Method for high-throughput synthesis of DNA (deoxyribonucleic acid)

Abstract

The invention belongs to the field of molecular biology, and provides a method for DNA high-throughput synthesis, which comprises the following steps: S1, loading a solid-phase synthesis carrier: loading the solid-phase synthesis carrier on a magnetic suspension mobile platform of a synthesizer; s2, deprotection: removing protective groups on the surface of the solid-phase carrier by using a deprotection reagent; s3, cleaning is conducted; cleaning the residual deprotection reagent; s4, coupling reaction: depositing a DMT-phosphoramidite monomer, and carrying out coupling reaction; s5, oxidation: carrying out oxidation treatment on the coupled solid-phase synthesis carrier by using an iodine solution; s6, end capping: carrying out end capping protection on uncoupled sites by using a capping reagent; and S7, circulating synthesis: moving the magnetic suspension mobile platform according to a set route, and circulating the steps S1-S6 until high-throughput synthesis of the target DNA sequence is completed. According to the invention, uniform synthesis of DNA at different sites can be ensured, accurate control of the temperature in the coupling reaction stage can be ensured, and the error rate of DNA synthesis is effectively reduced.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and relates to a high-throughput DNA synthesis method, in particular to a method for high-throughput DNA synthesis using a magnetic levitation mobile platform as a synthesis support platform. Background Art

[0002] During DNA synthesis, temperature stability is an important factor affecting reaction rate, reaction selectivity, and final product quality. Solid-phase synthesis is typically used for DNA synthesis, which is centered around multiple cyclic steps, such as deprotection, cleaning, coupling reactions, oxidation, and end-capping. The reaction temperature and reaction time of each step have a significant impact on the quality of the final product and synthesis efficiency. However, in traditional DNA synthesis methods, temperature fluctuations or uneven temperature distribution often lead to reduced reaction efficiency, incomplete local synthesis, and inconsistent DNA product quality.

[0003] Traditional mechanical motion platforms are often used to support DNA synthesis, but they have significant limitations. For example, friction from the platform's moving parts and the passage of electrical current generate heat, affecting the platform's temperature stability. Furthermore, the reaction temperature is difficult to precisely control during reagent supply and removal, leading to temperature inconsistencies between different steps, further impacting the efficiency and accuracy of DNA synthesis.

[0004] To address these issues, advanced DNA synthesis technologies have gradually introduced temperature control modules and high-precision mobile platforms. For example, by integrating semiconductor temperature control modules and temperature sensors into the mobile platform, the temperature of the reaction device can be adjusted and monitored in real time. Furthermore, inkjet printing technology is used to precisely deposit phosphoramidite monomers and activators, allowing them to react with the terminal hydroxyl groups of the DNA chains on the solid-phase support. This technology can significantly improve the accuracy and uniformity of synthesis, but it places higher demands on reaction temperature control. Especially in high-throughput synthesis scenarios, temperature instability can lead to the accumulation of errors in multi-site synthesis, reducing overall product quality.

[0005] Therefore, how to optimize the temperature stability of the reaction device, reduce heat interference during the movement process, and achieve precise temperature control between each step has become the key to the development of high-throughput DNA synthesis technology. Summary of the Invention

[0006] The present invention aims to provide a high-throughput DNA synthesis method that utilizes a magnetically suspended mobile platform as a synthesis support platform, effectively reducing heat generation during movement, maintaining temperature stability within the reaction apparatus, and improving the efficiency and accuracy of DNA synthesis, thereby achieving high-quality, high-throughput DNA synthesis. This method addresses the prior art issues of low DNA synthesis efficiency and product quality caused by unstable temperature control.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows:

[0008] A method for high-throughput DNA synthesis comprises the following steps:

[0009] S1. Loading the solid-phase synthesis carrier: loading the solid-phase synthesis carrier onto the magnetic levitation mobile platform of the synthesizer;

[0010] S2, deprotection: using a deprotection reagent to remove the protective groups on the surface of the solid support;

[0011] S3, cleaning: cleaning the residual deprotection reagent;

[0012] S4, coupling reaction: depositing DMT-phosphoramidite monomer and performing coupling reaction;

[0013] S5, oxidation: using iodine solution to oxidize the coupled solid phase synthesis support;

[0014] S6. Capping: Use capping reagents to cap and protect the uncoupled sites;

[0015] S7, cyclic synthesis: The magnetic levitation mobile platform moves along a predetermined route, cycling through steps S1-S6 until high-throughput synthesis of the DNA sequence is completed.

