Toxoplasma gondii antibody and detection kit thereof

By developing monoclonal antibodies XJ16 and XJ23 that specifically recognize the membrane surface antigen SAG1 protein of Toxoplasma recombinant antigen protein, a high-sensitivity dual-anti-sandwich ELISA kit was established, which solved the accuracy and simplicity of Toxoplasma detection in the prior art, laying the foundation for Toxoplasma research.

CN120441696AActive Publication Date: 2025-08-08INST OF ANIMAL SCI & VETERINARY TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510683178.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2025-08-08
Estimated Expiration
2045-05-26

AI Technical Summary

Technical Problem

The existing Toxoplasma antibody detection methods are not accurate, there are false positives or false negatives, and the operation is cumbersome, and there is a lack of effective latent infection detection methods, which affects eugenics and eugenics and disease prevention and control.

Method used

Two monoclonal antibodies XJ16 and XJ23 were developed to specifically recognize the membrane surface antigen SAG1 protein of Toxoplasma recombinant antigen protein, and used to prepare a dual-anti-sandwich ELISA kit. By optimizing parameters such as capture antibodies, detecting antibody concentration and blocking solution, a high-sensitivity detection method was established.

Benefits of technology

It realizes high sensitivity and wide range detection for Toxoplasma gondii, improves the accuracy and simplicity of detection, and provides new ways of exploration of prevention and treatment strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120441696A_ABST
    Figure CN120441696A_ABST
Patent Text Reader

Abstract

The invention provides two monoclonal antibodies XJ16 and XJ23 aiming at toxoplasma gondii recombinant antigen protein membrane surface antigen SAG1 protein, the antibodies can specifically recognize toxoplasma gondii in various stages, have the characteristics of high sensitivity and wide recognition range, can specifically detect toxoplasma gondii infection in various stages, and can be used for detecting toxoplasma gondii infection in various stages. The method can be used for detecting the existence and content of the toxoplasma gondii in a sample, lays a foundation for researching the toxoplasma gondii, and provides a new exploration idea for researching the transformation mechanism of the toxoplasma gondii rapid and slow colonies and further developing a new prevention and treatment strategy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and in particular relates to a Toxoplasma gondii antibody and a detection kit thereof. Background Art

[0002] Toxoplasma gondii is an obligate intracellular parasite that can infect the nucleated cells of almost all types of warm-blooded vertebrates and humans, causing a zoonotic disease called toxoplasmosis. The disease is widely distributed throughout the world. According to statistics, about one-third of the world's population is infected with toxoplasmosis. People with normal immunity are usually infected with Toxoplasma, which usually manifests as latent infection. However, some individuals with weakened immune systems (such as AIDS, organ transplant or cancer patients) may develop diseases such as toxoplasmosis encephalopathy and retinochoroiditis, which can even be life-threatening in severe cases. The first infection in pregnant women can cause congenital damage to the embryo, such as malformations, stillbirths, and miscarriages. Cats are the only definitive hosts for the transmission of toxoplasmosis, and human infection is mainly through eating food contaminated with oocysts excreted by infected cats and tissue cysts of other intermediate hosts.

[0003] At present, there is no effective treatment for latent Toxoplasma infection, and the measures to prevent vertical transmission are also imperfect, which seriously affects eugenics and good parenting. Moreover, with the increasing number of pet families, the detection of Toxoplasma has become the first and most important link in building a line of defense. Toxoplasma gene recombinant antigens mainly include membrane surface antigen (SAG), rod protein (ROP), dense granule protein (GRA), microneme protein (MIC), matrix antigen (MAG1), bradyzoite antigen (BAG), etc. Existing Toxoplasma antibody detection methods include ELISA, Western-blot, etc., which have high specificity. Although there are many antibodies against Toxoplasma in the existing technology, the accuracy is often not high, and the operation is cumbersome, and there are false positive or false negative results. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art.

[0005] First, the present invention provides two monoclonal antibodies XJ16 and XJ23 against the membrane surface antigen SAG1 protein of the recombinant antigen protein of Toxoplasma gondii. The above two monoclonal antibodies are secreted by hybridoma cell lines XJ16 and XJ23, respectively. The antibodies can specifically recognize Toxoplasma gondii at all stages and have the characteristics of high sensitivity and wide recognition range.

