Gene, primer set for identifying chrysosporium and application thereof

Abstract

The application provides a gene, a primer set and an application for identifying golden ear, and belongs to the technical field of biological detection. The application obtains specific gene fragments of two species contained in the golden ear through large-scale whole genome comparison analysis, designs species-specific primers based on the specific gene fragments, and further realizes identification of the effective species of the golden ear. The identification is extremely crucial in the production process of the effective species of the golden ear, and can maximize the guarantee of the fruiting rate in the production of the golden ear.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, and in particular relates to the genes, primer sets and applications for identifying golden ear fungus. Background Technology

[0002] Golden Ear ( Naematelia aurantialba The fruiting body is characterized by a rubbery or gel-like brain-like outer layer, bright yellow or orange in color, and an inner fibrous, relatively hard, grayish-white layer. Golden ear fungus is widely distributed globally and is considered an important medicinal and edible fungus in Asia. It has a long history in traditional Chinese medicine, often used for liver protection, cough relief, and phlegm reduction. Modern medical research shows that golden ear fungus contains various effective bioactive components, including polysaccharides, ergosterol, vitamins, amino acids, proteins, and fats, exhibiting various pharmacological activities, including hypoglycemic, lipid-lowering, immunomodulatory, antioxidant, antitumor, and anticoagulant effects. Golden ear fungus has been widely cultivated on a large scale in China for over forty years, with an annual production capacity of approximately 3,000 tons of fresh mushrooms.

[0003] The gelatinous fruiting body structure of *Auricularia auricula-judae* is morphologically similar to that of other fungi in the class Tremella, especially *Tremella fuciformis*. Therefore, although... Naematelia The genus was established very early, but most scientists consider it to be... Tremella (Tremella fuciformis family, Tremellales Synonyms for the same thing. Until recently, scientists used molecular phylogenetic analysis to show that... Naematelia and Tremella They represent unrelated phylogenetic lineages, therefore, Naematilia The name was renamed to suit [the needs of the people]. N.epiphala-N.aurantia (Schwein.) Burt's species complex. In fact, unlike Tremella fuciformis and other homogeneous macrofungi composed of only one type of fungus, the fruiting body of Auricularia auricula-judae is considered a heterogeneous structure. Recent microscopic observations and ITS amplification have further confirmed the coexistence of Auricularia auricula-judae and Auricularia velutipes fungi in the fruiting body, but research on the spatial ratio and interaction between the two fungi is lacking.

[0004] The heterogeneous fruiting body structure suggests that *Auricularia auricula-judae* and *Trichoderma truncatula* (… Stereum hirsutum The complex interaction between *Auricularia auricula-judae* and *Auricularia auricula-judae* is clearly reflected in the innovation of cultivation techniques. Cultivating *Auricularia auricula-judae* alone cannot form the fruiting body structure, and using *Trichoderma harzianum* alone can only produce *Trichoderma harzianum* fruiting bodies, also failing to yield *Auricularia auricula-judae* fruiting bodies. In fact, only when the inoculum of both fungi is prepared simultaneously in a specific ratio and sown in the cultivation substrate, completing nutrient transformation, can healthy *Auricularia auricula-judae* fruiting bodies be obtained. This makes the preparation of effective inoculum extremely crucial. To ensure the normal development of *Auricularia auricula-judae* fruiting bodies, a detection method is urgently needed to ensure that both *Auricularia auricula-judae* and *Trichoderma harzianum* are present simultaneously in the production inoculum. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide genes, primer sets and applications for identifying Auricularia auricula-judae and Leuciscus fasciatus.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides genes for identifying Auricularia auricula-judae and Leuciscus truncatula, said genes being divided into Auricularia auricula-judae-specific genes and Leuciscus truncatula-specific genes;

[0008] The specific genes for golden ear include Gene001315, Gene001316, Gene005441, or Gene005440;

[0009] The specific genes of *Trichoderma harzianum* include Gene000039, Gene002713, Gene005147, Gene006980, or Gene007705;

[0010] The nucleotide sequence of Gene001315 is shown in SEQ ID No. 1;

[0011] The nucleotide sequence of Gene001316 is shown in SEQ ID No. 2;

[0012] The nucleotide sequence of Gene005441 is shown in SEQ ID No. 3;

[0013] The nucleotide sequence of Gene005440 is shown in SEQ ID No. 4;

[0014] The nucleotide sequence of Gene000039 is shown in SEQ ID No. 5;

[0015] The nucleotide sequence of Gene002713 is shown in SEQ ID No. 6;

[0016] The nucleotide sequence of Gene005147 is shown in SEQ ID No. 7;

[0017] The nucleotide sequence of Gene006980 is shown in SEQ ID No. 8;

[0018] The nucleotide sequence of Gene007705 is shown in SEQ ID No. 9.

[0019] This invention provides a primer set for identifying Auricularia auricula-judae and Leuciscus truncatula, wherein the primer set is a primer set for amplifying Auricularia auricula-judae-specific genes and Leuciscus truncatula-specific genes.

[0020] Primers for amplifying the golden ear-specific gene include N1316F / R or N5440F / R;

[0021] The primer set for amplifying the specific gene of *Trichoderma harzianum* includes primers S0039F / R or S6980F / R.

[0022] N1316F / R is used to amplify the Gene001316 gene. The nucleotide sequence of the forward primer N1316F is shown in SEQ ID No. 12, and the nucleotide sequence of the reverse primer N1316R is shown in SEQ ID No. 13.

[0023] N5440F / R is used to amplify the Gene005440 gene. The nucleotide sequence of the forward primer N5440F is shown in SEQ ID No. 16, and the nucleotide sequence of the reverse primer N5440R is shown in SEQ ID No. 17.