[0016] Preferably, the solid phase synthesis support is a micron array well plate.

[0017] Preferably, the micron array well plate has both a hydrophobic surface and a hydrophilic surface and is grafted with Unylinker, wherein the hydrophobic surface is the plane of the micron array well plate, and the hydrophilic surface is the inner surface of the micropores of the micron array well plate.

[0018] Preferably, the magnetic levitation platform is equipped with a microcomputer and a semiconductor temperature control module, and the semiconductor temperature control module is integrated with a temperature sensor;

[0019] The microcomputer can control the magnetic levitation mobile platform carrying the solid-phase synthesis carrier to perform high-precision displacement along a pre-set route during the synthesis process, ensuring uniform synthesis of DNA at different sites. The magnetic levitation mobile platform reduces mechanical friction and heat generation, ensuring precise control of temperature during the coupling reaction stage, thereby effectively reducing the error rate of DNA synthesis.

[0020] Preferably, in step S2, the deprotection reaction temperature is 10°C to 35°C.

[0021] Preferably, the deprotection reaction temperature is 15°C to 25°C.

[0022] Preferably, in step S3, the cleaning temperature is 10°C to 70°C.

[0023] Preferably, the cleaning temperature is 15°C to 30°C.

[0024] Preferably, in step S4, the deposition method of the DMT-phosphoramidite monomer is an inkjet printing method.

[0025] Preferably, in step S4, the coupling reaction temperature is 20°C to 50°C.

[0026] Preferably, the coupling reaction temperature is 25-35°C.

[0027] Preferably, in step S6, the temperature of the end-capping reaction is 10°C to 50°C.

[0028] Preferably, the temperature of the end-capping reaction is 25°C to 50°C.

[0029] Preferably, in step S6, the capping reagent is acetic anhydride and N-methylimidazole.

[0030] Beneficial effects of the present invention:

[0031] The present invention uses a microcomputer to control the magnetic levitation mobile platform carrying the solid-phase synthesis carrier to perform high-precision displacement according to a pre-set route during the synthesis process, ensuring uniform synthesis of DNA at different sites. The magnetic levitation mobile platform reduces mechanical friction and heat generation, ensuring precise temperature control during the coupling reaction stage, thereby effectively reducing the error rate of DNA synthesis. At the same time, combined with the precise deposition and temperature control strategy of the inkjet printing method, the accuracy and efficiency of DNA synthesis can be further optimized, thereby improving the efficiency and accuracy of DNA synthesis and achieving high-throughput synthesis of DNA. The present invention is suitable for high-throughput DNA synthesis scenarios and can be widely used in fields such as genetic research and synthetic biology. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is a schematic diagram of the process of DNA synthesis in the present invention;

[0033] Figure 2 1 is a temperature fluctuation range diagram of Example 1, Examples 3-4 and Comparative Example 1 of the present invention;

[0034] Figure 3 is a uniformity distribution diagram of the oligo pool of Example 2 of the present invention;

[0035] Figure 4 It is a uniformity distribution diagram of the oligo pool of Comparative Example 1 of the present invention. DETAILED DESCRIPTION

[0036] In order to enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only embodiments of a part of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work should fall within the scope of protection of the present invention. In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below in conjunction with specific embodiments. The embodiments are intended to explain the present invention rather than to limit it.

[0037] The present invention provides a method for high-throughput DNA synthesis, which is based on a solid-phase synthesis technique using the phosphoramidite method and comprises the following steps:

[0038] S1. Loading solid phase synthesis carrier (micrometer array plate):

[0039] A micron array well plate that has undergone surface hydrophobic treatment, internal hydrophilic treatment of the micropores, and grafting of Unylinker is placed in a reactor and loaded on a microcomputer and a semiconductor temperature control module. The microcomputer can control the magnetic levitation mobile platform for high-precision displacement. The semiconductor temperature control module is used to adjust the surface temperature of the microplate, and an integrated temperature sensor is used to monitor the reaction surface temperature in real time.

[0040] S2. Deprotection: Use a deprotection reagent to remove the protecting groups on the surface of the microarray well plate. The reaction temperature is 10°C to 35°C, preferably 15°C to 25°C.

