falciparum (PF): First, 18S rRNA gene sequences of different geographical isolates of Plasmodium falciparum (such as African 3D7 strain, Southeast Asian K1 strain and Yunnan border strain) were obtained from the authoritative database NCBI using bioinformatics methods. The selected sequences were then subjected to multiple alignment using the multiple sequence alignment tools MAFFT and Clustal Omega software to remove obvious insertion and deletion regions, ensuring the accuracy and consistency of the alignment. Attention was paid to avoiding crossover with host or other non-target pathogen sequences in characteristic conserved regions.

[0072] 1.2 Synthesis of Plasmodium falciparum 18S rRNA gene sequence: The final optimized full-length 18S rRNA sequence of Plasmodium falciparum, abbreviated as PF-18S-M, was obtained by aligning the full-length 18S rRNA sequences of multiple Plasmodium falciparum isolates. Genome assembly was performed according to the start and stop sites of the 18S rRNA gene, resulting in a 2150 bp sequence (SEQ ID NO:1). This sequence was sent to GenScript Biotech Co., Ltd. for synthesis, yielding a conventional pUC plasmid (named pUC57-PF-18S-M) containing a consistent target fragment of the full-length 18S rRNA from Plasmodium falciparum. Primers PF-18S-MF / R (SEQ ID NO:2 and SEQ ID NO:3) were designed for plasmid vector construction, as shown in Table 1 below.

[0073] Example 2: Construction of the pBac-PF-18S-M plasmid vector of Plasmodium falciparum

[0074] 2.1 PCR amplification, purification, and recovery of the optimized 18S sequence of Plasmodium falciparum

[0075] Table 1. Nucleotide sequences of amplification primers for PF-designed sequences.

[0076]

[0077] The synthesized PF fragment, with a length of 2150 bp, was amplified by PCR using the primers in Table 1, as shown in SEQ ID NO:1. The PCR reaction system is shown in Table 2 below:

[0078]

[0079] The PCR reaction procedure is shown in Table 3 below.

[0080]

[0081] After the reaction, the amplification products were subjected to agarose gel electrophoresis, such as... Figure 1 As shown. The target fragment was purified and recovered using the Takara gel recovery kit.

[0082] 2.2 Preparation of the linear vector pBac-N-EGFP for plasmids

[0083] The plasmid pBac-N-EGFP was double-digested with restriction endonucleases Hind III and EcoRI. The digestion reaction system is shown in Table 4 below.

[0084]

[0085] The enzyme digestion reaction procedure is shown in Table 5 below:

[0086]

[0087] The linear vector pBac-N-EGFP was purified and recovered using a Takara gel recovery kit and used for fragment ligation.

[0088] 2.3 Ligation of linear vector with target fragment

[0089] Using Takara's In-Fusion® HD Cloning Plus homologous recombination kit, the target fragment PF-18S-M (SEQ ID NO:1) was seamlessly ligated into the linear vector pBac-N-EGFP. The 10 μL reaction mixture is shown in Table 6 below, and ligation was performed at 50 °C for 15 minutes.

[0090]

[0091] 2.4 Transformation

[0092] The ligation product was added to Takara competent E. coli DH5α competent cells and gently mixed. After incubating on ice for 10-30 minutes, the cells were placed in a 42 °C water bath for 30-60 seconds, then immediately removed and placed on ice for 2-5 minutes. 700 μL of SOC medium (pre-incubated at 37 °C) was added, and the cells were incubated at 37 °C with shaking for 1 hour (180 rpm). An appropriate amount was then spread onto LB solid medium (ampicillin, Amp, final concentration 100 μg / mL), and the plates were incubated upside down at 37 °C overnight.

[0093] 2.5 Identification of positive plasmids

[0094] Four single-clone bacteria were selected for bacterial culture PCR. The primers are shown in Table 7 below:

[0095]

[0096] The PCR reaction system is shown in Table 8 below:

[0097]

[0098] The PCR reaction procedure is shown in Table 9 below:

[0099]

[0100] After the reaction, a small amount of the amplification product was taken for agarose gel electrophoresis. The results showed that all four clones produced bands with a 2150 bp sequence (e.g., Figure 2 (As shown). Sequencing analysis of clone #1 confirmed that the sequence contained in the positive clone was identical to the PF-18S-M sequence, and it was named the pBac-PF-18S-M plasmid vector. The diagram is shown below. Figure 3 As shown.