[0024] S0039F / R is used to amplify the Gene000039 gene. The nucleotide sequence of the forward primer S0039F is shown in SEQ ID No. 18, and the nucleotide sequence of the reverse primer S0039R is shown in SEQ ID No. 19.

[0025] S6980F / R is used to amplify the Gene006980 gene. The nucleotide sequence of the forward primer S6980F is shown in SEQ ID No. 24, and the nucleotide sequence of the reverse primer S6980R is shown in SEQ ID No. 25.

[0026] This invention provides the application of the gene or primer set in the preparation of products for identifying golden ear fungus.

[0027] A kit for quantitative and qualitative identification of Auricularia auricula-judae and Leuciscus faecium, characterized in that the kit comprises the primer set described above.

[0028] This invention provides a method for quantitative and qualitative identification of *Auricularia auricula-judae* and *Trichoderma harzianum*, comprising the following steps:

[0029] (1) Extract DNA from the sample to be tested;

[0030] (2) Use primer sets to perform PCR or RT-PCR amplification on the DNA of the sample to be tested to obtain amplification products;

[0031] (3) Determine whether the sample to be tested is Auricularia auricula-judae based on the PCR amplification product. If the PCR amplification product contains both Auricularia auricula-judae-specific gene and Auricularia buergeriana-specific gene, then the sample to be tested is Auricularia auricula-judae. If the PCR amplification product contains only Auricularia auricula-judae-specific gene or Auricularia buergeriana-specific gene, then the sample to be tested contains only the single species corresponding to the Auricularia auricula-judae-specific gene or the Auricularia buergeriana-specific gene.

[0032] (4) Determine the relative contents of Auricularia auricula-judae and Leptomeria trifasciata in the sample based on the Ct value of RT-PCR amplification;

[0033] The primer set is the primer set used to amplify the specific genes of Auricularia auricula-judae and Auricularia buergeriana.

[0034] The samples to be tested include fruiting bodies of Auricularia auricula-judae or strains of Auricularia auricula-judae.

[0035] Preferably, the PCR amplification reaction system in step (2) consists of 8-12 µl of PCR supermix, 0.5-2 µl of forward primer, 0.5-2 µl of reverse primer, 4-8 µl of ddH2O, and 1-3 µl of sample DNA.

[0036] The initial concentration of the forward primer is 8-12 µM;

[0037] The initial concentration of the reverse primer is 8–12 µM.

[0038] Preferably, the PCR amplification reaction program is 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s and 57~63℃ extension for 30 s, for a total of 42 cycles.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] This invention uses large-scale whole-genome comparative analysis to obtain specific gene fragments of two fungal species contained in Auricularia auricula-judae. Based on this, species-specific primers are designed to identify the effective fungal species of Auricularia auricula-judae. This is extremely important in the production process of effective fungal species of Auricularia auricula-judae and can maximize the fruiting rate in Auricularia auricula-judae production. Attached Figure Description

[0041] Figure 1 A map showing the distribution of the fruiting bodies and substrate of *Auricularia auricula-judae* on the slope and at the sampling points;

[0042] Figure 2 The amplification efficiencies of the four candidate specific primer sets are: a, b are primer combination S0039F / R; c, d are primer combination S6980F / R; e, f are primer combination N1316F / R; g, h are primer combination N5440F / R. Detailed Implementation

[0043] This invention provides genes for identifying Auricularia auricula-judae, said genes being divided into Auricularia auricula-judae-specific genes and Auricularia trichomoniasis-specific genes;

[0044] The specific genes for golden ear include Gene001315, Gene001316, Gene005441, or Gene005440;

[0045] The specific genes of Stereum hirsutum include Gene000039, Gene002713, Gene005147, Gene006980 or Gene007705;

[0046] The nucleotide sequence of Gene001315 is shown in SEQ ID No.1;

[0047] SEQ ID No.1:

[0048] TCACGCCAATGACCGATGAACAGCTCGAAGACAGCATGGTGCTTGGGTTTCACAAAAGTATCAGAGATCTGTTCGATGGCGACATTGAGAAGAATGATGCGTTCCGGATAGCAGTAAGCAGTTACACTGATGTCCAGTATCCAGGGCTCTGACGTAGTTGTAGGCAGTCATCGTCACCGGTCACCCGAACGGTTTCAACAGCTCCGAGTCCTTCCAACATGAGACCTTTGCAATCCTGGATCGCGCAGTTTATCTGGCAACGCTCAAACGGCGTGGTGACCTGTCAGACGAACAACGGGGCTGGATAAGG;

[0049] The nucleotide sequence of Gene001316 is shown in SEQ ID No.2;

[0050] SEQ ID No.2:

[0051] AGTGGAAAAGGAGACGCAGTCTTCCAAACCACTAGGCATGATAGTGAGTTAGCGTCTTCCGTGGAGATTTCGGAGAGACGCGGCCCAGCTGACACGATTGACAGAAGGTCGTGGTTAGGGGCACTGAGCGGAGTTTGGCACGCTTCAATAAGGTCAAGTACAAGTCGTTTGCCAATCTGAATCGCGCCCAATACCTGGCTTCACATGATCGAAACGACCTCTCACCGAATCAAAGCAATCTGGTCGCCCGTGTCAGGTCATACAGCGATGCTCTGGAGCCTGCGGCCAGGTCTCAAGCCTTATTGACTGCCGTAGAAGCTGTATTCGGTCTTGCCGGTG;

[0052] The nucleotide sequence of Gene005441 is shown in SEQ ID No.3;

[0053] SEQ ID No.3:

[0054] CCCGTAGAGTTCCAGCGTTTCTCCGTTGTCGTCCGATCCAATAACAAACGGCCAATCCGGCAGCTTGGCCAGATACGCGAGGCCGTGAGCGGTCTCATCTTGAAACCGGGTGCACGTATCTCCCAGCTCCCAGTCTTGCCGCATGTGAGCACGGTGCTTCTCACACACACCTTTGGACCGGAACCTTTGACTTATACTGGTACTGTCACCCGGAAGAGCATGCTGCCGTGTGAGTTGACGAGTTTCGCCATACGCGTCGACCCAGAGGCGTGAGGCGTGGGGGCACGCTGATCGCGCTGGCTCGCTGACTAGGTGCCAGACAAGCGGACGCGCAAACCAAGTCAAA;

[0055] The nucleotide sequence of Gene005440 is shown in SEQ ID No.4;

[0056] SEQ ID No.4:

[0057] ATCGAAACTCGCGCAAATCGCTCTGCTGTCGGCCCGCCCCTAGGCTACACGCGCGTAGATGAAACGACCGTCGCCACGAGTGCGCAGAAAATACCCAATCTTTGGCACATCAGAATGCTCAAGCACGGCTTGACTCCCAGTCTGGACGGTGAGTCGTCCGTGGGCTGACGGACCTGCGCATGTATCGTCGTCCCCAATGCAGATGAGACATCCATAGCTGACCTCACGCAGCTCCCGACCCGTCGCGGTCCGGACTTCTCATTGCCCCCGCGCTTCGGGAGGGCGAAGACGGCCGTCAGTGGTTTCAACGGAGCAAGAGCAGTTTCCCGAACCGTA;

[0058] The nucleotide sequence of Gene000039 is shown in SEQ ID No.5;

[0059] SEQ ID No.5:

[0060] ATCCCACCGAAGTCGTTTCTCCTTTGTCAGAAGTTGGTTCAATGCTTCGAATGCCGCCTTGAGCTATTGACAAAGTCGGGTCAGCTTGAGCCTACGGTAGGATGCACCTTACAATTACCTTGCTGAATCTCCTTGAAATGGAGAGGGGTACGTACTGGTACCCATTTCTGAGAAGTTCTTCCGATACTTTTTCATACGCCGCATCGGTGAATTGACCCTTGGACGAAAGCCCATCAGCGCCCGCCTGTGCTAGACTGCTGACAATAATAGTGTCTGCTTCGAGCGTGTAG;

[0061] The nucleotide sequence of Gene002713 is shown in SEQ ID No.6;

[0062] SEQ ID No.6:

[0063] CATTTGTGGTTCGTTCTGCGTCGTACCGGGGTCAATTGAAGCGTACTTGGATTGTGCATATGGCCATGTATTTATTTTGGAGGGATATGTGCTCCTGATTGTATGTTACGACAATCTCTGGCTTGGTGAGTACCCCCCATACCCCCTCACCATCAAAAAATGTGTCGCCCTTGTTCAATTGCGTCTCATTCAGTGTCACACTGGGACCGATTGACACGTA;

[0064] The nucleotide sequence of Gene005147 is shown in SEQ ID No.7;

[0065] SEQ ID No.7:

[0066] ACATCGACACAGCAGGTCTCGCAACTGGGAGTTTTGTTTTAAATGGGTTGAAGTACTGGATTGTCGCACGTCCGGCGCCTCGCGAAGAAAATCCAGACGCTCACCTCCGATATCGTGATTACATGGTGGGCCACCGAGCAACCCGTATCAGACGATCAGATCGGTTTGAGGCTGTATATCTGGAGCAATGTACAGCCTTGTAAGTTCCATTTTTTTCATTGCGTTGAGCCGTATTCTCAATATTTTTTGGTGTAGCCTCATGCGCCCTGGAACACTGCACTACGTTCTTACTCCGTTGTCCTCCTTTGTTGCTGGG;

[0067] The nucleotide sequence of Gene006980 is shown in SEQ ID No.8;

[0068] SEQ ID No.8:

[0069] CAACGGCACACACAAAGAGGTACGGAGATACCTGGGGTACGATCTTTCTTTATTCCTATCTGATGTGGTGTCTCTGACCACGAACCTTCAGCATCACAGCCGAACGCACCGAGATCATACAGAGGTGGTGTGATACAACGTTCCGATATGATGACAGTACTGATAAAAATGCCTCGTAGCACCGTAATACTGTGGATGAGTGGGATAACCTCCAACACTTTGGACAGACCGAAGAAGTGGTCCCCTTCGAGCGTCCCGAACACAAGAAAGTCCTCGAGGTGCAATCTGCGCCACAATCAAGCCGTTTATGCCCGAGGGAGCTT;

[0070] The nucleotide sequence of Gene007705 is shown in SEQ ID No.9

[0071] SEQ ID No.9:

[0072] GGCAGAGGTTCCATACCGAGCGTAAGTACAGGAGCACGCAGAGTGCTGTCGTCGAAGTCGCTGAACAGATGAGAAGGAGGGGGAAACATATGAGCTATCAAACGCCGTTCGGAAAGCTAGCTTTATAACACGAAAACTTACAGCCTCATGTTCTTTCGAATGCTGTCCTGCCGCACTATCGCCCTCATTTCGTCGTC.

[0073] This invention provides a primer set for identifying Auricularia auricula-judae, wherein the primer set is a primer set for amplifying Auricularia auricula-judae-specific genes and Auricularia buergeriana-specific genes.

[0074] Primers for amplifying the golden ear-specific gene include N1316F / R or N5440F / R;

[0075] The primer set for amplifying the specific gene of *Trichoderma harzianum* includes primers S0039F / R or S6980F / R.

[0076] N1316F / R is used to amplify the Gene001316 gene. The nucleotide sequence of the forward primer N1316F is shown in SEQ ID No. 12, and the nucleotide sequence of the reverse primer N1316R is shown in SEQ ID No. 13.

