Primer probe combination, kit, method and application for simultaneously detecting chicken infectious anemia virus and chicken circumvirus 3 based on fluorescent raa

Abstract

The present application relates to the technical field of avian virus detection, and specifically discloses a primer probe combination, a kit, a method and an application for simultaneously detecting chicken infectious anemia virus and chicken circle virus 3 based on fluorescence RAA. The present application can simultaneously detect chicken infectious anemia virus and chicken circle virus 3, has the advantages of simple operation, short detection time, good specificity, high sensitivity, no need for expensive instruments and equipment, support for on-site rapid detection, suitability for large-scale popularization and application, and can provide effective technical support for rapid detection and screening of chicken infectious anemia virus and chicken circle virus 3.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of avian virus detection, and particularly relates to a primer probe combination, a kit, a method and an application for simultaneously detecting chicken infectious anaemia virus and chicken gyrovirus 3 based on fluorescence RAA. BACKGROUND

[0002] Chicken infectious anaemia virus (CIAV) and chicken gyrovirus 3 (GyV3) can both cause aplastic anemia and immunosuppression in chickens, and often co-infect with other pathogens, so the detection of the two viruses is challenging in clinical practice.

[0003] Chicken infectious anaemia virus has been detected almost worldwide since it was first reported in Japan in 1979, and has caused huge economic losses. Chicken infectious anaemia virus mainly attacks bone marrow hematopoietic tissue and central immune organs such as thymus, and the clinical symptoms are aplastic anemia and generalized lymphoid tissue atrophy. Chickens are the only recognized natural host and can infect chickens of all ages, but the disease is often seen in 2-3 week-old chicks. Infection with chicken infectious anaemia virus alone or with other pathogens will cause immunosuppression in the body, and secondary diseases. Chicken infectious anaemia virus can be horizontally transmitted and vertically transmitted. In addition, chicken infectious anaemia virus can also be transmitted through contaminated live poultry vaccines. Therefore, in terms of prevention and control, a specific method for detecting chicken infectious anaemia virus is particularly important.

[0004] Chicken gyrovirus 3 (Gyrovirus 3, GyV3) is the third member of the Gyrovirus genus after chicken infectious anaemia virus. The virus was first discovered in the feces of children with acute gastroenteritis in Chile in 2012, and was subsequently detected in feces of ferrets, wild birds, commercial chickens and pet cats, indicating that its host range is wide. Studies have found that chicken infectious anaemia virus and chicken gyrovirus 3 can co-infect poultry flocks, and can synergistically promote immune suppression, pathogenicity and viral replication in co-infected chickens. Given the harm caused by the two viruses to the poultry industry, it is urgent to establish a rapid and sensitive detection system for rapid detection on site.

[0005] Currently, the detection methods of viral pathogens mainly include conventional PCR, qPCR, etc., but these methods need complex thermal cycler, which limits their application in medical resource shortage and on-site detection. Compared with them, the isothermal amplification technology such as fluorescent RAA (Recombinase aided amplification, RAA) has the advantages of short detection time, no need for expensive instruments and equipment, suitable for on-site rapid detection and large-scale popularization and application. For example, the patent application with publication number CN 114959120 A discloses a primer probe set for detecting chicken infectious anemia virus by RAA fluorescence method, a kit and its application. However, the patent application only realizes the detection of chicken infectious anemia virus, and cannot simultaneously detect chicken infectious anemia virus and chicken circle virus 3. Compared with single detection, double RAA can simultaneously detect two pathogens, so it has the advantages of higher efficiency and lower cost. However, due to many influencing factors, such as the sensitivity and specificity of the detection are not as good as the single detection. In order to realize the simultaneous rapid and efficient diagnosis of chicken infectious anemia virus and chicken circle virus 3, the present study establishes a rapid diagnosis method based on RAA technology, aiming to establish a double fluorescent RAA detection technology with specificity and sensitivity not inferior to single detection, short amplification time, simple operation, no need for special instruments and professional laboratory, which is convenient for on-site constant temperature rapid detection, and easier to apply in clinical practice, and provides a new technical means for on-site detection of chicken infectious anemia virus and chicken circle virus 3. SUMMARY

[0006] In view of the above shortcomings, the present application provides a primer probe combination for simultaneously detecting chicken infectious anemia virus and chicken circle virus 3 based on fluorescent RAA, a kit, a method and an application, which can simultaneously detect chicken infectious anemia virus and chicken circle virus 3, has the advantages of simple detection method, high sensitivity, no need for expensive instruments and equipment, short detection time, and is suitable for large-scale popularization and application, and the specific technical scheme is as follows:

[0007] The primer probe combination for simultaneously detecting chicken infectious anemia virus and chicken circle virus 3 based on fluorescent RAA comprises the following primer probe set:

[0008] The primer probe set for detecting chicken infectious anemia virus comprises a primer pair consisting of an upstream primer RAA-C-F2 as shown in SEQ ID NO. 2 and a downstream primer RAA-C-R1 as shown in SEQ ID NO. 5, and a RAA-C-P probe as shown in SEQ ID NO. 9; the specific sequence is as follows:

[0009] The upstream primer RAA-C-F2 is 5'-TCACTCTATCGCTGTGTGGCTGCGCGAATG-3' (SEQ ID NO. 2);

