Novel coriaria nepalensis lentinula edodes strain derived from coriaria nepalensis deadwood and cultivation method thereof
Through the collection and molecular identification of the new strain Le.Msy-01 in Massia mushroom, the cultivation method was optimized, and the problem of regional heterogeneity in Massia mushroom was solved, efficient growth and high output of the wide-temperature strain were achieved, and market competitiveness and diversified supply of the edible fungi industry were enhanced.
Patent Information
- Application Number
- CN202510598683.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-08
AI Technical Summary
In the prior art, the regional heterogeneity of shiitake mushrooms leads to limitations in the cultivation of authentic shiitake mushroom species, insufficient market competitiveness, and lack of excellent strains with wide applicability and easy to cultivate artificially.
A new strain of Le.Msy-01 in Massia mushroom is provided. Through collection, purification and molecular identification, it is determined to be a wide-temperature white rot bacteria. The cultivation method is optimized, including the expansion and promotion of the parent species and the preparation of bacterial rods. It adopts specific culture matrix and environmental management to achieve rapid growth and high output.
The new strain of Masang shiitake mushrooms has been achieved in the range of 4-35℃, with a bioconversion rate of no less than 120%, with excellent quality of mushroom production, tender and sweet taste, broad market prospects, and enhanced the competitiveness of the edible fungi industry.
Smart Images
Figure CN120442415A_ABST
Abstract
Description
Technical Field
[0001] The present application belongs to the field of microorganisms and relates to a new strain of shiitake mushroom derived from dead branches of mulberry trees and a cultivation method thereof. Background Art
[0002] Lentinula edodes (Berk.) Pegler is a typical edible mushroom of the order Agaricales, class Agaricomycetes, phylum Basidiomycota. It is named as Lentinula edodes (Berk.) Pegler because it can grow on the dead branches of the poisonous mulberry tree in the wild. However, its fruiting body is non-toxic, edible and has a faint fragrance, so it is also known as the "Five-mile Fragrant".
[0003] Currently, global shiitake mushroom germplasm resources show significant regional heterogeneity.
[0004] Therefore, it is an inevitable trend to cultivate and domesticate authentic shiitake mushroom strains, optimize the strain structure, enrich the strain categories, and improve market competitiveness. Summary of the Invention
[0005] In view of the shortcomings of the existing technology, the present application provides a new strain of Lentinula edodes (Le.Msy-01), which is as follows:
[0006] A new strain of Lentinula edodes (Le.Msy-01) was deposited with the China Center for Type Culture Collection (Wuhan University) on October 14, 2024, with the accession number CCTCC NO: M20242211. Wild fruiting bodies of this strain (Le.Msy-01) were collected around the vernal equinox from dead branches of a mulberry shrub forest at an altitude of 900-1200 meters in Mazong Miao Township, Zunyi City, Guizhou Province.
[0007] Furthermore, the new strain of Lentinus edodes is a wood-rotting white-rot fungus with an umbrella-shaped phenotype, a fleshy cap and gills, a fibrous stipe, a thin cap, and a fine stipe.
[0008] Furthermore, the new strain of Lentinus edodes is a wide-temperature type, and the mycelium can grow at 4-35°C, and can grow and reproduce relatively quickly at 21-28°C.
[0009] The application of the new strain of Coriaria officinalis in food production.
[0010] The cultivation method of the new strain of Le.Msy-01 shiitake mushroom comprises the following steps: inoculating purified Le.Msy-01 mother strain mycelium into a mother strain culture medium for propagation and culture, or transferring the mycelium into a liquid culture medium for propagation and fermentation to produce mother strains and cultivars, and finally inoculating the mycelium into mushroom sticks for production and cultivation, and harvesting the fruiting bodies after the mushrooms have grown.
[0011] Furthermore, the mother culture medium is: 6g potato extract powder, 10g glucose, 10g sucrose, 5g brown sugar, 3g peptone, 18g agar, 3g magnesium sulfate, 1g potassium dihydrogen phosphate, 150mg VB, 1L distilled water, and the pH is adjusted to 5.5.
[0012] Furthermore, the liquid culture medium is the mother culture medium except for the agar.
[0013] Furthermore, the propagation and fermentation conditions include: liquid fermentation temperature of 26.5° C., fermentation speed of 130 rpm / min, fermentation time of 10 d, and inoculation amount of 100 bacterial blocks with a diameter of φ4 mm / L.