[0077] SEQ ID No.12: AGTGGAAAAGGAGACGCAGT;

[0078] SEQ ID No.13: CACCGGCAAGACCGAATACA;

[0079] N5440F / R is used to amplify the Gene005440 gene. The nucleotide sequence of the forward primer N5440F is shown in SEQ ID No. 16, and the nucleotide sequence of the reverse primer N5440R is shown in SEQ ID No. 17.

[0080] SEQ ID No.16: ATCGAAACTCGCGCAAATCG;

[0081] SEQ ID No.17:TACGGTTCGGGAAACTGCTC;

[0082] S0039F / R is used to amplify the Gene000039 gene. The nucleotide sequence of the forward primer S0039F is shown in SEQ ID No. 18, and the nucleotide sequence of the reverse primer N0039R is shown in SEQ ID No. 19.

[0083] SEQ ID No.18: ATCCCACCGAAGTCGTTTCT;

[0084] SEQ ID No.19: CTACACGCTCGAAGCAGACA;

[0085] S6980F / R is used to amplify the Gene006980 gene. The nucleotide sequence of the forward primer S6980F is shown in SEQ ID No. 24, and the nucleotide sequence of the reverse primer N6980R is shown in SEQ ID No. 25.

[0086] SEQ ID No.24:CAACGGCACACACAAAGAGG;

[0087] SEQ ID No. 25: AAGCTCCCTCGGGCATAAAC.

[0088] This invention provides the application of the gene or primer set in the preparation of products for qualitative and quantitative identification of *Auricularia auricula-judae*.

[0089] This invention provides a kit for qualitative and quantitative identification of *Auricularia auricula-judae*, wherein the kit preferably includes the primer set, PCR supermixing solution and ddH2O.

[0090] This invention provides a method for qualitative and quantitative identification of *Auricularia auricula-judae*, comprising the following steps:

[0091] (1) Extract DNA from the sample to be tested;

[0092] (2) Use primer sets to perform PCR or RT-PCR amplification on the DNA of the sample to be tested to obtain amplification products;

[0093] (3) Determine whether the sample to be tested is Auricularia auricula or the distribution of Auricularia auricula based on the PCR amplification product. If the PCR amplification product includes both Auricularia auricula-specific genes and Auricularia buergeriana-specific genes, then the sample to be tested is Auricularia auricula. If the PCR amplification product only contains Auricularia auricula-specific genes or Auricularia buergeriana-specific genes, then the sample to be tested contains only the single species corresponding to the Auricularia auricula-specific genes or Auricularia buergeriana-specific genes.

[0094] (4) Determine the relative contents of Auricularia auricula-judae and Leptomeria trifasciata in the sample based on the Ct value of RT-PCR amplification;

[0095] The primer set is the primer set used to amplify the specific genes of Auricularia auricula-judae and Auricularia buergeriana.

[0096] The samples to be tested include fruiting bodies of Auricularia auricula-judae or strains of Auricularia auricula-judae.

[0097] In this invention, the PCR amplification reaction system in step (2) consists of PCR supermix, forward primer, reverse primer, ddH2O and sample DNA;

[0098] The volume of the PCR ultramix solution is preferably 8-12 µl, more preferably 9-11 µl, and even more preferably 10 µl;

[0099] The volume of the forward primer is preferably 0.5~2 µl, more preferably 0.7~1.5 µl, and even more preferably 1 µl; the initial concentration of the forward primer is preferably 8~12 µM, more preferably 9~11 µM, and even more preferably 10 µM.

[0100] The reverse primer is preferably 0.5~2 µl, more preferably 0.7~1.5 µl, and even more preferably 1 µl; the initial concentration of the reverse primer is preferably 8~12 µM, more preferably 9~11 µM, and even more preferably 10 µM.

[0101] The volume of ddH2O is preferably 4~8 µl, more preferably 5~7 µl, and even more preferably 6 µl;

[0102] The volume of the sample DNA is preferably 1-3 µl, more preferably 1.5-2.5 µl, and even more preferably 2 µl; the initial concentration of the sample DNA is preferably 10-50 µM, more preferably 15-35 µM, and even more preferably 25 ng / µL.

[0103] In this invention, the PCR amplification reaction program is 95°C pre-denaturation for 5 min; 95°C denaturation for 10 s and extension for 30 s, for a total of 42 cycles. The extension temperature is preferably 57~63°C, more preferably 58~61°C, and even more preferably 60°C.

[0104] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0105] Example 1: Development of species-specific primers for *Auricularia auricula-judae* and *Gynostemma pentaphyllum*

[0106] The genomes of 54 publicly published species from the Agaricus subphylum (Table 1) were downloaded, including 12 species of *Tremellomycetes*, 2 species of *Dacrymycetes*, 38 species of *Agaricomycetes*, and 2 species of *Wallemiomycete*. Comparative genomic analysis was performed, and the genomes were compared with those of *Auricularia auricula-judae* and *Gynostemma pentaphyllum*, totaling 56 genomes. Species-specific genes for *Auricularia auricula-judae* and *Gynostemma pentaphyllum* were identified, and species-specific primers were designed based on these genes. Detailed information on the 56 genomes is shown in Table 1.

[0107] Table 1. Detailed information on 56 genomes used for comparative genomic analysis.

[0108]

[0109] The genomes of *Auricularia auricula-judae* and *Trichoderma truncatula* have been uploaded to https: / / doi.org / 10.6084 / m9.figshare.28581020.

[0110] The specific procedures for screening specific genes are briefly described below: First, based on the encoded proteins of 56 species, orthologous gene analysis was performed using OrthoFinder. Proteins encoded only in the genomes of *Auricularia auricula-judae* and *Trichoderma truncatula* were selected, and their corresponding gene and genomic sequences were extracted as candidate species-specific gene sequences. Subsequently, blastn was used to align the candidate sequences with the genomes of other species, eliminating sequences with an evalue less than 10. -20 Potential homologous sequences with a homologous sequence length greater than 200 bp were identified; finally, the remaining species-specific sequences were compared with the NCBI database to confirm that they only have the highest homology in the target species.