[0010] Downstream primer RAA-C-R1: 5'-TTCTTCGAGGGAGGCTTGGGTTGATCGG-3' (SEQ ID NO. 5);

[0011] RAA-C-P probe:

[0012] 5'-GGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGG-3' (SEQ ID NO. 9);

[0013] The primer probe set for detecting chicken circovirus type 3 is composed of an upstream primer RAA-G-F1 as shown in SEQ ID NO. 10, a downstream primer RAA-G-R3 as shown in SEQ ID NO. 16, and a RAA-G-P probe as shown in SEQ ID NO. 18; the specific sequences are as follows:

[0014] Upstream primer RAA-G-F1: 5'-TCAACCCACATCCGGGATCTTACCTGGT-3' (SEQ ID NO. 10);

[0015] Downstream primer RAA-G-R3: 5'-CCTTTAGTTGTGTCTGGTAAGTAGCTTGTG-3' (SEQ ID NO. 16);

[0016] RAA-G-P probe:

[0017] 5'-GACTGCCGAACCCCTATAACGCGATTAACCTATACTTTCAAGGGCT-3' (SEQ ID NO. 18).

[0018] Preferably, in the primer probe combination, the 3' end of the RAA-C-P probe is modified by C3 spacer blocking, and the 5' end is modified by a fluorescent reporter group at the 31st base, a tetrahydrofuran residue at the 32nd base, and a fluorescent quencher group at the 33rd base;

[0019] The 3' end of the RAA-G-P probe is modified by C3 spacer blocking, and the 5' end is modified by a fluorescent reporter group at the 31st base, a tetrahydrofuran residue at the 32nd base, and a fluorescent quencher group at the 33rd base.

[0020] Preferably, in the primer probe combination, the fluorescent reporter group of the RAA-C-P probe is FAM, and the fluorescent quencher group is BHQ1; the fluorescent reporter group of the RAA-G-P probe is ROX, and the fluorescent quencher group is BHQ2;

[0021] The modified RAA-C-P probe is:

[0022] GGACAATTCAGAAAGCACTGGTTTCAAGAA[FAM-dT][THF][BHQ1-dT]GCCGGACT TGAGG-C3Spacer;

[0023] The modified RAA-G-P probe is:

[0024] GACTGCCGAACCCCTATAACGCGATTAACC[ROX-dT][THF][BHQ2-dT]ACTTTCAA GGGCT-C3Spacer.

[0025] In another aspect, the present application also provides an application of the primer probe combination in the preparation of a product for simultaneously detecting chicken infectious anemia virus and chicken circumvirus type 3 by fluorescence RAA.

[0026] Preferably, in the application, the product is a kit or a reagent.

[0027] In another aspect, the present application also provides a kit for simultaneously detecting chicken infectious anemia virus and chicken circumvirus type 3 by fluorescence RAA, which comprises the primer probe combination.

[0028] Preferably, in the kit, the kit further comprises reaction dry powder, A Buffer, B Buffer, positive control, and negative control; further, the negative control sample is enzyme-free water, and the positive control is a plasmid standard of chicken infectious anemia virus and a plasmid standard of chicken circumvirus type 3.

[0029] In another aspect, the present application also provides an application of the primer probe combination or the kit in the simultaneous detection of chicken infectious anemia virus and chicken circumvirus type 3 for non-disease diagnosis or treatment purposes.

[0030] In another aspect, the present application also provides a method for simultaneously detecting chicken infectious anemia virus and chicken circumvirus type 3 by fluorescence RAA, which comprises the following steps:

[0031] (1) extracting DNA of a sample to be tested;

[0032] (2) using the DNA of the sample to be tested as a template, performing double constant temperature fluorescence amplification by using the primer probe combination or the kit to obtain a constant temperature amplification curve;

[0033] (3) determining whether the sample to be tested contains chicken infectious anemia virus or chicken circumvirus type 3 according to the constant temperature amplification curve.

[0034] Preferably, in the above method, in the step (2), the double isothermal fluorescence amplification RAA reaction system comprises: a primer probe group for detecting chicken infectious anemia virus, a primer probe group for detecting chicken circle virus type 3, and the final concentration of the upstream primer RAA-C-F2, the downstream primer RAA-C-R1, the upstream primer RAA-G-F1, and the downstream primer RAA-G-R3 in the reaction system is 0.4 μM, and the final concentration of the RAA-C-P probe and the RAA-G-P probe is 0.12 μM.

[0035] Preferably, in the above method, in the step (2), the isothermal fluorescence amplification reaction system comprises: 25 μL of Abuffer, 2.5 μL of B buffer, 2 μL of the upstream and downstream primers for chicken infectious anemia virus, 0.6 μL of the probe, 2 μL of the upstream and downstream primers for chicken circle virus type 3, 0.6 μL of the probe, 5 μL of the DNA template of the positive control or the negative control or the sample to be tested, and 8.3 μL of enzyme-free water, with a total volume of 50 μL; the concentration of the upstream primer, the downstream primer, and the probe is 10 μM; during the isothermal fluorescence amplification, 5 μL of the DNA template of the negative control or the positive control or the sample to be tested is added into the reaction system for isothermal fluorescence amplification, and the isothermal amplification results of the negative control, the positive control, and the sample to be tested are obtained, respectively.