[0014] Furthermore, the matrix of the mushroom stick is: 75% miscellaneous sawdust, 20% bran, 3% corn cobs, 1% glucose, 1% gypsum, and 60-65% water content. The mixture is fully mixed and bagged, and sterilized with high pressure wet heat for 2 hours.
[0015] Furthermore, the production cultivation includes: inoculating the mushroom spawn into the mushroom sticks, culturing them in an environment at 22°C for 20-40 days until the mushrooms have finished feeding, perforating the holes for ventilation, transferring them to an environment with diffuse light and room temperature for 40-60 days to change color. After the change color is complete, the mushrooms are removed from the bags, rehydrated, and placed in an environment with a relative humidity of 80-95% and a temperature of 18-27°C for fruiting, with ventilation maintained 2-5 times a day.
[0016] Furthermore, the mushrooms are harvested after the mushrooms have grown. The mushrooms are picked by pinching the base of the stem of the shiitake mushroom and rotating it to avoid damaging the mushroom film. The harvested fruiting bodies can be eaten fresh or stored in a dry place at 35-80°C.
[0017] Beneficial effects of this application:
[0018] (1) The present invention is based on the collection and purification of the wild Le.Msy-01 strain, and its phenotypic and ITS molecular identification. Through artificial discovery, a strain of Le.Msy-01 with wide applicability, easy artificial cultivation, and both medicinal and edible properties is provided.
[0019] (2) The new strain of Lentinus edodes given in this application, namely, Le.Msy-01, has a bioconversion rate (first two crops) of not less than 120% after cultivation. It has a huge difference in appearance from commercially available Lentinus edodes with the same appearance and excellent flavor. It is an excellent strain with promotional and application value.
[0020] (3) The strain of Lentinus edodes given in this application is a typical wood-rotting white-rot fungus, with an umbrella-shaped phenotype, a fleshy cap and gills, a fibrous stipe, a thin cap, and a fine stipe. The main edible part (i.e., the cap) accounts for a high proportion, with a cap diameter / stipe diameter of up to 1.13 and a cap diameter / stipe diameter of 7.06. It has a tender and smooth taste and a sweet flavor, and has excellent market prospects.
[0021] (4) The shiitake mushroom of the present application is a wide temperature type. The mycelium can grow at 4-35°C and can grow and reproduce relatively quickly at 21-28°C. The growth rate is best at 24°C, reaching (8.03±0.15) mm / d.
[0022] (5) The present invention provides a new strain of shiitake mushroom with strong adaptability and high yield and its cultivation method, which can enhance the core competitiveness of the edible fungus industry, optimize the macro-food concept and build a diversified food supply system. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 It is the habitat and phenotype of wild Shiitake mushroom (Le.Msy-01).
[0024] Figure 2 The purified mycelium (A) and the characteristic lock-like joint structure (B) of Le.Msy-01.
[0025] Figure 3 These are the spores of Le.Msy-01, a species of mushroom.
[0026] Figure 4 This is the electrophoresis result of the strain ITS amplified fragment.
[0027] Figure 5 This is a phylogenetic tree constructed based on the NJ method and the maximum composite likelihood method (all images are cited from the Global Biodiversity Information Facility).
[0028] Figure 6 This is a photo of the original species (secondary species).
[0029] Figure 7 It is the fruiting situation of domesticated cultivation.
[0030] Figure 8 It is the fruiting body phenotype (fresh mushroom) of Shiitake mushroom obtained through domestication and cultivation. DETAILED DESCRIPTION
[0031] The present application will be further described in detail below with reference to specific embodiments, which are intended to explain rather than limit the present application.
[0032] Example:
[0033] 1. The methods for obtaining the Coriolus moringa described in this application are as follows:
[0034] (1) Collection and habitat:
[0035] The strain of the present application was collected on March 21, 2024 in Mazong Miao Township, Zunyi City, Guizhou Province. It grows in a shrub forest at an altitude of about 1000m in the mountains. Its fruiting bodies are scattered on the dead branches of the mulberry tree ( Figure 1 ).