[0111] Homology analysis showed that the 56 species had an average of 1,610 orthologous genes, each with a varying number of species-specific genes, with *Auricularia auricula-judae* and *Trichoderma truncatula* having 506 and 3,614 genes, respectively.

[0112] By comparing the intra-species and inter-species nucleic acid sequences of the target genes and eliminating potential non-specific sequences, four species-specific genes (Gene001315, Gene001316, Gene005441, and Gene005440) from *Auricularia auricula-judae* and five species-specific genes (Gene000039, Gene002713, Gene005147, Gene006980, and Gene007705) from *Clerodendrum trichotomum* were selected as species-specific sequence fragments. These fragments showed no homologous sequences outside the target species in comparisons across 56 candidate species and in the NCBI Nucleotidecollection (nr / nt), Whole-genome shotgun contigs (wgs), Expressed sequence tags (est), Transcriptome Shotgun Assembly (TSA), and High throughput genomic sequences (HTGS) databases, indicating their species specificity. The specific nucleotide sequences of the specific genes are as follows:

[0113] The nucleotide sequence of Gene001315 is shown in SEQ ID No. 1;

[0114] SEQ ID No. 1:

[0115] TCACGCCAATGACCGATGAACAGCTCGAAGACAGCATGGTGCTTGGGTTTCACAAAAGTATCAGAGATCTGTTCGATGGCGACATTGAGAAGAATGATGCGTTCCGGATAGCAGTAAGCAGTTACACTGATGTCCAGTATCCAGGGCTCTGACGT AGTTGTAGGCAGTCATCGTCACCGGTCACCCGAACGGTTTCAACAGCTCCGAGTCCTTCCAACATGAGACCTTTGCAATCCTGGATCGCGCAGTTTATCTGGCAACGCTCAAACGGCGTGGTGACCTGTCAGACGAACAACGGGGCTGGATAAGG;

[0116] The nucleotide sequence of Gene001316 is shown in SEQ ID No. 2;

[0117] SEQ ID No. 2:

[0118] AGTGGAAAAGGAGACGCAGTCTTCCAAACCACTAGGCATGATAGTGAGTTAGCGTCTTCCGTGGAGATTTCGGAGAGACGCGGCCCAGCTGACACGATTGACAGAAGGTCGTGGTTAGGGGCACTGAGCGGAGTTTGGCACGCTTCAATAAGGTCAAGTACAAGTCGTTTGCCAATCTGAATCGCGCCCAATACCTGGCTTCACATGATCGAAACGACCTCTCACCGAATCAAAGCAATCTGGTCGCCCGTGTCAGGTCATACAGCGATGCTCTGGAGCCTGCGGCCAGGTCTCAAGCCTTATTGACTGCCGTAGAAGCTGTATTCGGTCTTGCCGGTG;

[0119] The nucleotide sequence of Gene005441 is shown in SEQ ID No.3;

[0120] SEQ ID No.3:

[0121] CCCGTAGAGTTCCAGCGTTTCTCCGTTGTCGTCCGATCCAATAACAAACGGCCAATCCGGCAGCTTGGCCAGATACGCGAGGCCGTGAGCGGTCTCATCTTGAAACCGGGTGCACGTATCTCCCAGCTCCCAGTCTTGCCGCATGTGAGCACGGTGCTTCTCACACACACCTTTGGACCGGAACCTTTGACTTATACTGGTACTGTCACCCGGAAGAGCATGCTGCCGTGTGAGTTGACGAGTTTCGCCATACGCGTCGACCCAGAGGCGTGAGGCGTGGGGGCACGCTGATCGCGCTGGCTCGCTGACTAGGTGCCAGACAAGCGGACGCGCAAACCAAGTCAAA;

[0122] The nucleotide sequence of Gene005440 is shown in SEQ ID No.4;

[0123] SEQ ID No.4:

[0124] ATCGAAACTCGCGCAAATCGCTCTGCTGTCGGCCCGCCCCTAGGCTACACGCGCGTAGATGAAACGACCGTCGCCACGAGTGCGCAGAAAATACCCAATCTTTGGCACATCAGAATGCTCAAGCACGGCTTGACTCCCAGTCTGGACGGTGAGTCGTCCGTGGGCTGACGGACCTGCGCATGTATCGTCGTCCCCAATGCAGATGAGACATCCATAGCTGACCTCACGCAGCTCCCGACCCGTCGCGGTCCGGACTTCTCATTGCCCCCGCGCTTCGGGAGGGCGAAGACGGCCGTCAGTGGTTTCAACGGAGCAAGAGCAGTTTCCCGAACCGTA;

[0125] The nucleotide sequence of Gene000039 is shown in SEQ ID No.5;

[0126] SEQ ID No.5:

[0127] ATCCCACCGAAGTCGTTTCTCCTTTGTCAGAAGTTGGTTCAATGCTTCGAATGCCGCCTTGAGCTATTGACAAAGTCGGGTCAGCTTGAGCCTACGGTAGGATGCACCTTACAATTACCTTGCTGAATCTCCTTGAAATGGAGAGGGGTACGTACTGGTACCCATTTCTGAGAAGTTCTTCCGATACTTTTTCATACGCCGCATCGGTGAATTGACCCTTGGACGAAAGCCCATCAGCGCCCGCCTGTGCTAGACTGCTGACAATAATAGTGTCTGCTTCGAGCGTGTAG;

[0128] The nucleotide sequence of Gene002713 is shown in SEQ ID No.6;

[0129] SEQ ID No.6:

[0130] CATTTGTGGTTCGTTCTGCGTCGTACCGGGGTCAATTGAAGCGTACTTGGATTGTGCATATGGCCATGTATTTATTTTGGAGGGATATGTGCTCCTGATTGTATGTTACGACAATCTCTGGCTTGGTGAGTACCCCCCATACCCCCTCACCATCAAAAAATGTGTCGCCCTTGTTCAATTGCGTCTCATTCAGTGTCACACTGGGACCGATTGACACGTA;

[0131] The nucleotide sequence of Gene005147 is shown in SEQ ID No.7;

[0132] SEQ ID No.7:

[0133] ACATCGACACAGCAGGTCTCGCAACTGGGAGTTTTGTTTTAAATGGGTTGAAGTACTGGATTGTCGCACGTCCGGCGCCTCGCGAAGAAAATCCAGACGCTCACCTCCGATATCGTGATTACATGGTGGGCCACCGAGCAACCCGTATCAGACGATCAGATCGGTTTGAGGCTGTATATCTGGAGCAATGTACAGCCTTGTAAGTTCCATTTTTTTCATTGCGTTGAGCCGTATTCTCAATATTTTTTGGTGTAGCCTCATGCGCCCTGGAACACTGCACTACGTTCTTACTCCGTTGTCCTCCTTTGTTGCTGGG;

[0134] The nucleotide sequence of Gene006980 is shown in SEQ ID No.8;

[0135] SEQ ID No.8:

[0136] CAACGGCACACACAAAGAGGTACGGAGATAACCTGGGGTACGATCTTTCTTTATTCCTATCTGATGTGGTGTCTCTGACCACGAACCTTCAGCATCACAGCCGAACGCACCGAGATCATACAGAGGTGGTGTGATACAACGTTCCGATATGATGACAGTACTG ATAAAAATGCCTCGTAGCACCGTAATACTGTGGATGAGTGGGATAACCTCCAACACTTTGGACAGACCGAAGAAGTGGTCCCTTCGAGCGTCCCGAACACAAGAAAGTCCTCGAGGTGCAATCTGCGCCACAATCAAGCCGTTTATGCCCGAGGGAGCTT;

[0137] The nucleotide sequence of Gene007705 is shown in SEQ ID No. 9.

[0138] SEQ ID No. 9:

[0139] GGCAGAGGTTCCATACCGAGCGTAAGTACAGGAGCACGCAGAGTGCTGTCGTCGAAGTCGCTGAACAGATGAGAAGGAGGGGGAAACATATGAGCTATCAAACGCCGTTCGGAAAGCTAGCTTTATAACACGAAAACTTACAGCCTCATGTTCTTTCGAATGCTGTCCTGCCGCACTATCGCCCTCATTTCGTCGTC.

[0140] Primer design was performed using the primer-BLAST program. The upstream and downstream primers were preferably adapted to the exon region, with a target sequence length between 150-350 bp, an annealing temperature of 60℃±3℃, and a preferred primer length of 20 bp. Primer sets with no more than four self-complementarities for each upstream and downstream primer, and no more than two self-3' complementarities, were selected as candidate primers. Primer synthesis was performed by Qingke (Beijing, China) Biotechnology Co., Ltd.

[0141] To verify the specificity of the primers, the designed primers were used to amplify and detect pure *Trichoderma repens* and *Auricularia auricula-judae*. The results showed that the species-specific primers could only be effectively amplified within their respective species, and no amplification results were obtained between opposing species, confirming the species specificity of these primers. Primers are detailed in Table 2.

[0142] Table 2. Species-specific primers for *Auricularia auricula-judae* and *Trichoderma truncatula*.

[0143]

[0144] ND indicates that no specific fragment was detected.

[0145] Example 2: Cultivation and Sample Collection of Golden Ear Fruiting Bodies

[0146] The fruiting bodies of *Auricularia auricula-judae* (with live substrate) used in this experiment were cultivated under factory-scale conditions. The cultivation method is briefly described as follows: the cultivation bag size was 18×33 cm, each substrate weighed approximately 2 kg, and the substrate formula was: 58.5% sawdust, 30% cottonseed hulls, 10% wheat bran, and 1.5% lime. A liquid spawn mixture of *Auricularia auricula-judae* and *Gynostemma pentaphyllum* was used, with two inoculation points on one side of the substrate, each inoculated with 1 mL of the mixed spawn. After inoculation, the substrate was incubated at a constant temperature of 24℃ for approximately 25 days, after which the mycelium had fully colonized the entire substrate. Thirty days after inoculation, the substrate was transferred to a fruiting room for induction and management of fruiting: the fruiting body cultivation temperature was 22-23℃, and the air humidity was 85-95%. Healthy, mature fruiting bodies (with substrate) were selected for subsequent experiments.

[0147] Along the central position of the fruiting body and the vertical plane of the substrate, the complete fruiting body and substrate are cut in half (see...). Figure 1 Nine samples were taken from the top to the bottom of the cross-section. The outermost edge of the fruiting body (predominantly golden-yellow tissue) was designated L01; the junction of the golden-yellow and white tissues was designated L02; the center of the fruiting body was designated L03; the mycelium further down was designated L04; and the junction of the fruiting body and the substrate was designated L05. Continuing in a straight line downwards, four more sampling points were evenly spaced (approximately 3 cm apart), designated L06-L09, with L07 being the midpoint of the mycelium. All samples were 1 cm³ in size and volume. 3 Equal amounts of samples were taken from the corresponding locations of three different samples, and the samples from the same sampling point were mixed before use.