[0101] Example 3: Construction and PCR Verification of Engineered Bacteria Carrying Artificial Chromosomes

[0102] 3.1 Construction of engineered bacteria carrying artificial chromosomes:

[0103] Add 100 ng of pBac-PF-18S-M plasmid to competent DH10Bac cells and incubate on ice for 30 min. Heat shock in a 42 ℃ water bath for 50-100 s, then immediately place on ice for 2-5 min. Add 700 μL of LB medium and incubate at 37 ℃ with a shaker at 200 rpm for 2-4 h. Spread 200 μL of the cultured bacterial solution evenly onto LB fixation medium containing 50 μg / mL Kan, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plates and incubate at 37 ℃ for 24-72 h.

[0104] Select positive white monoclonal colonies and place them into 3-5 mL of LB liquid medium containing 50 μg / mL Kan, 7 μg / mL tetracycline, and 10 μg / mL gentamicin. Incubate at 37 ℃ and 200 rpm for 20-30 h. Extract artificial chromosome DNA (i.e. DNA containing the PF-18S-M sequence) from the engineered bacteria using the Omega BAC / PAC large basic plasmid extraction kit.

[0105] 3.2 PCR verification of engineered bacteria using artificial chromosomes:

[0106] Using 1 μg of engineered bacterial artificial chromosome DNA as a template, PCR verification and sequencing were performed using pUC / M13-F (CCCAGTCACGACGTTGTAAAACG) (SEQ ID NO:4) and pUC / M13-R (AGCGGATAACAATTTCACACAGG) (SEQ ID NO:5) as primers. After confirming the PCR identification and sequencing alignment were correct, the next step of the experiment was performed. The PCR verification system was as follows: 25 μL of 2×T5 buffer, 23 μL of ddH2O, 1 μL each of 10 μmol / L pUC / M13 upstream primers, and 1 μg of artificial chromosome DNA.

[0107] The PCR amplification reaction conditions are shown in Table 10 below:

[0108]

[0109] PCR verification results of the engineered bacteria's artificial chromosome DNA are as follows: Figure 4 As shown, the product is 4500 bp and contains the target gene and part of the vector linker region sequence. The PCR product was sequenced, as shown... Figure 5 As shown, the sequencing results are correct, indicating that the engineered bacteria carrying the artificial chromosome were successfully constructed.

[0110] Example 4: Preservation and Use of Engineered Bacterial Strains Carrying Artificial Chromosomes

[0111] 4.1 Preservation of engineered bacterial strains carrying artificial chromosomes:

[0112] First, prepare the bacterial culture preservation solution: aliquot and sterilize glycerol and LB liquid medium to prepare LB medium with a final concentration of 50 μg / mL Kan, 7 μg / mL tetracycline, and 10 μg / mL gentamicin, and use it to dilute the glycerol (ratio 1:1); take 500 μL of the bacterial culture for preservation, add 500 μL of diluted glycerol, mix well, place in a 1.5 mL EP tube, and label with the strain number, strain name, preservation date, operator, and other information; then store the glycerol culture backup in a -80 ℃ freezer.

[0113] 4.2 Instructions for using engineered bacteria carrying artificial chromosomes:

[0114] Remove the glycerol bacteria and rewarm them at room temperature or 2-8°C until thawed. Spread a small amount of the bacterial suspension onto a plate and incubate in LB broth containing 50 μg / mL Kan, 7 μg / mL tetracycline, 10 μg / mL gentamicin, 40 μg / mL X-Gal, and 40 μg / mL IPTG. Invert the plate and incubate at 37°C for 24-48 h. Pick positive white monoclonal colonies and transfer them to 3-5 mL of LB liquid broth containing 50 μg / mL Kan, 7 μg / mL tetracycline, and 10 μg / mL gentamicin. Incubate at 37°C and 200 rpm for 20-30 h. The bacterial suspension is used to extract artificial chromosome DNA for subsequent quality control testing.

[0115] Example 5: Preparation and Production of Raw Materials and Finished Products for Engineered Microorganism Quality Control Products

[0116] 5.1 Heat inactivation of engineered bacterial cultures carrying artificial chromosomes

[0117] Place the centrifuge tubes containing the engineered bacterial culture into a 60 °C water bath. Ensure a tight seal to prevent leakage during heating. After heating for 1 hour, remove the inactivated culture as raw material for quality control of the engineered bacteria.