[0036] (2) Separation and purification:
[0037] The collected wild fruiting bodies were cleaned with cotton wool dipped in clean water, then wiped with 75% alcohol and placed in a clean bench under ultraviolet irradiation for 30 minutes. The stems were removed under sterile conditions, and a small piece of the cap about 4 mm in size was cut and inoculated into a PDA plate. The tissue separation method was used to culture at 20°C without light to induce the production of hyphae. The agar block containing the hyphae was then cut and transferred to a new PDA medium for purification three times ( Figure 2 ).
[0038] 2. Strain information
[0039] (1) Morphological characteristics:
[0040] The fruiting body of Le.Msy-01 is composed of a cap, gills, and a stipe. In the wild, the cap is round, fleshy, and thin, with a small amount of scales, with a diameter of (44.03±7.79) mm and a thickness of less than (8.02±1.15) mm. The surface is dark brown or dark brown (different light quality will cause color differences); the stipe is solid, slender, fibrous, and mesogenous or slightly eccentric, with a length of (39.07±6.91) mm and a diameter of (6.24±1.01) mm. A large number of milky white hairs are attached to the surface; the gills are straight and extremely densely arranged from the stipe to the edge of the cap, with white blades or serrated shapes; the spores are oval with bird-beak-like protrusions, and the size is (5-8)×(3-4) μm ( Figure 3 ).
[0041] (2) Molecular identification:
[0042] Fresh purified hyphae grown on the plate were scraped and total DNA was extracted using the Omega Fungal DNA Extraction Kit. The obtained DNA was frozen at -20°C for future use. PCR amplification was performed using the universal fungal ITS primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). PCR reaction system (25 μL): 2×Taq Master Mix 10 μL, DNA 2 μL, 1 μL each of ITS primers, 11 μL of ddH2O. PCR reaction conditions: 95°C pre-denaturation for 4 min; 95°C denaturation for 30 s, 50°C annealing for 30 s, 72°C extension for 1 min, 35 cycles; 72°C post-extension for 7 min. After amplification, 10 μL was taken and spotted into a 1% agarose gel for electrophoresis detection. An ITS fragment slightly smaller than 750 bp was observed ( Figure 4 The remaining PCR amplification solution was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0043] The purified mycelial sequences were as follows:
[0044] ACGGGGCATCCTACCTGATTTGAGGTCAGCAAATAAGTTATATATAG
[0045] TCAATCAAGACAGTTAGAAAGCGGGACTTCCCTTGTGCTCCAATGAATA
[0046] GAACAGATTGAGCAAACTAAATGCAACAACCCAAACCAATAGAGCTTTA
[0047] TTATTGTAAGGTTCCACCAAAATGTAGATAATTATCACACCAAGGTTAGA
[0048] ACTAACAAAACAGGGTTCCCACTAATCAATTTAAGAGGAGCTGACAAAC
[0049] GCCTGCAAGCCTCCAACATCCAAGCTTTGATAAGTAAAAACTTATAAAG
[0050] TTGAGAATTTAATGACACTCAAACAGGCATGCCCTCCGGAATACCAGAG
[0051] GGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTC
[0052] ACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGGAGAGCCAAGA
[0053] GATCCGTTGCTGAAAGTTGTATTAAGTTTAAAGGGTCAATAAAGTCCCAA
[0054] TAACAAGATCATTCTATAACATACTTCAATGGTTTATAAGAACATAGAAGC
[0055] CTTGTCAACTAGTCTTTTCAAGTAACTCATAATGAGCACCCTTCAAAAAC
[0056] CCAATAAAAAACTTCTAACAAAAGGGCAACAGGTGAATGATTAAAATTC
[0057] GAAGGAGAATGTCACCTTACCCAAGGCCAGCCAACAATCAACAACAAA
[0058] AAAATCAATTATTGACCCTCCGCAAGGTTCACTTACGAAACCTGTAGC
[0059] Furthermore, the mycelial sequences were submitted to NCBI for a Blast homology search, and all hits were Lentinula edodes. Based on information from the Chinese Fungal Names database (Fungal Names), sequences from other recognized species of Lentinula (including Lentinula aciculospora, Lentinula boryana, Lentinula novae-zelandiae, Lentinula lateritia, Lentinula raphanica, and Lentinula reticeps) were selected, with Pleurotus pulmonarius, also from the order Agaricales, used as an outgroup. Phylogenetic analysis software MEGA 12 was used. The genetic distance between sequences was taken into account to gradually connect similar taxa. Based on the statistical method Neighbor-joining (NJ), the original data were sampled with replacement by the bootstrap method. The phylogenetic tree was repeatedly constructed to evaluate the branch reliability of the tree. The maximum composite likelihood method was used to integrate the substitution model. The two main types of nucleotide substitutions were fully considered. Transitions + transversions (d: Transitions + Transversions) were included in the substitution type. The phylogenetic test was performed 1000 times to construct the phylogenetic tree ( Figure 5 ).