[0036] Preferably, in the above method, the reaction conditions of the isothermal fluorescence amplification are as follows: the isothermal temperature is 39 ℃, the reaction time is 20 min, and the FAM fluorescence signal and the ROX fluorescence signal are collected; further, the FAM channel represents the chicken infectious anemia virus, and the ROX channel represents the chicken circle virus type 3.

[0037] Preferably, in the above method, in the step (3), the process of determining whether the sample to be tested contains the chicken infectious anemia virus and the chicken circle virus type 3 comprises:

[0038] ① The isothermal amplification result of the positive control: a typical amplification curve appears, and Ct≤30; the isothermal amplification result of the negative control: no amplification curve appears, or Ct≥40; both the above positive control and the negative control are valid results, which are used as a control reference to determine whether the sample to be tested contains the chicken infectious anemia virus and the chicken circle virus type 3;

[0039] ② The sample to be tested:

[0040] Positive: a typical amplification curve appears, and the Ct of the sample to be tested is ≤36, which is judged as a positive sample; if a typical amplification curve appears in the FAM channel or the ROX channel and the Ct is ≤36, it means that the sample to be tested contains the chicken infectious anemia virus or the chicken circle virus type 3;

[0041] Negative: if Ct> 36, or no amplification curve appears, it is judged as a negative sample, that is, the sample to be tested does not contain chicken infectious anemia virus and chicken circle virus 3 or does not reach the detection threshold of the chicken infectious anemia virus and chicken circle virus 3.

[0042] Compared with the prior art, the present application has the following beneficial effects:

[0043] 1. The primer probe combination and kit for simultaneously detecting chicken infectious anemia virus and chicken circle virus 3 based on fluorescent RAA of the present application can be used for simultaneously detecting chicken infectious anemia virus and chicken circle virus 3, and has the characteristics of rapid detection, good specificity, high sensitivity and the like.

[0044] 2. The detection method of the present application has the advantages of simple operation, short detection time, good specificity, high sensitivity, no need for expensive instrument equipment, support for on-site rapid detection, suitability for large-scale popularization and application, and the like, and can provide effective technical support for the rapid detection screening of chicken infectious anemia virus and chicken circle virus 3. BRIEF DESCRIPTION OF DRAWINGS

[0045] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiment description. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without any creative labor.

[0046] Figure 1 (A) is the agarose gel electrophoresis diagram of the PCR amplification product of chicken infectious anemia virus in the embodiment 1 of the present application, wherein M is 2000 DNA Marker, lane 1 is the amplification band of chicken infectious anemia virus, the target fragment amplification size is 423 bp, and lane 2 is the negative control; Figure 1 (B) is the agarose gel electrophoresis diagram of the PCR amplification product of chicken circle virus 3, wherein M is 2000 DNA Marker, lane 1 is the amplification band of chicken circle virus 3, the target fragment amplification size is 762 bp, and lane 2 is the negative control;

[0047] Figure 2 is the agarose gel electrophoresis diagram of the gel recovery result of the PCR amplification product of chicken infectious anemia virus and chicken circle virus 3 in the embodiment 1 of the present application, wherein M is 2000 DNA Marker, lane 1 is chicken infectious anemia virus, and lane 2 is chicken circle virus 3.

[0048] Figure 3It is the screening result curve diagram of the fluorescent amplification of the chicken infectious anemia virus primer probe group in the embodiment 2 of the application, wherein 1-8 are F1R1, FIR2, F1R3, F1R4, F4R3, F4R4, F2R1, F2R2 respectively; 9-16 are F2R3, F2R4, F4R2, F4R1, F3R1, F3R2, F3R3, F3R4 respectively.

[0049] Figure 4 It is the screening result curve diagram of the fluorescent amplification of the chicken infectious anemia virus primer probe group in the embodiment 2 of the application, wherein 1-8 are F1R1, FIR2, F1R3, F1R4, F2R1, F2R2, F2R3, F2R4 respectively; 9-16 are F3R1, F3R2, F3R3, F3R4, F4R1, F4R2, F4R3, F4R4 respectively.

[0050] Figure 5 It is the sensitivity investigation result curve diagram of the chicken infectious anemia virus and the chicken infectious anemia virus 3 type double fluorescent RAA primer probe group in the embodiment 4 of the application, wherein 1-7 represent the concentration gradient of the chicken infectious anemia virus positive standard plasmid, and are 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 copies / μL respectively; 8-14 represent the concentration gradient of the chicken infectious anemia virus 3 type positive standard plasmid, and are 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 copies / μL respectively; 15 represents a negative control.

[0051] Figure 6 It is the specificity investigation result curve diagram of the chicken infectious anemia virus and the chicken infectious anemia virus 3 type double fluorescent RAA primer probe group in the embodiment 4 of the application; wherein 1 represents the chicken infectious anemia virus; 2 represents the infectious anemia virus 3 type; 3-8 represent the avian influenza virus (H5), the marek's disease virus, the infectious bronchitis virus, the infectious bursal disease virus (B87 strain), the infectious laryngotracheitis virus, and a negative control respectively.