[0118] 5.2 Extraction and preparation of bacterial artificial chromosome DNA

[0119] The engineered bacterial control samples were serially diluted with phosphate-buffered saline to obtain sufficient concentrations of engineered bacteria. Nucleic acid was extracted from the engineered bacterial control samples at different concentrations using the MagaBio plus Viral DNA / RNA Purification Kit (Hangzhou Bori Technology Co., Ltd., catalog number BSC86S1E). Following the kit instructions, purified nucleic acid solutions were finally obtained.

[0120] 5.3 Digital PCR (ddPCR) Assay

[0121] Using the extracted nucleic acid as a template, prepare a reaction system containing the nucleic acid template, ddPCR reaction premix, primers, and probes, referring to the finished kit. Ensure the proportions of each component are accurate. Transfer the prepared reaction system to a digital PCR instrument for testing (ddPCR reaction system and conditions are shown in Tables 11 and 12). Directly obtain the absolute concentration of the target nucleic acid in the sample, and then calculate the nucleic acid concentration in the engineered bacterial quality control sample.

[0122]

[0123]

[0124] 5.4 Preparation of engineered microbial quality control products

[0125] The raw material of Plasmodium falciparum quality control sample with known concentration was diluted to obtain the finished product of engineered Plasmodium falciparum quality control sample with different concentrations as required.

[0126] Example 6: Verification of nuclease tolerance in engineered bacterial quality control samples

[0127] The engineered bacterial control samples prepared in Example 5 and the pUC57-PF-18S-M conventional plasmid from Example 1 (hereinafter referred to as plasmids) (both E8 copies / mL) were digested with Thermo #EN0521 DNase I at 37℃ for 30 min (working concentration: 0.1 U per ng of nucleic acid), followed by inactivation at 70℃ for 10 min. A control group without any treatment was also included, with each group tested in duplicate. The samples were then cumulatively diluted 100-fold and subjected to Q-PCR detection (Q-PCR reaction system and conditions are shown in Tables 13 and 14), with each sample tested twice. The results are as follows: Figure 6 As shown in Table 15, there was no difference in the Q-PCR results of the engineered bacterial control samples before and after DNaseI digestion, while the results of the plasmids before and after DNaseI digestion were very different. This indicates that the engineered Plasmodium falciparum control samples prepared in this invention have superior nuclease tolerance, which is much higher than that of conventional plasmids.

[0128]

[0129]

[0130]

[0131] Example 7: Verification of the ability of engineered bacterial quality control samples to monitor nucleic acid extraction

[0132] Nucleic acid extraction and non-extraction comparison tests were performed on engineered Plasmodium falciparum bacteria quality control samples with concentrations of 5.00E+06 copies / mL and 5.00E+03 copies / mL and pUC57-PF-18S-M plasmid, respectively (qPCR reaction conditions were the same as in Example 6). The results are shown in Table 16. Figure 7 , 8 As shown, the quality control product of engineered Plasmodium falciparum can only be detected after nucleic acid extraction; it cannot be detected without nucleic acid extraction. However, the plasmid can be detected regardless of whether nucleic acid extraction is performed, and the Ct value is the same. This indicates that the quality control product of engineered Plasmodium falciparum prepared in this invention can effectively monitor the nucleic acid extraction process, which is not possible with conventional plasmids.

[0133]

[0134] Example 8: Stability test of engineered microbial quality control samples

[0135] Referring to standard JJF1343-2022 "Assignment and Homogeneity and Stability Assessment of Standard Reference Materials", stability was assessed at five time points: 0 days, 3 days, 5 days, 9 days, and 14 days, stored at three different temperatures: 4℃, 25℃, and 37℃. Two units were sampled from each temperature at each time point, and qPCR was used for detection (qPCR reaction conditions were the same as in Example 6). Each unit was tested twice. The test results are shown in Tables 17, 18, and 19. Figure 9 , 10 The quality control samples of *Plasmodium falciparum* prepared in this invention showed no significant differences in stability after storage at different temperatures; however, the Ct of the plasmid decreased after storage at 4℃, and gradually increased after storage at 25℃ and 37℃. This indicates that the quality control samples of *Plasmodium falciparum* prepared in this invention have outstanding and excellent stability, while conventional plasmids have poor stability.