[0148] Example 3: Extraction of Genomic DNA

[0149] Genomic DNA was extracted using a magnetic bead-based plant DNA extraction kit (the kit was sourced from ONREW, Plant DNA Extraction CZ kit, DNP621-02C, Guangzhou Haiyan, China; the washing solution described below is Buffer W1A from the kit, and the dissolving solution is Buffer EB from the kit). Genomic DNA was extracted using an automated DNA extractor. The extraction method is briefly described below: First, the sample obtained in Example 2 was ground into powder using liquid nitrogen. Approximately 0.2 g of powder was added to 500 µl of lysis buffer, vortexed to disperse, and allowed to stand for 15 min. Then, it was centrifuged at 13000 rpm to obtain the supernatant. Subsequently, following the instructions of the automated DNA extractor, the supernatant, MagExtract Suspension, washing solution, 70% ethanol, and dissolving solution were placed in the corresponding chambers of the device for automated DNA extraction. The extracted DNA was quality checked by nanodrop and then stored at 4°C or used directly.

[0150] Example 4: Detection of amplification efficiency using species-specific primers

[0151] Three samples, L02, L03, and L05, were randomly selected to test the amplification efficiency of the designed species-specific primers. The initial genomic concentration obtained from the samples was diluted to a final concentration of 100 ng / µl, and then further diluted in 1 / 10 gradients to a final concentration of 100 ng / µl. -3 Six dilution gradients were performed using ng / ul. Detection was conducted on a Bio-rad CFX quantitative PCR instrument. A 20 μl PCR reaction mixture consisted of 10 μl iTaq Universal SYBR® Green Supermix, 1 μl 10 μM forward and reverse primers, 6 μl ddH2O, and 2 μl DNA template. The PCR program was: 95°C pre-denaturation for 5 min, followed by 42 cycles of 95°C denaturation for 10 s and 60°C extension for 30 s. Fluorescence signals were read after each reaction, and melting curves were recorded after the entire reaction. Each reaction was performed in triplicate.

[0152] After the PCR reaction, a standard curve was plotted with the logarithm of the template concentration series on the X-axis and the corresponding Ct value on the Y-axis. The standard curve needs to be evaluated after plotting. Two evaluation metrics are used: correlation coefficient R. 2 and amplification efficiency (E). Correlation coefficient R 2 It not only reflects the linear relationship of the data, but is also mainly used to evaluate the reproducibility of repeated samples and whether different concentrations of initial template have the same amplification efficiency. R 2The value should be greater than 0.98; the closer the value is to 1, the stronger the linear relationship and the higher the accuracy of the data. The formula for calculating amplification efficiency (E) is as follows: E = (10^(-1 / slope)) - 1. It is generally believed that amplification efficiency (E) should be between 90% and 100%, corresponding to a slope between -3.58 and -3.1.

[0153] Agarose gel electrophoresis results showed that all four primer groups (S0039F / R, S6980F / R, N1316F / R, and N5440F / R) produced clear amplification bands. Quantitative PCR analysis of the candidate primers' melting curves and amplification efficiency revealed that S0039F / R and S6980F / R had amplification efficiencies of 92.03% and 97.17%, respectively, with sharp single peaks in their melting curves. N1316F / R and N5440F / R had amplification efficiencies of 98.72% and 99.40%, respectively, with sharp single peaks in their melting curves, indicating their effectiveness. Figure 2 ).

[0154] Example 5: Detection of spatial location of fruiting bodies and agarwood using species-specific primers.

[0155] Four primer pairs (S0039F / R, S6980F / R, N1316F / R, and N5440F / R) were selected and used to perform RT-PCR to detect the content of two genotypes in nine spatial locations of the fruiting body and matrix of *Auricularia auricula-judae* to determine the gene content of *Auricularia auricula-judae* and *Gynostemma pentaphyllum* in different spatial locations. Each sample was subjected to three biological replicates. The PCR reaction system and amplification conditions were as described in Example 4. The difference in relative gene content between *Auricularia auricula-judae* and *Gynostemma pentaphyllum* was calculated as follows: in the same sample tissue, the Ct value (threshold cycle number) of *Gynostemma pentaphyllum* species-specific gene amplification was subtracted from the Ct value of *Auricularia auricula-judae* species-specific gene amplification to obtain ΔCt. Then, the relative ratio of gene content between the two species was obtained by exponential calculation 2^(-ΔCt).

[0156] The amplification results showed that the two primers for *Trichoderma harzianum* could amplify effective results at 9 spatial locations, with amplification Ct values ​​ranging from 18.94 to 25.79. There was no significant difference in amplification between the two primers at the 9 spatial locations (p=0.0001), indicating the stability of their amplification.

[0157] Two *Auricularia auricula-judae*-specific primers were effectively amplified at nine spatial locations between L01 and L07, with amplification Ct values ​​ranging from 21.91 to 35.21. There was no significant difference in amplification between the two primers across seven samples (p = 1.12e-05). In fact, a Ct value greater than 35 indicates extremely low gene content, consistent with the fact that *Auricularia auricula-judae*-specific genes were undetectable at locations L08 and L09.

[0158] Gene content of the two species at nine spatial locations was calculated by using the average difference in Ct values ​​of two specific primers for each species, *Trichoderma repens* and *Auricularia auricula-judae*. The results showed that the gene content ratio of the two species gradually increased from the top of the fruiting body down to the bottom of the matrix. At the top, the ratio was closest, with a difference of 1.51-fold. This difference increased to 6.52-fold at the base of the fruiting body, and reached a high of 520.95-fold at the center of the matrix. Further downwards, no *Auricularia auricula-judae*-specific genes were detected. The differences in gene content indicate the heterogeneity of the fruiting bodies and that *Trichoderma repens* is the dominant nutrient metabolite in the matrix (Table 3).

[0159] Table 3. Differences in gene content between *Trichoderma harzianum* and *Auricularia auricula-judae* in fruiting bodies and cultivation substrates.