[0052] Figure 7 It is the repeatability investigation result curve diagram of the chicken infectious anemia virus and the chicken infectious anemia virus 3 type double fluorescent RAA primer probe group in the embodiment 4 of the application: (A) the concentration is 10 5 copies / μL; (B) the concentration is 104 copies / μL; (C) concentration is 10 2 copies / μL; in three figures, 1-3 represent chicken infectious anemia virus; 4-6 represent chicken circumvirus type 3. DETAILED DESCRIPTION

[0053] The specific embodiments of the present application are described in detail below, but it should be understood that the scope of protection of the present application is not limited by the specific embodiments. Unless otherwise defined, all professional terms used in the following have the same meaning as understood by those skilled in the art. The professional terms used herein are only for the purpose of describing the specific embodiments and are not intended to limit the scope of protection of the present application. Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0054] The dry powder reaction tube, A buffer, B buffer involved in the following examples are from Nanning Zhuangbo Biotechnology Co., Ltd., which are RAA nucleic acid amplification reagents (fluorescent type), and the product number is ZBA12001.

[0055] Example 1 Construction of chicken infectious anemia virus and chicken circumvirus type 3 plasmid standard

[0056] Take the positive samples of chicken infectious anemia virus and chicken circumvirus type 3 stored in the laboratory, and design specific PCR amplification primers according to the chicken infectious anemia virus genome (GenBank accession number: OQ267594.1) and the chicken circumvirus type 3 genome (GenBank accession number: NC_017091.1) published on GenBank.

[0057] Among them, the specific PCR amplification primers of chicken infectious anemia virus are as follows:

[0058] CIAV-F: 5'-GGACCATCAACGGTGTTCAG-3'(SEQ ID NO. 19);

[0059] CIAV-R: 5'-CTTCGTCGAAGTCGCTTGAG-3'(SEQ ID NO. 20).

[0060] The size of the amplified target fragment is 423 bp.

[0061] Among them, the specific PCR amplification primers of chicken circumvirus type 3 are as follows:

[0062] Gyv3-F: 5'-ATTACCGTATCGCTTCCTG-3'(SEQ ID NO. 21);

[0063] Gyv3-R: 5'-CATCGCCACCATTCTGAA-3' (SEQ ID NO. 22).

[0064] The amplified size of the target fragment was 762 bp.

[0065] The DNA of chicken infectious anemia virus and chicken circumvirus type 3 was extracted using a viral genomic DNA / RNA extraction kit from Baibio-Engineering (Dalian) Co., Ltd. The PCR reaction system was prepared according to the components listed in Table 1, and then placed in a PCR instrument to set the specific reaction program as follows:

[0066] Chicken infectious anemia virus: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 sec, 56°C annealing for 30 sec, 72°C extension for 30 sec, for a total of 30 cycles; 72°C extension for 10 min; 4°C storage;

[0067] Chicken circumvirus type 3: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 45 sec, for a total of 30 cycles; 72°C extension for 10 min; 4°C storage.

[0068] Table 1. Conventional PCR reaction system

[0069] Reagent name Reaction system (μL) PCR buffer 12.5 Upstream primer 1 Downstream primer 1 DNA 1 Enzyme-free water 9.5 Total volume 25

[0070] The target genes of chicken infectious anemia virus and chicken circumvirus type 3 were subjected to PCR amplification, and the results are shown in Figure 1 The chicken infectious anemia virus and chicken circumvirus type 3 were amplified to 423 bp and 762 bp bands, respectively, which were consistent with the expected results.

[0071] The PCR amplification products were subjected to gel recovery, and the results are shown in Figure 2 The gel recovery products were ligated with pMD18-T vector at 16°C overnight. The ligation products were transformed into E. coli DH5α competent cells, and the transformed products were inoculated into LB solid medium containing ampicillin using a spreader, and cultured at 37°C for 10 hours. The bacteria grown on the LB solid medium containing ampicillin were picked and inoculated into LB liquid medium containing ampicillin for expansion culture.

[0072] The bacteria liquid of the expansion culture in the previous step were subjected to plasmid extraction and concentration determination. The constructed plasmids were stored at -20°C after sequencing verification. The concentration of the plasmids correctly digested and sequenced was determined using a spectrophotometer, and the formula was as follows:

[0073]

[0074] The plasmid with correct sequencing was diluted 10 times with nuclease-free water to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 10 0 copies / μL, to obtain plasmid standards of chicken infectious anemia virus and chicken circumvirus type 3, which were stored at -20°C for standby use.

[0075] Example 2 Design and screening of chicken infectious anemia virus and chicken circumvirus type 3 double fluorescent RAA primers and probes

[0076] 1. Design and synthesis of primers and probes

[0077] This example targets the approximately 200bp conserved region of chicken infectious anemia virus and chicken circumvirus type 3 as the target region for the design of RAA primers and probes, one probe, and four upstream and downstream primers, respectively. The primers and probes were synthesized by Nanning Zhuangbo Biological Technology Co., Ltd.