[0041] S3. Cleaning: Clean the surface of the microarray well plate to remove residual deprotection reagent. The cleaning temperature is 10°C to 70°C, preferably 15°C to 30°C.

[0042] S4. Coupling reaction: DMT-phosphoramidite monomer and activator are deposited one by one into the microwells of the micron array plate by inkjet printing, and coupled with Unylinker. The coupling reaction temperature is 20°C to 50°C, preferably 25°C to 35°C.

[0043] S5. Oxidation: Use iodine solution to oxidize the coupled microwell array plate to stabilize the coupled product; after the oxidation is completed, clean the residual iodine solution.

[0044] S6. Capping: Use capping reagents (acetic anhydride and N-methylimidazole (NMI)) to cap the uncoupled sites to prevent the DNA chains that failed to couple from continuing to couple and extend in subsequent reactions, so as to facilitate the separation of products of the correct length. The temperature of the capping reaction is 10°C to 50°C, preferably 25°C to 50°C.

[0045] S7, cyclic synthesis: According to the target DNA sequence, the magnetic levitation mobile platform carrying the micron array well plate can be controlled by a microcomputer to perform high-precision displacement along a pre-set route during the synthesis process, and the steps S1-S6 are cycled to sequentially couple DMT-phosphoramidite monomers in different microwells until the synthesis of the DNA sequence is completed, thereby obtaining high-throughput synthetic DNA.

[0046] Example 1

[0047] A method for high-throughput DNA synthesis comprises the following steps:

[0048] S1. Place a micronized well plate, which has undergone surface hydrophobic treatment, internal hydrophilic treatment of the micropores, and grafted with Unylinker as a synthesis support, into a reactor. Secure the microwell array plate to a magnetically suspended mobile platform using a mounting bracket.

[0049] S2. Move the magnetic levitation mobile platform carrying the microwell array plate to the deprotection reagent feeding point through microcomputer control. Adjust the temperature of the microwell array plate to 25°C through the temperature control system. Inject 10ml of deprotection reagent (3% dichloroacetic acid (DCA) solution (i.e., 3ml DCA mixed with 97ml dichloromethane) with a temperature set to 25°C) to ensure full contact between the microwell plate surface and the reagent. React at a constant temperature of 25°C for 1 minute. Subsequently, move the magnetic levitation platform to the drainage point, start the negative pressure drainage function, and remove the residual reagent.

[0050] S3. Move the magnetic levitation platform to the cleaning solution inlet point, adjust the surface temperature of the microwell array plate to 30°C, and inject 10 ml of acetonitrile cleaning solution set to 30°C for cleaning. After cleaning, move the magnetic levitation platform again to the drainage point and initiate negative pressure drainage. Repeat this cleaning process three times to ensure complete removal of deprotection reagent residues.

[0051] S4. The magnetic levitation platform carrying the microwell array plate moves to the printing position below the array printhead. The printhead is mounted on a precision translation stage on a high-precision marble gantry, which independently controls the position and deposition volume of each printhead. The inkjet printhead precisely deposits the DMT-phosphoramidite monomer solution and activator dropwise into the microwells, where they undergo a coupling reaction with the terminal hydroxyl groups of the DNA chains within the wells. After a constant temperature coupling reaction of 30°C for 2 minutes, the magnetic levitation platform moves again to the drainage point, activates the drainage function, and injects cleaning fluid for cleaning.

[0052] S5. The magnetic levitation platform is then moved to the oxidant feed point, and 10 ml of iodine solution (0.02 M, a mixture of THF and water) is injected. The reaction is allowed to proceed at 25°C for 1 minute to form a stable phosphodiester bond. After the reaction is complete, the platform is moved again to the drain point, and the cleaning solution injection and draining steps are initiated. The cleaning process is repeated three times to remove residual reagents.

[0053] S6. Move the magnetic levitation platform carrying the microwell array plate to the capping reagent injection point. Inject 5 ml of cap A reagent (acetic anhydride) and 5 ml of cap B reagent (NMI) and continue capping at 25°C for 0.5 minutes. After capping, move the platform back to the drainage point to initiate the cleaning solution injection and drainage steps. Repeat the cleaning process three times.