[0006] The monoclonal antibody comprises a heavy chain variable region and a light chain variable region; wherein the amino acid sequence of the heavy chain variable region of the monoclonal antibody XJ16 is shown in SEQ ID NO.3, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.4, wherein

[0007] The heavy chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 5-7 respectively;

[0008] The light chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 8-10 respectively;

[0009] The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ23 is shown in SEQ ID NO.11, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.12, wherein

[0010] The heavy chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 13-15, respectively;

[0011] The light chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 16-18, respectively;

[0012] Furthermore, the present invention provides a nucleotide sequence encoding the above-mentioned monoclonal antibody, and a vector, cell, composition, and conjugate containing the above-mentioned sequence.

[0013] Furthermore, the present invention provides any application of the above-mentioned monoclonal antibodies, nucleotide sequences, vectors, cells, compositions, and conjugates, wherein the application is: application in the preparation of products for treating or detecting Toxoplasma gondii; detection of Toxoplasma gondii for non-disease diagnosis and treatment, where the samples include, but are not limited to, pet excrement, water samples, environmental samples, etc.;

[0014] Furthermore, the present invention provides a double-antibody sandwich ELISA kit for detecting Toxoplasma gondii, characterized in that the kit comprises the following components:

[0015] Capture antibody, HRP-labeled detection antibody, coating solution, sample diluent and washing solution, blocking solution, substrate solution, stop solution, standard positive serum (positive control), standard negative serum (negative control);

[0016] The capture antibody is monoclonal antibody XJ16;

[0017] The detection antibody was HRP-labeled monoclonal antibody XJ23;

[0018] The coating solution was 0.05 M carbonate buffer with a pH of 9.6;

[0019] The sample diluent (PBS) and washing solution (PBST) were phosphate-buffered saline containing 0.5% Tween-20;

[0020] The blocking solution was 1% BSA;

[0021] The substrate color development solution is TMB substrate solution;

[0022] The stop solution is 2 mol / L H2SO4 solution.

[0023] Furthermore, the present application provides a method for detecting Toxoplasma gondii infection in a sample using the above-mentioned double-antibody sandwich ELISA detection kit, comprising the following steps:

[0024] (1) Dilute the purified capture antibody XJ16 and coat the plate at a concentration of 250 ng / well. Incubate at 37°C for 2 h.

[0025] (2) Dry the liquid in the plate, wash with washing solution three times, 3 min each time, add blocking solution, block the ELISA plate, the blocking solution is 5% skim milk powder, and incubate at 37°C for 2 h;

[0026] (3) Dry the liquid in the plate, wash with washing solution three times, 3 min each time, add the sample to be tested diluted 1:80 with PBS, 100 uL / well, repeat three times for each sample, and incubate at 37°C for 2 h;

[0027] (4) drying the liquid in the plate, washing with washing solution 3 times, 3 min / time; diluting the detection antibody XJ23 labeled with horseradish peroxidase and adding it to the ELISA plate, incubating at 37°C for 1 hour; the dilution ratio is 1:400 by volume;

[0028] (5) Dry the plate and wash with washing solution 4-5 times, 3 min / time; add TMB substrate, 100 μL / well, and develop at room temperature in the dark for 10 min;

[0029] (6) Add 100 μL / well of stop solution, mix well, and measure the OD450nm value using a microplate reader.

[0030] (7) Result determination: The ratio of the measured well to the negative well is ≥2.1, which is considered positive; the remaining wells are considered negative.

[0031] Thirty Toxoplasma gondii-negative sera were selected and their values at OD450nm were read using the detection method established in this study. The average value (X) of these 30 sera was calculated to be 0.214, and the standard deviation (SD) was 0.039. Therefore, the critical value of the above indirect ELISA method was X + 3SD = 0.214 + 3 × 0.039 = 0.331.

[0032] Beneficial effects

[0033] The present invention provides two monoclonal antibodies XJ16 and XJ23 targeting the membrane surface antigen SAG1 protein of the recombinant antigen protein of Toxoplasma gondii. The antibodies can specifically recognize Toxoplasma gondii at all stages, have the characteristics of high sensitivity and wide recognition range, can be used for targeted detection of Toxoplasma infection at various stages, and can be used to detect the presence and content of Toxoplasma gondii in samples, laying a foundation for the study of Toxoplasma gondii, and providing new exploration ideas for exploring the mechanism of Toxoplasma bradyzoite transformation and further developing new prevention and treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of double enzyme digestion of PCR fragment inserted into pET-30a(+) plasmid, where M is Marker, 1 is PCR fragment (573 bp), and 2 is vector fragment (~5200 bp);