[0078] Among them, the selected conserved region of chicken infectious anemia virus is 197bp long, and the specific DNA sequence is as follows: (5'-3')

[0079] CGCTGGAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGATCTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCGAGCTAAAAGAAA. (SEQ ID NO. 23)

[0080] Among them, the selected conserved region of chicken circumvirus type 3 is 202bp long, and the specific DNA sequence is as follows: (5'-3')

[0081] GACCCAGTGCTCGCAGCGTTAAAAGGAAGATATTCAACCCACATCCGGGATCTTACCTGGTAAGACTGCCGAACCCCTATAACGCGATTAACCTATACTTTCAAGGGCTCGTATTCATACCTAGAGCCACAAGCTACTTACCAGACACAACTAAAGGCAAAAACGTTACAACAACTAATGTGGCACTAATTAACGTTAACCT. (SEQ ID NO. 24)

[0082] The primer and probe sequences of the double fluorescent RAA of the chicken infectious anemia virus and chicken circle virus type 3 are shown in Table 2.

[0083] Table 2 Double fluorescent RAA primer, probe sequence

[0084]

[0085]

[0086] The RAA-C-P probe in Table 2 is modified by C3 spacer blocking at the 3' end, and the fluorescent reporter group FAM is modified at the 31st T base position from the 5' end, the 32nd nucleotide G is modified by tetrahydrofuran (THF) d Spacer, and the 33rd T base is modified by fluorescent quenching group BHQ1, to obtain the modified RAA-C-P probe:

[0087] GGACAATTCAGAAAGCACTGGTTTCAAGAA[FAM-dT][THF][BHQ1-dT]GCCGGACT TGAGG-C3Spacer;

[0088] The 3' end of the RAA-G-P probe in Table 2 is modified by C3 spacer blocking, and the fluorescent reporter group ROX is modified at the 31st T base position from the 5' end of the probe sequence; the fluorescent quenching group BHQ2 is modified at the 33rd T base position from the 5' end of the probe sequence, and the 32nd nucleotide A is modified by tetrahydrofuran (THF) d Spacer. The modified RAA-G-P probe is:

[0089] GACTGCCGAACCCCTATAACGCGATTAACC[ROX-dT][THF][BHQ2-dT]ACTTTCAA GGGCT-C3Spacer.

[0090] 2. Screening of primer pairs

[0091] The upstream and downstream primers of chicken infectious anemia virus and chicken circumvirus type 3 were combined in pairs to obtain 16 groups of primer probe combinations, and the results are shown in Table 3.

[0092] Table 3 Multiple primer probe combinations of double fluorescence RAA

[0093]

[0094]

[0095] Enzyme-free water was used as a negative control, and 10 6 copies / μL plasmid standard as a positive control template to construct the RAA amplification system, perform fluorescence reaction, and screen the primer probe combination with the best amplification efficiency.

[0096] The RAA amplification system includes: reaction dry powder 1 tube, A Buffer 25 μL, B Buffer 2.5 μL, upstream primer 2.0 μL (10 μM), downstream primer 2.0 μL (10 μM), probe 0.6 μL (10 μM), sample 5 μL, enzyme-free water 12.9 μL, and the total volume is 50 μL.

[0097] Reaction program: constant temperature 39℃, reaction time 20 min.

[0098] The test results of the best primer probe combination of chicken infectious anemia virus are shown in Table 4. Figure 3 Figure 3 The abscissa represents the reaction time, and the ordinate represents the fluorescence value. Figure 3 The results show that the primer pair RAA-C-F2R1 has the earliest peak curve and the highest amplification efficiency, which is more conducive to the rapid and efficient amplification of chicken infectious anemia virus. Therefore, the selected good RAA primer group and probe sequence are as follows:

[0099] The nucleotide sequence of the upstream primer RAA-C-F2 is:

[0100] TCACTCTATCGCTGTGTGGCTGCGCGAATG-3′ (SEQ ID NO. 2);

[0101] The nucleotide sequence of the downstream primer RAA-C-R1 is:

[0102] TTCTTCGAGGGAGGCTTGGGTTGATCGG (SEQ ID NO. 5);

[0103] The nucleotide sequence of the probe RAA-C-P is:

[0104] ​GGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGG (SEQ ID NO. 9);

[0105] The modified RAA-C-P probe is:

[0106] GACAATTCAGAAAGCACTGGTTTCAAGAA[FAM-dT][THF][BHQ1-dT]GCCGGACTT GAGG-C3Spacer.

[0107] The results of the optimal primer probe combination test of chicken circovirus type 3 are shown in Figure 4 . Figure 4 In the figure, the abscissa represents the cycle number, and the ordinate represents the fluorescence value. Figure 4 The results show that the primer pair RAA-G-F1R3 has the earliest peak curve and the highest amplification efficiency, which is more conducive to the rapid and efficient amplification of chicken circovirus type 3. The selected good RAA primer group and probe sequence are as follows:

[0108] The nucleotide sequence of the upstream primer RAA-G-F1 is:

[0109] TCAACCCACATCCGGGATCTTACCTGGT (SEQ ID NO. 10);

[0110] The nucleotide sequence of the downstream primer RAA-G-R3 is:

[0111] CCTTTAGTTGTGTCTGGTAAGTAGCTTGTG (SEQ ID NO. 16);

[0112] The nucleotide sequence of the RAA-G-P probe is:

[0113] GACTGCCGAACCCCTATAACGCGATTAACCTATACTTTCAAGGGCT (SEQ ID NO. 18);

[0114] The modified RAA-G-P probe is as follows:

[0115] GACTGCCGAACCCCTATAACGCGATTAACC[ROX-dT][THF][BHQ2-dT]ACTTTCA AGGGCT-C3Spacer.