[0054] S7. The magnetic levitation platform repeats steps S1-S6 above according to the established synthesis route, depositing one target nucleotide into the microwell in each cycle until the target DNA sequence is completed (in this example, the nucleotide sequence of the target DNA is "5-attagcaaggcacccgtcgaagttcacacgccgcccttgtcccggcccga cgccttcccaacttgtaaaacgcgctatgtaactaatccgatcggtcccttcgtccttattggcgatgctggccttttat tgggt-3"). The magnetic levitation platform moves with high precision between each step to ensure reagent supply and reaction stability, while also monitoring and recording temperature data in real time (see Table 1).

[0055] After synthesis, the microwell array plate was immersed in saturated ammonia solution and incubated at 55°C overnight to dissociate and deprotect the synthesized DNA strands from the chip surface. After vacuum concentration, the product was dissolved in 500 μl of pure water. A 1 μl aliquot of the product was used to determine the yield by absolute quantitative PCR. The total DNA yield was calculated to be 17.8 μg (see Table 1).

[0056] Example 2

[0057] The present embodiment is a method for high-throughput synthesis of DNA. The difference from Example 1 is that the specific operation of step S7 of this embodiment is as follows: the magnetic levitation platform repeats the above steps S1-S6 according to the established synthesis route, and deposits a target nucleotide monomer into the micropore in each round of circulation. A specified one of the four different monomers A / T / C / G can be deposited in each micropore. The type of monomer deposited in each micropore is specified by the sequence synthesis file. In this embodiment, a total of 7000 different DNA sequences were synthesized. The 5-end and 3-end of the target sequence are respectively fixed to a 15nt flank sequence (wherein the 5-end is 5'-ATTAGCAAGGCACCC and the 3-end is GGCCTTTTATTGGGT-3'), while the middle 105nt is a non-fixed sequence. Between each reaction step, the magnetic levitation platform moves with high precision between each link to ensure the stability of reagent supply and reaction, while monitoring and recording temperature data in real time (see Table 1).

[0058] After synthesis, the microwell array plate was immersed in saturated ammonia solution and reacted at 55°C overnight to completely dissociate the DNA chains on the solid support (microwell array plate) and remove the protecting groups. After the reaction, the resulting solution was vacuum concentrated, and the product was dissolved in 500 μl of pure water and mixed thoroughly to form the oligo pool sample. To accurately assess the synthesis yield, 1 μl of the solution was aspirated for absolute quantitative qPCR, which showed a total DNA yield of 18.5 μg (see Table 1).

[0059] Subsequently, 50ng DNA was quantitatively taken out from the oligo pool as a template, and 15 rounds of PCR amplification were performed to construct a sequencing library. After purification, the amplified product was sent to Novogene Laboratory and NGS sequencing was performed using a high-throughput sequencing platform (NovaSeq). The sequencing data volume was 2.0G, and the data alignment rate reached 99.14%, obtaining a total of 13,926,838 reads data. By analyzing the sequencing data, the number of reads of 7000 target sequences was extracted, and the median reads number of each sequence was calculated to be 1980. Further based on the reads distribution, an oligo abundance histogram was drawn, and its uniformity index 95 / 5 ratio was calculated, and the result was 2.28 (see Table 2), indicating that the oligo pool synthesized in the present embodiment has higher uniformity, and the uniformity is close to the ideal state.

[0060] Example 3

[0061] This embodiment is a method for high-throughput DNA synthesis. The differences from Example 1 are as follows: in step S2 of this embodiment, the microwell array plate temperature, deprotection reagent, and deprotection reagent reaction temperature are all set at 15°C; in step S3, the microwell array plate temperature, wash reagent, and reaction temperature are all set at 15°C; in step S4, the microwell array plate temperature, relevant phosphoramidite monomers, activation reagent, and reaction temperature are all set at 30°C; and in step S6, the microwell array plate temperature, capping reagent, and reaction temperature are all set at 20°C.

[0062] After synthesis, the microarray plate was immersed in saturated ammonia solution and incubated overnight at 55°C to dissociate and deprotect the synthesized DNA strands from the chip surface. After vacuum concentration, the product was dissolved in 500 μl of pure water. 1 μl of the product was taken and the yield was determined by absolute quantitative qPCR. The total DNA synthesis yield was calculated to be 12.2 μg (see Table 1). The synthesized product was sequenced for generation 1, and the synthesis error rate was calculated (see Figure 2).