[0035] Figure 2 Schematic diagram of protein expression induced by IPTG in pET-30a(+)-GRA1, where M is a marker, 1 is the protein expression profile before purification, and 2 is the purified rGRA1 protein;

[0036] Figure 3 The purified protein was identified by Western blot, and a specific band was found at 27 kDa. DETAILED DESCRIPTION

[0037] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Example 1 Screening and identification of monoclonal antibodies against SAG1 protein

[0039] Primers were designed based on the GRA1 gene sequence in GenBank (accession number: XM_002365660.2). The expected amplified fragment length was 573 bp. Restriction sites were introduced at the front end of the upstream and downstream primers. The primers are shown in Table 1. The PCR fragment was inserted into the pET-30a(+) plasmid. After double enzyme digestion, two bands were observed, with the correct size ( Figure 1 ), the correctly connected plasmid was sequenced and named pET-30a(+)-GRA1 after sequencing. BL21 was used for expansion culture, and protein expression was induced by IPTG and then purified ( Figure 2 ),

[0040] GRA1-F CTATCTGATGATGCGTGTGACC(SEQ ID NO.1) GRA1-R CTCAAGATTTACTAATCCTCTCCGG(SEQ ID NO.2)

[0041] The purified protein was identified by Western blot. It was confirmed that the protein could be recognized by the positive serum of dogs infected with Toxoplasma gondii, with a specific band at 27kDa ( Figure 3 ), indicating that the recombinant protein GRA1 has good reactogenicity.

[0042] Monoclonal antibodies were prepared and screened using conventional methods. The steps were briefly summarized as follows: Purified recombinant GRA1 protein was used as an immunogen to immunize mice. Antibody titers were determined by orbital blood sampling. Booster immunizations were performed when titers exceeded 1:10,000. Three days later, splenocytes were harvested and fused with SP / 20 cells. Positive clones were screened by indirect ELISA and subcloned. Positive clones were expanded and injected intraperitoneally into BALB / c female mice to produce ascites. The titers of the ascites were assessed by indirect ELISA and purified. High-titer monoclonal cell lines were selected for expansion and culture. Western blot analysis was performed using culture fluids of these clones as primary antibodies and HRP-conjugated goat anti-mouse IgG as secondary antibodies. Two monoclonal cell lines, designated XJ16 and XJ23, were identified and expanded and cryopreserved. Ascites titers of both monoclonal cell lines were determined by indirect ELISA. The titers of the ascites titers of both monoclonal cell lines exceeded 1:256,000 and were stored at -80°C until further use.

[0043] The ascites of XJ16 and XJ23 were centrifuged to remove the precipitate and clots. The samples were purified by Protein G immunoaffinity chromatography and sent to a gene company for sequencing.

[0044] The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ16 is shown in SEQ ID NO.3, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.4, wherein

[0045] The heavy chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 5-7 respectively;

[0046] The light chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 8-10 respectively;

[0047] The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ23 is shown in SEQ ID NO.11, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.12, wherein

[0048] The heavy chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 13-15, respectively;

[0049] The light chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 16-18, respectively.

[0050]

[0051]

[0052] The test samples were diluted with 0.05M pH 9.6 carbonate buffer. The test samples included positive sera infected with Mycoplasma bovis, Mycoplasma oviparum, Neospora solium, Trichinella spiralis, Sarcocystis gallinarum, Ascaris suum, Dipylidium caninum, or Eimeria tenella. ELISA tests were performed using the above samples as detection antigens. The results showed that the OD values of the above samples were all below 0.1, indicating negative reactions, indicating that the prepared XJ16 and XJ23 monoclonal antibodies have very good specificity.

[0053] Example 2 Construction and optimization of double sandwich kit

[0054] After labeling the antibodies using conventional methods in the art, a detection kit was constructed. A checkerboard matrix method was used to optimize various parameters. Taking the determination of capture and detection antibody concentrations and the optimization of the blocking solution as examples, XJ16 was used as the capture antibody, coating the ELISA plate at concentrations of 2000 ng / well, 1000 ng / well, 500 ng / well, 250 ng / well, and 100 ng / well. XJ23 was used as the detection antibody in a gradient dilution, and a double-antibody sandwich ELISA assay was established according to the aforementioned process. The criterion was to determine the OD450nm value, with a ratio of measured wells to negative wells ≥ 2.1 being considered positive, and the remaining wells being negative. The results, as shown in Table 1, show that when the capture antibody coating concentration was 250 ng / well and the detection antibody dilution concentration was 1:400, both the P / N value and the P value were maximized.