[0116] Optimization of primer and probe concentration in Example 3

[0117] The concentration of each probe is set to 0.12 μM, the concentrations of the upstream and downstream primers of chicken infectious anemia virus and chicken circovirus type 3 are 0.3 μM, 0.4 μM and 0.5 μM respectively, the primer concentrations of the two viruses are cross-reacted, combined into 9 combinations, and each combination is set with a group of negative controls. The RAA reaction system is shown in Table 4. The 9 groups of primer probe combinations are subjected to RAA amplification under the condition of constant temperature 39℃ for 20 min, and the best combination of amplification efficiency is screened out (see Table 5).

[0118] Table 4 RAA reaction system

[0119] RAA reaction system component Use amount Final concentration RAA reaction dry powder 1 tube A liquid 25 μL B liquid 2.5 μL RAA-C-F2 (concentration of 10 μM) X μL Y μM RAA-C-R1 (concentration of 10 μM) X μL Y μM RAA-C-P (concentration of 10 μM) 0.6 μL 0.12 μM RAA-G-F1 (concentration of 10 μM) X μL Y μM RAA-G-R3 (concentration of 10 μM) X μL Y μM RAA-G-P (concentration of 10 μM) 0.6 μL 0.12 μM DNA template 5 μL ddH2O Supplemented to 50 μL Total volume 50 μL

[0120] Table 5 Primer and probe concentration combination

[0121]

[0122]

[0123] Through analysis of the detection results, the best primer and probe concentration ratio confirmed by the application is 10:3, wherein the concentrations of the upstream and downstream primers of chicken infectious anemia virus and chicken circovirus type 3 are 0.4 μM, and the concentration of the probe is 0.12 μM.

[0124] Example 4 Construction of chicken infectious anemia virus and chicken circovirus type 3 double fluorescent RAA reaction system, kit and detection method

[0125] After optimizing the primer and probe ratio, the preparation of the chicken infectious anemia virus and chicken circovirus type 3 double fluorescent RAA reaction system is shown in Table 6. Among them, the DNA template is specifically 5 μL of chicken infectious anemia virus and chicken circovirus type 3 template two-in-one.

[0126] Table 6 Double fluorescent RAA reaction system

[0127]

[0128] The kit for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescent RAA includes: upstream primer RAA-C-F2, downstream primer RAA-C-R1, RAA-C-P probe, upstream primer RAA-G-F1, downstream primer RAA-G-R3 and RAA-G-P probe, ddH2O, A Buffer, B Buffer, reaction dry powder; wherein the concentrations of the probes and primers are all 10 μM. The dry powder reaction tube, A buffer and B buffer are from Nanning Zhuangbo Biological Technology Co., Ltd., and are RAA nucleic acid amplification reagent (fluorescent type).

[0129] A double fluorescent RAA detection method for chicken infectious anemia virus and chicken circle virus 3 type, comprising the following steps:

[0130] (1) Extract the DNA of the sample to be tested;

[0131] (2) Using the DNA of the sample to be tested as a template, a double constant temperature fluorescent amplification is carried out using the screened primer probe combination, the reaction system is shown in Table 4, the constant temperature fluorescent amplification reaction conditions are: constant temperature 39℃, reaction time 20min, FAM fluorescence signal and ROX fluorescence signal are collected, and a constant temperature amplification curve is obtained; the FAM channel represents chicken infectious anemia virus, and the ROX channel represents chicken circle virus 3 type;

[0132] (3) According to the constant temperature amplification curve, it is determined whether the sample to be tested contains chicken infectious anemia virus or chicken circle virus 3 type, specifically:

[0133] ① The constant temperature amplification result of the positive control: a typical amplification curve appears, and Ct≤30; the constant temperature amplification result of the negative control: no amplification curve appears, or Ct≥40; the above positive control and negative control are effective results, which are used as a control standard to determine whether the sample to be tested contains chicken infectious anemia virus and chicken circle virus 3 type;

[0134] ② The sample to be tested:

[0135] Positive: a typical amplification curve appears, and the Ct of the sample to be tested is ≤36, which is judged as a positive sample; if a typical amplification curve appears in the FAM channel or the ROX channel and the Ct is ≤36, it is determined that the sample to be tested contains chicken infectious anemia virus or chicken circle virus 3 type;

[0136] Negative: if the Ct is > 36, or no amplification curve appears, it is judged as a negative sample, that is, the sample to be tested does not contain chicken infectious anemia virus and chicken circle virus 3 type or does not reach the detection threshold of avian chicken infectious anemia virus and chicken circle virus 3 type.

[0137] Example 5 Methodological investigation of the double fluorescent RAA detection method for chicken infectious anemia virus and chicken circle virus 3 type

[0138] 1. Sensitivity investigation:

[0139] The plasmid standard of 10 6 copies / μL-10 0 copies / μL concentration gradient is used as a template, and enzyme-free water is used as a negative control, and the double RAA detection system established in Example 3 is used for detection. Figure 5As can be seen, at a concentration as low as 10 copies / μL, both the FAM and ROX channels exhibit obvious amplification curves. Therefore, the detection method provided by this invention has a limit of detection of 10 copies / μL for both chicken infectious anemia virus and chicken circle virus type 3.