[0063] Example 4

[0064] This embodiment is a method for high-throughput DNA synthesis. The differences from Example 1 are as follows: in step S2 of this embodiment, the microwell array plate temperature, deprotection reagent, and deprotection reagent reaction temperature are all set at 30°C; in step S3, the microwell array plate temperature, wash reagent, and reaction temperature are all set at 50°C; in step S4, the microwell array plate temperature, relevant phosphoramidite monomers, activation reagent, and reaction temperature are all set at 40°C; and in step S6, the microwell array plate temperature, capping reagent, and reaction temperature are all set at 40°C.

[0065] After synthesis, the microarray plate was immersed in saturated ammonia solution and incubated at 55°C overnight to dissociate and deprotect the synthesized DNA strands from the chip surface. After vacuum concentration, the product was dissolved in 500 μl of pure water. A 1 μl aliquot of the product was used to determine the yield by absolute quantitative PCR. The total DNA yield was calculated to be 11.4 μg (see Table 1).

[0066] Comparative Example 1

[0067] This example describes a method for high-throughput DNA synthesis. Unlike Example 1, the microwell array plate used as the synthesis support in this comparative example is mounted on a conventional mechanical displacement platform via a bracket, rather than a magnetic levitation platform. During the synthesis process, the reaction temperature is monitored and recorded in real time (see Table 2).

[0068] After synthesis, the microwell array plate was immersed in saturated ammonia solution and incubated at 55°C overnight to dissociate and deprotect the synthesized DNA strands from the chip surface. After vacuum concentration, the product was dissolved in 500 μl of pure water. A 1 μl aliquot of the product was used to determine the yield using absolute quantitative PCR. The total DNA synthesis yield was calculated to be 14.6 μg (see Table 1). The synthesized product was subjected to first-generation sequencing, and the synthesis error rate was calculated (see Figure 2).

[0069] Comparative Example 2

[0070] This example describes a method for high-throughput DNA synthesis. Unlike Example 2, the microwell array plate used for synthesis in this comparative example is fixed to a conventional mechanical displacement platform rather than a magnetically levitated platform. Temperature data is monitored and recorded in real time during the synthesis process (see Table 2).

[0071] After synthesis, the microarray plate was immersed in saturated ammonia solution and reacted overnight at 55°C to completely dissociate the DNA strands from the solid support and remove the protecting groups. After the reaction, the resulting solution was vacuum concentrated, the product dissolved in 500 μl of pure water, and mixed evenly to form an oligo pool sample. A 1 μl sample was taken for absolute quantitative qPCR analysis, which showed a total DNA yield of 15.3 μg (see Table 1). 50 ng of DNA was quantitatively removed from the oligo pool as template and subjected to 15 rounds of PCR amplification to construct a sequencing library. After purification, the amplified product was sequenced using a high-throughput sequencing platform (NovaSeq). The resulting data volume reached 2.0 GB, with a data alignment rate of 97.58%, resulting in a total of 10,496,814 reads. Data analysis extracted the read counts for 7000 target sequences, and the median read count for each sequence was calculated to be 1411. Furthermore, an oligo abundance histogram was plotted based on the read distribution, and the 95 / 5 ratio of the uniformity index was calculated. The result was 5.26 (see Table 2), indicating that the oligo pool synthesized in this control group was significantly insufficient in uniformity, which was significantly different from that in Example 2.

[0072] Table 1 Final DNA synthesis yields of each embodiment and comparative example 1 (all dissolved in 500 μl pure water)

[0073] Case Example 1 Example 3 Example 4 Comparative Example 1 Synthetic yield / μg 17.8 13.2 14.4 12.6 Temperature fluctuation range -0.1～+0.1 -0.1～+0.5 -0.1～+0.2 -0.2～+2.1

[0074] Table 2 Comparison of the accuracy of the synthetic sequences of Example 1 and Comparative Example 1

[0075] Case Example 1 Comparative Example 1 Accuracy 99.8％ 97％

[0076] Table 3 Temperature deviation data and oligo pool synthesis of Example 2 and Comparative Example 2

[0077] Case Example 2 Comparative Example 2 Temperature fluctuation range -0.1～+0.2 -0.5～2.5 Uniformity index 95 / 5 ratio 2.28 5.26 Synthesis yield 18.5 12.3 Median number of sequence reads / record 1980 1411