[0060] Based on the phylogenetic tree, Le.Msy-01 clearly falls within the Lentinula edodes cluster, forming a clade with known L. edodes strains (OP818498.1, MK940847.1, and HQ186261.1), with a high support rate of 92%. This indicates a stable evolutionary relationship and close relationship between the strains. However, it forms a separate clade, suggesting that it may not belong to the canonical L. edodes. Furthermore, its fruiting body phenotype differs significantly from that of traditional Lentinula edodes strains. Combined with the results of blast alignment and phylogenetic tree analysis, it was identified as a new strain or subspecies.
[0061] (3) Biological characteristics:
[0062] Among the main environmental factors, the hyphae of strain Le.Msy-01 can germinate and grow at 4-35℃, belonging to the wide-temperature type, but the growth state is best at 24℃, and the morphology is round; the pH prefers a weakly acidic environment (pH5.0-6.0). The main nutritional factor requirements are reflected in the lack of specific selection for carbon sources. Different carbon source matrices can support normal hyphae growth, and there is no significant difference in colony diameter; ammonium nitrogen is not suitable for hyphae growth; the carbon-nitrogen ratio (C / N) has a weak effect, but the hyphae grow fastest in the range of 20-30:1, and the hyphae are dense and white; among the inorganic salt requirements, there is a high demand for magnesium ions (Mg 2+ Overall, Le.Msy-01 has a wide adaptability to nutritional factors and flexible cultivation substrates, making it an excellent shiitake mushroom strain suitable for low-cost, efficient production and large-scale production.
[0063] Furthermore, the nutritional requirements were clarified and cultivation was carried out. The cultivation steps are as follows:
[0064] (1) Propagation of mother stocks and original stocks
[0065] Propagation of solid and liquid starter cultures: Cut agar blocks of purified mycelium growing on PDA plates and transfer them to a selected mother culture medium. Incubate the solid mother culture at 24°C in the dark for 7-15 days. Incubate the liquid starter culture at 26.5°C at 130 rpm / min for 10-15 days.
[0066] The preferred mother seed culture medium is: 6g potato extract powder, 10g glucose, 10g sucrose, 5g brown sugar, 3g peptone, 18g agar (determine whether to add as needed), 3g magnesium sulfate, 1g potassium dihydrogen phosphate, 150mg VB, 1L distilled water, and the pH is adjusted to 5.5.
[0067] Preparation of stock culture: Thoroughly mix a matrix containing 78% sawdust, 15% bran, 5% corncobs, 1% glucose, and 1% gypsum. Add water to a moisture content of 60-60%, mix well, bag, and sterilize with high-pressure heat for 2 hours. After cooling, inoculate the grown Le.Msy-01 solid mother culture or liquid fermentation culture of Le.Msy-01 mushroom in a sterile environment. Incubate in a constant temperature of 25°C in the dark for 20-30 days until the mycelium fills the bag and becomes dense and white. This is used as the stock culture for future use. Figure 6 ).
[0068] (2) Preparation and inoculation of culture spawn
[0069] The cultivar formula is 75% sawdust, 20% bran, 3% corncobs, 1% glucose, 1% gypsum, and a moisture content of approximately 60-65%. Mix thoroughly, bag, and sterilize under high pressure and moist heat for 2 hours. Cool to room temperature and set aside. In a strictly disinfected and sterilized environment, inoculate the cultured seed blocks into the mushroom sticks, compact, and seal.
[0070] (3) Bacteria culture and management
[0071] Transfer the inoculated mushroom sticks to a dark environment at 22°C for incubation. The mycelial incubation period is approximately 20-40 days. When the mycelium is growing well, perform puncture to increase oxygen and accelerate mycelial growth. Puncture should only be performed when the ambient temperature is kept below 25°C. After nodules form on the surface of the mushroom sticks, puncture should be performed along the outer periphery of the nodules.