[0140] 2. Specificity assessment:

[0141] Using DNA or cDNA of avian infectious anemia virus (AINV), avian circle virus type 3 (ANIV3), avian influenza virus (H5), Marek's disease virus (MARV), infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV) (strain B87), and infectious laryngotracheitis virus (ILV) as templates, the ANIV-RAA method was used for detection and analysis of the specificity of the method. The copy number of plasmid standards for ANIV and ANIV3 was 10-1. 6 copies / μL, with enzyme-free water as a negative control. Results are as follows: Figure 6 As shown, the standard plasmids of infectious anemia virus and chicken circle virus type 3 showed obvious amplification curves, while the other samples did not show amplification curves at all.

[0142] 3. Repeatability testing:

[0143] The positive control plasmids for chicken infectious anemia virus and chicken circle virus type 3 constructed in Example 1 were used and diluted 10-fold with enzyme-free water to a concentration of 10: 5 10 4 10 2 Copies / μL, with three replicate wells for each concentration, for a total of three replicates.

[0144] Depend on Figure 7 As can be seen, stable amplification curves were observed at all three concentration gradients of dual fluorescent RAA for chicken infectious anemia virus and chicken circle virus type 3, indicating that the established detection method has good repeatability.

[0145] Application Example 1

[0146] Clinical samples were tested using a definitive dual-fluorescent RAA detection method for chicken infectious anemia virus and chicken circle virus type 3. The method is as follows:

[0147] A total of 224 avian serum samples were collected from Guangxi Province, including 68 from farm A, 64 from farm B, 52 from farm C, and 40 from farm D. The samples were detected using conventional PCR, dual qPCR, and the dual fluorescent RAA detection method for chicken infectious anemia virus and chicken circle virus type 3 determined in Example 4.

[0148] The conventional PCR of chicken infectious anemia virus adopts the primers and method in the literature (Zhang Yubiao, Li Xiaohan, Meng Fafen, et al. Comparative analysis of different molecular biology methods for detecting chicken infectious anemia virus), and the specific primer sequences are as follows:

[0149] CIAV-F1: 5'-GCATTCCGAGTGGTTACTATTCC-3' (SEQ ID NO. 25);

[0150] CIAV-R1: 5'-CGTCTTGCCATCTTACAGTCTTAT-3' (SEQ ID NO. 26).

[0151] The conventional PCR of chicken circovirus type 3 adopts the primers and method in the literature (Diao Zhijun, Yuan Shiyu, Hao Xiaojing, et al. Diagnosis of adenogastroenteritis caused by co-infection of chicken infectious anemia virus and chicken circovirus type 3), and the specific primer sequences are as follows:

[0152] Gyv3-F1: 5'-GACACAGACTGCGACGAAGA-3' (SEQ ID NO. 27);

[0153] Gyv3-R1: 5'-ATGCTCCTGGCTGTCTAGAT-3' (SEQ ID NO. 28).

[0154] The primer set and probe sequence of the duplex qPCR are shown in Table 7.

[0155] Table 7 Primer and probe sequence of duplex qPCR

[0156]

[0157] The primer set and probe of the duplex qPCR are designed by the inventors according to the conserved sequences of chicken infectious anemia virus and chicken circovirus type 3 published on GenBank.

[0158] The reaction system of the duplex qPCR method is shown in Table 8.

[0159] Table 8 Reaction system of duplex qPCR method

[0160]

[0161] The qPCR program is set as: 95℃ pre-denaturation for 30 sec; 95℃ PCR amplification for 15 sec, 56℃ PCR amplification for 30 sec, a total of 40 cycles, and FAM and VIC channel fluorescence signals are collected.

[0162] The detection time is shown in Table 9. As can be seen from Table 9, the detection time of the chicken infectious anemia virus and chicken circle virus type 3 double fluorescent RAA detection method is only 20 min, which greatly saves the detection time compared with the other two detection methods.

[0163] Table 9 detection time

[0164]

[0165] The detection results are shown in Table 10. As can be seen from Table 10, using the conventional PCR detection method for detection, 28 chicken infectious anemia virus positive samples, the positive rate is 12.50%; 4 chicken circle virus type 3 positive samples are detected, the positive rate is 1.79%. Using qPCR for detection, 53 chicken infectious anemia virus positive samples are detected, the positive rate is 23.66%; 7 chicken circle virus type 3 positive samples are detected, the positive rate is 3.13%. Using the chicken infectious anemia virus and chicken circle virus type 3 double fluorescent RAA detection method provided by the application for detection, 53 chicken infectious anemia virus positive samples are detected, the positive rate is 23.66%, and 7 chicken circle virus type 3 positive samples are detected, the positive rate is 3.13%.

[0166] Table 10 detection results

[0167]

[0168] The above results show that the chicken infectious anemia virus and chicken circle virus type 3 double fluorescent RAA detection method established by the application has the same positive detection rate as the qPCR detection method, which is much higher than the conventional PCR, indicating that the chicken infectious anemia virus and chicken circle virus type 3 double fluorescent RAA detection method established by the application has good sensitivity. According to the detection time of the three methods, the detection time of the chicken infectious anemia virus and chicken circle virus type 3 double fluorescent RAA detection method is 20 min, which greatly saves the detection time compared with the other two detection methods.