[0078] According to Table 1-3 and Figure 2-4From the experimental results, it can be seen that temperature has a certain influence on the yield of DNA synthesis. The closer to the optimum temperature, the higher the DNA synthesis yield, and the further it deviates from the optimal temperature range, the lower the DNA synthesis yield (see Table 1). This is because the coupling efficiency of the phosphoramidite monomer will be greatly reduced above or below the optimal temperature. At the same time, the stability of temperature will also affect the synthesis yield of DNA. The more stable the temperature performance, that is, the smaller the temperature fluctuation within the set range, the higher the DNA synthesis yield (see Table 1 and Table 3). More importantly, the stability of temperature during the synthesis process has an important influence on the quality of DNA synthesis. In the process of single sequence synthesis, at the set temperature, the more stable the temperature, that is, the smaller the fluctuation, the lower the error rate of DNA synthesis (see Table 2). In the process of high-throughput synthesis, stable temperature also affects the yield and quality of the DNA pool. The smaller the temperature fluctuation, the higher the DNA pool synthesis yield and the better uniformity; while the temperature fluctuation range is large, the DNA pool synthesis yield is relatively low and the uniformity performance is poor (see Table 2, Figure 2 and Figure 3 ), this is because drastic temperature fluctuations will destroy the dynamic equilibrium of the reaction reagents, thereby generating a large number of side reactions and by-products, such as depurination of DNA chains, incorrect deprotection, etc.

[0079] In summary, the present invention uses a microcomputer to control the magnetic levitation mobile platform carrying the solid-phase synthesis carrier to perform high-precision displacement along a pre-set route during the synthesis process, ensuring uniform synthesis of DNA at different sites. The magnetic levitation mobile platform also reduces mechanical friction and heat generation, ensuring precise temperature control during the coupling reaction stage, thereby effectively reducing the error rate of DNA synthesis.

[0080] The above-described embodiments merely represent preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the spirit of the present invention, and such modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. A method for high-throughput DNA synthesis, characterized in that The steps include: S1. Loading the solid-phase synthesis carrier: loading the solid-phase synthesis carrier onto the magnetic levitation mobile platform of the synthesizer; S2, deprotection: using a deprotection reagent to remove the protective groups on the surface of the solid support; S3, cleaning: cleaning the residual deprotection reagent; S4, coupling reaction: depositing DMT-phosphoramidite monomer and performing coupling reaction; S5, oxidation: using iodine solution to oxidize the coupled solid phase synthesis support; S6. Capping: Use capping reagents to cap and protect the uncoupled sites; S7, cyclic synthesis: The magnetic levitation mobile platform moves along a predetermined route, and steps S1-S6 are repeated until high-throughput synthesis of the DNA sequence is completed.

2. A method for high-throughput DNA synthesis according to claim 1, characterized in that: The solid phase synthesis carrier is a micron array well plate.

3. A method for high-throughput DNA synthesis according to claim 2, characterized in that: The micron array well plate has both a hydrophobic surface and a hydrophilic surface and is grafted with Unylinker. The hydrophobic surface is the plane of the micron array well plate, and the hydrophilic surface is the inner surface of the micropores of the micron array well plate.

4. A method for high-throughput DNA synthesis according to claim 1, characterized in that: The magnetic levitation platform is equipped with a microcomputer and a semiconductor temperature control module, and the semiconductor temperature control module is integrated with a temperature sensor.

5. A method for high-throughput DNA synthesis according to claim 1, characterized in that: In step S2, the deprotection reaction temperature is 10°C to 35°C.

6. A method for high-throughput DNA synthesis according to claim 1, characterized in that: In step S3, the cleaning temperature is 10°C to 70°C.

7. A method for high-throughput DNA synthesis according to claim 1, characterized in that: In step S4, the DMT-phosphoramidite monomer is deposited by an inkjet printing method.

8. A method for high-throughput DNA synthesis according to claim 1, characterized in that: In step S4, the coupling reaction temperature is 20°C to 50°C.

9. A method for high-throughput DNA synthesis according to claim 1, characterized in that: In step S6, the temperature of the end-capping reaction is 10°C to 50°C.

10. A method for high-throughput DNA synthesis according to claim 1, characterized in that: In step S6, the capping reagents are acetic anhydride and N-methylimidazole.

Images