[0055] Table 1 Determination of capture antibody and detection antibody concentrations

[0056]

[0057]

[0058] Four blocking solutions, 5% skim milk powder, 5% BSA, 2.5% BSA, and 1.25% BSA, were selected for double antibody sandwich ELISA reaction to determine the optimal blocking solution. 250 μl of blocking solution was added to each enzyme-labeled well and incubated in a 37°C constant temperature box. The experimental results are shown in Table 2 below. Finally, 5% skim milk powder was determined to be the optimal blocking solution, and the optimal blocking time was determined to be 1 hour.

[0059] Table 2 Optimization of blocking solution

[0060] 5% skim milk powder 5% BSA 2.5% BSA 1.25% BSA P-value 1.298 1.067 1.037 0.842 N value 0.21 0.26 0.21 0.18 P / N 6.18 4.1 4.93 4.67

[0061] On this basis, the parameters such as antigen reaction time, detection antibody dilution multiple and reaction time, TMB substrate reaction time, critical value, etc. were further determined, and the optimal double antibody sandwich ELISA method was finally determined, which is characterized by comprising the following steps:

[0062] (1) Dilute the purified capture antibody XJ16 and coat the ELISA plate at a coating concentration of 250 ng / well;

[0063] (2) washing the ELISA plate, adding a blocking solution, and blocking the ELISA plate, wherein the blocking solution is 5% skim milk powder;

[0064] (3) Wash the ELISA plate, add the sample to be tested, and react;

[0065] (4) diluting the detection antibody XJ23 labeled with horseradish peroxidase and adding it to the ELISA plate for reaction; the dilution ratio is 1:400 by volume;

[0066] (5) Wash the ELISA plate, add TMB substrate, and develop color at room temperature in the dark for 10 min;

[0067] (6) Add stop solution, mix well and measure OD450nm value with a microplate reader;

[0068] (7) Result determination: The ratio of the measured well to the negative well is ≥2.1, which is considered positive; the remaining wells are considered negative.

[0069] Thirty Toxoplasma gondii-negative sera were selected and their values at OD450nm were read using the detection method established in this study. The average value (X) of these 30 sera was calculated to be 0.214, and the standard deviation (SD) was 0.039. Therefore, the critical value of the above indirect ELISA method was X + 3SD = 0.214 + 3 × 0.039 = 0.331.

[0070] With other conditions unchanged, the established double-antibody sandwich ELISA method was used to serially dilute Toxoplasma-positive serum. The sensitivity of the method was determined to be 1:1280 (see Table 3).

[0071] Table 3 Sensitivity test results

[0072] Dilution multiple 1:40 1:80 1:160 1:320 1:640 1:1280 1:2560 PBS OD450nm 2.84 2.11 1.57 1.06 0.47 0.28 0.13 0.10 P / N 25.8 2.18 1.1 0.9 1 1.1 1 / Yin and Yang (+ / -) + + + + + + - -

[0073] Eleven serum samples were selected and the established double antibody sandwich ELISA method was used for inter-batch and intra-batch repeatability tests. The maximum coefficient of variation of the intra-batch repeatability test was 4.17%, and the maximum coefficient of variation between batches was 7.40%, indicating that the method had good repeatability.

[0074] Example 3 Clinical sample detection

[0075] 135 clinical nasal swab samples were collected from laboratory-stored serum or tissue samples. These samples were thawed or ground and then tested using a double-antibody sandwich ELISA or PCR assay. The PCR assay method and primers were as described in Example 1. The agreement and concordance between the PCR and sandwich ELISA assays were calculated.

[0076] Table 4 Comparison of double antibody sandwich ELISA and PCR detection results

[0077]

[0078] The results showed (Table 4) that the overall concordance rate between sandwich ELISA and PCR results was 96.2% (130 / 135), and the consistency Kappa value was 0.815 (95% CI: 0.669-0.946), indicating that the two methods were highly consistent.

[0079] The above description of the embodiments is intended to facilitate understanding and use of the present invention by those skilled in the art. Those skilled in the art will readily be able to make various modifications to these embodiments and apply the general principles described herein to other embodiments without resorting to creative effort. Therefore, the present invention is not limited to the above-described embodiments. Any improvements or modifications made by those skilled in the art based on the principles of the present invention that do not depart from the scope of the present invention should be considered within the scope of protection of the present invention.