[0169] In summary, the chicken infectious anemia virus and chicken circle virus type 3 double fluorescent RAA detection method provided by the application can specifically detect chicken infectious anemia virus and chicken circle virus type 3 from a variety of viruses, and the minimum detection limit of the two viruses is 10 copies / μL, which has good repeatability and can complete the detection in 20 min; has good popularization value and application prospect, and can also provide effective technical support for the rapid detection screening of chicken infectious anemia virus and chicken circle virus type 3 and the prevention and control of the epidemic diseases caused by the virus.

[0170] The foregoing description of specific exemplary embodiments of the application has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the application to the precise forms disclosed, and obviously many modifications and variations are possible in light of the above teaching. It is intended that the scope of the application be limited not with this detailed description, but rather by the claims appended hereto.

Claims

1. A primer probe combination for simultaneous detection of chicken infectious anemia virus and chicken circumvirus type 3 based on fluorescent RAA, characterized in that, The primer probe set comprises the following: The primer probe set for detecting chicken infectious anemia virus consists of a primer pair composed of an upstream primer RAA-C-F2 as shown in SEQ ID NO. 2 and a downstream primer RAA-C-R1 as shown in SEQ ID NO. 5, and a RAA-C-P probe as shown in SEQ ID NO. 9; The primer probe set for detecting chicken circumvirus 3 consists of an upstream primer RAA-G-F1 as shown in SEQ ID NO. 10, a downstream primer RAA-G-R3 as shown in SEQ ID NO. 16, and a RAA-G-P probe as shown in SEQ ID NO.

18.

2. The primer probe combination of claim 1, wherein The 3' end of the RAA-C-P probe is modified by C3 spacer blocking, and the 5' end is modified by a fluorescent reporter group at the 31st base, a tetrahydrofuran residue at the 32nd base, and a fluorescent quencher group at the 33rd base; The 3' end of the RAA-G-P probe is modified by C3 spacer blocking, and the 5' end is modified by a fluorescent reporter group at the 31st base, a tetrahydrofuran residue at the 32nd base, and a fluorescent quencher group at the 33rd base.

3. The primer probe combination of claim 2, wherein, The fluorescent reporter group of the RAA-C-P probe is FAM, and the fluorescent quencher group is BHQ1; the fluorescent reporter group of the RAA-G-P probe is ROX, and the fluorescent quencher group is BHQ2.

4. Use of the primer probe combination of any one of claims 1-3 in the preparation of a product for simultaneous detection of chicken infectious anemia virus and chicken circumvirus 3 based on fluorescent RAA.

5. Use according to claim 4, characterized in that, The product is a kit or a reagent.

6. A kit for simultaneous detection of chicken infectious anemia virus and chicken circumvirus type 3 based on fluorescent RAA, characterized in that, The kit comprises the primer probe combination of any one of claims 1-3.

7. Use of the primer probe combination of any one of claims 1-3 or the kit of claim 6 for simultaneous detection of chicken infectious anemia virus and chicken circumvirus 3 for non-disease diagnosis or treatment purposes.

8. A method for simultaneous detection of chicken infectious anemia virus and chicken circumvirus type 3 for non-disease diagnostic or therapeutic purposes based on fluorescent RAA, characterized by, The method comprises the following steps: (1) extracting DNA from the sample to be tested; (2) using the primer probe combination of any one of claims 1-3 or the kit of claim 6 to perform double isothermal fluorescent amplification with the DNA from the sample to be tested as the template to obtain an isothermal amplification curve; (3) determining whether the sample to be tested contains chicken infectious anemia virus or chicken circumvirus 3 based on the isothermal amplification curve.

9. The method of claim 8, wherein, In step (2), the RAA reaction system for double isothermal fluorescent amplification comprises the primer probe set for detecting chicken infectious anemia virus, the primer probe set for detecting chicken circumvirus 3, and the final concentration of the upstream primer RAA-C-F2, the downstream primer RAA-C-R1, the upstream primer RAA-G-F1, and the downstream primer RAA-G-R3 is 0.4 μM, and the final probe concentration of RAA-C-P and RAA-G-P is 0.12 μM.

10. The method of claim 8, wherein, In step (3), the process of determining whether the sample to be tested contains chicken infectious anemia virus and chicken circumvirus 3 comprises: ① Positive control: typical amplification curve appears, and Ct≤30; negative control: no amplification curve appears, or Ct≥40; the above positive control and negative control are effective results, which are used as control standards to determine whether the sample contains chicken infectious anemia virus and chicken circle virus 3; ② Test sample: Positive: typical amplification curve appears, and Ct≤36, the sample is determined as positive, if typical amplification curve appears in FAM channel or ROX channel and Ct≤36, the sample contains chicken infectious anemia virus or chicken circle virus 3; Negative: if Ct>36, or no amplification curve appears, the sample is determined as negative, that is, the sample does not contain chicken infectious anemia virus and chicken circle virus 3, or does not reach the detection threshold of chicken infectious anemia virus and chicken circle virus 3.

Images