[0136]

[0137]

[0138]

[0139] Example 9: Linearity and amplification efficiency of engineered bacterial quality control samples

[0140] The engineered bacterial control sample and pUC57-PF-18S-M plasmid were serially diluted 1E+09 copies / mL to a starting concentration of 6 10-fold to obtain a series of serially diluted products. Nucleic acid extraction and qPCR detection were performed (qPCR reaction conditions were the same as in Example 6), with two replicates per concentration. The results are shown in Table 20. Figure 12 As shown, according to the "Performance Evaluation Requirements for Biotechnology Nucleic Acid Target Sequence Quantification Methods (qPCR and dPCR)" (GB / T 42077-2022), the linear correlation coefficient and amplification efficiency of the engineered bacteria quality control samples both met the standards (R0). 2 The amplification efficiency E is >0.99 (with amplification efficiency E in the range of 0.9–1.1), while the amplification efficiency E of the plasmid is 1.31, significantly exceeding the standard range. This shows that the engineered Plasmodium falciparum quality control sample prepared in this invention has good linearity and amplification efficiency, and is more suitable for quality control or quantitative detection research of Plasmodium falciparum nucleic acid detection than conventional plasmids.

[0141]

[0142] Example 10: Application of engineered microbial quality control products

[0143] The engineered Plasmodium falciparum quality control material prepared by this invention can be used as a standard reference material to monitor the detection limit (as shown in Table 21), accuracy, precision, and sensitivity of the reagent kit; it can also serve as an internal control to help determine the reliability of the detection results; and for some quantitative detection kits, it can be used to plot standard curves. This demonstrates that the engineered bacterial quality control material of this invention plays a crucial role in the reagent kit and also helps improve the operational skills of laboratory personnel and the quality control level of the laboratory.

Claims

1. A quality control product for the nucleic acid detection of Plasmodium falciparum, characterized in that, The invention comprises an engineered Escherichia coli strain carrying a genetically engineered recombinant artificial chromosome, wherein the artificial chromosome integrates a target fragment containing the full-length sequence of the Plasmodium falciparum 18S rRNA gene, and the full-length sequence of the Plasmodium falciparum 18S rRNA gene is a characteristic sequence of Plasmodium falciparum selected by artificial design as shown in SEQ ID NO:

1.

2. The quality control material for detecting Plasmodium falciparum nucleic acid according to claim 1, characterized in that, The full-length identical sequence of the Plasmodium falciparum 18S rRNA gene was integrated into the artificial chromosome of engineered Escherichia coli via homologous recombination mediated by a shuttle plasmid vector. The construction method includes: The 18S rRNA gene fragment of Plasmodium was ligated to a shuttle plasmid vector using a seamless ligation method. The resulting recombinant shuttle plasmid vector was then transformed into host bacteria for screening to obtain engineered bacteria carrying recombinant artificial chromosomes of the 18S rRNA gene fragment of Plasmodium.

3. The quality control material for detecting Plasmodium falciparum nucleic acid according to claim 2, characterized in that, The engineered bacterial cultures obtained were heat-inactivated and then diluted with phosphate buffer to form quality control products containing different concentrations of artificial chromosomes carrying the full-length, homologous sequence of Plasmodium 18S rRNA. The quality control products were prepared while retaining the characteristic properties of the engineered bacterial cell wall and cell structure, which provide a protective layer against exogenous nuclease degradation of the internal nucleic acids and require nucleic acid extraction for PCR amplification. They also exhibited good homogeneity and stability when stored at -20°C to room temperature. The copy number concentration of the Plasmodium 18S rRNA target gene carried by the recombinant artificial chromosome in the engineered bacterial quality control products was determined by digital PCR.

4. The application of the quality control product according to any one of claims 1-3, characterized in that, Applicable to the following scenarios: (1) Quality control of positive detection concordance rate and accuracy in high and low concentration ranges of real-time quantitative PCR; (2) Establish a standard curve that meets the requirements of real-time fluorescence quantitative PCR quantitative detection specifications; (3) Performance verification of the nucleic acid extraction kit.

5. A nucleic acid detection kit for Plasmodium falciparum, characterized in that, The kit comprises the quality control material as described in any one of claims 1-3, PCR reaction solution, Taq enzyme, and primers and probes with sequences as shown in SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8; the quality control material contained in the kit can be serially diluted at least 6 times to establish a standard curve that meets the requirements of real-time quantitative PCR quantitative detection specifications, thereby achieving accurate quantitative detection.

Citation Information

Patent Citations

  • Methods, compositions and kits for high-throughput detection of malaria parasites

    CN104284986B

  • Primer group and kit for detecting blood parasites by multi-PCR

    CN106319060A

  • Primer combination and kit for distinguishing plasmodium species

    CN117947199A

  • Fungal artificial chromosomes, compositions, methods and uses therfor

    CN107574178A

  • Quality control product for detecting DNA mutation of circulating tumor and preparation method of quality control product

    CN110578002A