[0072] After the mycelium has fully grown into the spawn sticks, the spawn is then incubated under scattered light for 40-60 days to promote color change and biofilm formation. When the spawn stick mass decreases by approximately 10-25% compared to the initial inoculation, and a few buds develop, the outer bags are removed to allow the sticks to change color. At this point, the humidity is maintained at 85%-90%, and ventilation is maintained 3-5 times daily. A brown biofilm will form in approximately 15-20 days.
[0073] (4) Harvesting and management
[0074] After the color change is completed and the mushroom sticks are hydrated, they are placed in an environment with a relative humidity of 80-95% and a temperature of 18-27°C for fruiting and ventilation is maintained 2-5 times a day. The fruiting bodies can be harvested 5-10 days after the primordium differentiation. Figure 7 When harvesting, pinch the base of the stem and gently rotate it to make it fall off to avoid large-scale damage to the fungus film. The harvested fruiting bodies can be eaten fresh or stored in a dry place at 35-80℃. Figure 8 ).
[0075] Finally, it should be noted that the above embodiments are merely representative examples of this application. Obviously, the technical solutions of this application are not limited to the above embodiments and are subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of this application should be considered within the scope of protection of this application.
Claims
1. A new strain of Lentinula edodes, characterized in that: It is deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M20242211.
2. The new strain of Lentinula edodes according to claim 1, characterized in that The new strain of Lentinus edodes is a wood-rotting white-rot fungus with an umbrella-shaped phenotype, a fleshy cap and gills, a fibrous stipe, a thin cap, and a fine stipe.
3. The new strain of Lentinula edodes according to claim 1, characterized in that The new strain of Lentinus edodes is a wide-temperature type, and the mycelium can grow at 4-35°C, and can grow and reproduce relatively quickly at 21-28°C.
4. Use of the new strain of Lentinula edodes according to claim 1 in food production.
5. The cultivation method of the new strain of Lentinula edodes according to claim 1, characterized in that: The purified mycelium of the mother culture of Shiitake mushroom is inoculated into the mother culture medium for propagation culture, or transferred to the liquid culture medium for propagation and fermentation to produce the mother culture and the cultivar, which is finally inoculated into the mushroom sticks for production cultivation, and the fruiting bodies are harvested after the mushrooms are produced.
6. The cultivation method of the new strain of Lentinula edodes according to claim 5, characterized in that: The mother seed culture medium is: 6g potato extract powder, 10g glucose, 10g sucrose, 5g brown sugar, 3g peptone, 18g agar, 3g magnesium sulfate, 1g potassium dihydrogen phosphate, 150mg VB, 1L distilled water, and the pH is adjusted to 5.
5.
7. The cultivation method of the new strain of Lentinula edodes according to claim 5, characterized in that: The liquid culture medium is the mother culture medium minus the agar.
8. The cultivation method of the new strain of Lentinula edodes according to claim 5, characterized in that: The propagation and fermentation conditions include: liquid fermentation temperature of 26.5° C., fermentation speed of 130 rpm / min, fermentation time of 10 days, and inoculation amount of 100 bacterial blocks with a diameter of φ4 mm / L.
9. The cultivation method of the new strain of Lentinula edodes according to claim 5, characterized in that: The matrix of the mushroom stick is: 75% of miscellaneous sawdust, 20% of bran, 3% of corn cobs, 1% of glucose, 1% of gypsum, and 60-65% of water content. The mixture is fully mixed and bagged, and sterilized by high-pressure wet heat for 2 hours.
10. The cultivation method of the new strain of Lentinula edodes according to claim 5, characterized in that: The production cultivation comprises the following steps: inoculating the mushroom spawn into the mushroom sticks, culturing the mushroom sticks in an environment of 22°C for 20-40 days until the mushrooms are fully grown, punching holes for ventilation, transferring the mushrooms to an environment of scattered light and room temperature for color change for 40-60 days; after the color change is completed, removing the mushrooms from the bags, adding water, and placing the mushrooms in an environment of relative humidity of 80-95% and temperature of 18-27°C for fruiting, and maintaining ventilation 2-5 times a day.