Claims

1. Two monoclonal antibodies XJ16 and XJ23 targeting the membrane surface antigen SAG1 protein of Toxoplasma gondii recombinant antigen protein, characterized in that: The above two monoclonal antibodies are secreted by hybridoma cell lines XJ16 and XJ23 respectively. The antibodies can specifically recognize Toxoplasma gondii at all stages and have the characteristics of high sensitivity and wide recognition range.

2. The monoclonal antibody according to claim 1, wherein Monoclonal antibody XJ16 The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ16 is shown in SEQ ID NO.3, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.4, wherein The heavy chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 5-7 respectively; The light chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 8-10 respectively; The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ23 is shown in SEQ ID NO.11, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.12, wherein The heavy chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 13-15, respectively; The light chain variable region comprises CDR1, CDR2 and CDR3, and the amino acid sequences thereof are shown in SEQ ID NOs. 16-18, respectively.

3. A nucleotide sequence encoding the monoclonal antibody according to claim 1 or 2, a vector, a cell, a composition, or a conjugate containing the sequence.

4. Any use of the monoclonal antibody according to claim 1 or 2, or the nucleotide sequence, vector, cell, composition, or conjugate according to claim 3, wherein the use is: use in the preparation of a product for treating or detecting Toxoplasma gondii; or detection of Toxoplasma gondii for non-disease diagnosis and treatment, wherein the samples include, but are not limited to, pet excrement, water samples, and environmental samples.

5. A double-antibody sandwich ELISA kit for detecting Toxoplasma gondii, characterized in that The kit comprises the following components: Capture antibody, HRP-labeled detection antibody, coating solution, sample diluent and washing solution, blocking solution, substrate solution, stop solution, standard positive serum (positive control), standard negative serum (negative control); The capture antibody is monoclonal antibody XJ16; The detection antibody was HRP-labeled monoclonal antibody XJ23; The coating solution was 0.05 M carbonate buffer with a pH of 9.6; The sample diluent (PBS) and washing solution (PBST) were phosphate-buffered saline containing 0.5% Tween-20; The blocking solution was 1% BSA; The substrate color development solution is TMB substrate solution; The stop solution is 2 mol / L H2SO4 solution.

6. A method for detecting Toxoplasma gondii infection in a sample using the double-antibody sandwich ELISA detection kit according to claim 5, comprising the following steps: (1) Dilute the purified capture antibody XJ16 and coat the plate at a concentration of 250 ng / well. Incubate at 37°C for 2 h. (2) Dry the liquid in the plate, wash with washing solution three times, 3 min each time, add blocking solution, block the ELISA plate, the blocking solution is 5% skim milk powder, and incubate at 37°C for 2 h; (3) Dry the liquid in the plate, wash with washing solution three times, 3 min each time, add the sample to be tested diluted 1:80 with PBS, 100 uL / well, repeat three times for each sample, and incubate at 37°C for 2 h; (4) drying the liquid in the plate, washing with washing solution 3 times, 3 min / time; diluting the detection antibody XJ23 labeled with horseradish peroxidase and adding it to the ELISA plate, incubating at 37°C for 1 hour; the dilution ratio is 1:400 by volume; (5) Dry the plate and wash with washing solution 4-5 times, 3 min / time; add TMB substrate, 100 μL / well, and develop at room temperature in the dark for 10 min; (6) Add 100 μL / well of stop solution, mix well, and measure the OD450nm value using a microplate reader. (7) Result determination: The ratio of the measured well to the negative well is ≥2.1, which is considered positive; the remaining wells are considered negative. Thirty Toxoplasma gondii-negative sera were selected and their values at OD450nm were read using the detection method established in this study. The average value (X) of these 30 sera was calculated to be 0.214, and the standard deviation (SD) was 0.

039. Therefore, the critical value of the above indirect ELISA method was X + 3SD = 0.214 + 3 × 0.039 = 0.331.

Citation Information

Patent Citations

  • Dog toxoplasma gondii antibody indirect ELISA detection kit

    CN104965086A

  • Monoclonal antibody for resisting toxoplasma gondii as well as preparation method and application thereof

    CN117720655A

  • Method of using P35 antigen of toxoplasma gondii in distinguishing acute from chronic toxoplasmosis

    US6221619B1