[0160]

[0161] Experiment Example 6: Detection of Genotype Content of Two Fungi in Commercial Strains

[0162] Three valid samples (capable of normal fruiting) and three invalid samples (unable to fruit) from the market were collected for genotyping. Specific steps included: centrifuging the obtained liquid inoculum at 12000 rpm to obtain mycelial precipitate; extracting genomic DNA according to the DNA extraction method described above, and after quality control using nanodrop, diluting to a final concentration of 25 ng / µL, storing at 4℃ or using directly. The genotypes of the two fungi were quantitatively detected and analyzed using the above amplification conditions, with each sample subjected to three biological replicates.

[0163] The results are shown in Table 4. Both *Trichoderma repens* and *Auricularia auricula-judae* were detected in all three valid samples (Sample 01-Sample 03). The average Ct value for *Trichoderma repens* ranged from 19.23 to 20.74, while the average Ct value for *Auricularia auricula-judae* ranged from 23.36 to 25.22, indicating that the genotype content of *Trichoderma repens* was significantly higher than that of *Auricularia auricula-judae*. Relative content calculations showed a significant difference in relative content among the three valid samples, ranging from a minimum of 6.63 times (Sample 01) to a maximum of 37.05 times (Sample 02).

[0164] Three samples that failed to produce fruiting (Sample04-Sample06) were tested, and all successfully amplified the specific gene of *Trichoderma viride*, but the specific amplification of *Auricularia auricula-judae* was negative. Further RT-PCR quantitative analysis showed that the Ct values ​​of *Trichoderma viride* ranged from 18.04 to 18.98, with an average amplification value between 18.46 ± 0.48 (primer set S0039R / F) and 18.50 ± 0.31 (primer set S6980R / F); however, no *Auricularia auricula-judae* gene was amplified (Table 4). These data indicate that the non-fruiting strains contained only *Trichoderma viride*, lacking *Auricularia auricula-judae*, which may be the root cause of the failure to produce fruiting.

[0165] Table 4. Genotypic content analysis of two fungi in commercial liquid cultures.

[0166]

[0167] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer set for identifying *Auricularia auricula-judae*, characterized in that, The primer set is a primer set for amplifying the specific genes of Auricularia auricula-judae and Chrysophagus truncatula. Primers for amplifying the golden ear-specific gene include N1316F / R or N5440F / R; The primer set for amplifying the specific gene of *Trichoderma harzianum* includes primers S0039F / R or S6980F / R. N1316F / R is used to amplify the Gene001316 gene. The nucleotide sequence of the forward primer N1316F is shown in SEQ ID No. 12, and the nucleotide sequence of the reverse primer N1316R is shown in SEQ ID No.

13. N5440F / R is used to amplify the Gene005440 gene. The nucleotide sequence of the forward primer N5440F is shown in SEQ ID No.16, and the nucleotide sequence of the reverse primer N5440R is shown in SEQ ID No.

17. S0039F / R is used to amplify the Gene000039 gene. The nucleotide sequence of the forward primer S0039F is shown in SEQ ID No. 18, and the nucleotide sequence of the reverse primer S0039R is shown in SEQ ID No.

19. S6980F / R is used to amplify the Gene006980 gene. The nucleotide sequence of the forward primer S6980F is shown in SEQ ID No. 24, and the nucleotide sequence of the reverse primer S6980R is shown in SEQ ID No.

25. The nucleotide sequence of Gene001315 is shown in SEQ ID No. 1; The nucleotide sequence of Gene001316 is shown in SEQ ID No. 2; The nucleotide sequence of Gene005441 is shown in SEQ ID No. 3; The nucleotide sequence of Gene005440 is shown in SEQ ID No. 4; The nucleotide sequence of Gene000039 is shown in SEQ ID No. 5; The nucleotide sequence of Gene002713 is shown in SEQ ID No. 6; The nucleotide sequence of Gene005147 is shown in SEQ ID No. 7; The nucleotide sequence of Gene006980 is shown in SEQ ID No. 8; The nucleotide sequence of Gene007705 is shown in SEQ ID No.

9.

2. The application of the primer set described in claim 1 in the identification of golden ear fungus products.

3. A kit for quantitative and qualitative identification of *Auricularia auricula-judae* and *Trichoderma harzianum*, characterized in that, The kit includes the primer set as described in claim 1.

4. A method for quantitative and qualitative identification of *Auricularia auricula-judae* and *Trichoderma harzianum*, characterized in that, Includes the following steps: (1) Extract DNA from the sample to be tested; (2) Use primer sets to perform PCR or RT-PCR amplification on the DNA of the sample to be tested to obtain amplification products; (3) Determine whether the sample to be tested is Auricularia auricula-judae based on the PCR amplification product. If the PCR amplification product contains both Auricularia auricula-judae-specific gene and Auricularia buergeriana-specific gene, then the sample to be tested is Auricularia auricula-judae. If the PCR amplification product contains only Auricularia auricula-judae-specific gene or Auricularia buergeriana-specific gene, then the sample to be tested contains only the single species corresponding to the Auricularia auricula-judae-specific gene or the Auricularia buergeriana-specific gene. (4) Determine the relative contents of Auricularia auricula-judae and Leptomeria trifasciata in the sample based on the Ct value of RT-PCR amplification; The primer set is the primer set for amplifying the specific genes of Auricularia auricula-judae and Chrysophagus truncatula as described in claim 1; The samples to be tested include fruiting bodies of Auricularia auricula-judae or strains of Auricularia auricula-judae.

5. The method according to claim 4, characterized in that, The PCR amplification reaction system in step (2) consists of 8-12 µl of PCR mixture, 0.5-2 µl of forward primer, 0.5-2 µl of reverse primer, 4-8 µl of ddH2O, and 1-3 µl of sample DNA. The initial concentration of the forward primer is 8-12 µM; The initial concentration of the reverse primer is 8-12 µM; The initial concentration of the sample DNA was 10-50 ng / uL.

6. The method according to claim 5, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s and 57~63℃ extension for 30 s, for a total of 42 cycles.

Images