Method for increasing yield of alpha-ketoglutaric acid
By heterologously expressing glutamate oxidase and overexpressing related enzyme genes in Yarrowia lipolytica, genetically engineered strains were constructed, and the problem of low production efficiency of α-ketoglutaric acid was solved, and efficient and economical production of α-ketoglutaric acid was achieved.
Patent Information
- Application Number
- CN202510582705.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-08-08
AI Technical Summary
In the prior art, α-ketoglutaric acid has low production efficiency, chemical synthesis pathways have problems with low product selectivity and by-product formation, and the microbial production route has not yet achieved efficient heterologous expression of glutamate oxidase in Yarrow lipolytica.
In Yarrowia lipolytica, six glutamate oxidase genes GLOD, and overexpresses the isocitrate dehydrogenase gene IDP, pyruvate carboxylase gene PYC, and glycerol kinase gene GUT1, to construct genetically engineered strains to produce α-ketoglutaric acid using L-glutamate as a substrate.
The production of α-ketoglutaric acid is significantly improved, production costs are reduced, high value-added chemical biosynthesis is achieved, carbon flux optimization reduces substrate waste, and decomposes hydrogen peroxide, providing a new and efficient production pathway.
Smart Images

Figure CN120442685A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, in particular to a method for increasing the yield of alpha-ketoglutaric acid. Background Art
[0002] α-Ketoglutarate (α-KG) is a weak acid, a short-chain dicarboxylic acid. It is an important intermediate in the tricarboxylic acid cycle in the mitochondrial matrix and an essential metabolite in almost all organisms. It participates in various biological processes, including antioxidant defense, energy production, signal modules and genetic modification. It is widely used in food, medicine, fine chemicals and other fields and is known as the current anti-aging king; L-glutamate oxidase (GLOD) is a flavin enzyme with flavin adenine dinucleotide (FAD) as a coenzyme. L-glutamate oxidase is abundant, mainly derived from Streptomyces sp. microorganisms. It was first isolated from snake venom, mouse kidneys, invertebrates and microorganisms. Due to its high catalytic efficiency and mild reaction conditions, it is widely used in various fields such as food, light industry, chemical industry and medicine.
[0003] Currently, α-ketoglutarate is primarily produced via chemical synthesis routes, starting from succinic acid and diethyl oxalate and involving multiple steps. However, these chemical pathways have many disadvantages, such as low product selectivity, the formation of byproducts, and the use of toxic precursors and catalysts. Therefore, biotechnological routes utilizing microbial production are an ecologically attractive alternative.
[0004] Previous studies have shown that many microorganisms can accumulate α-ketoglutarate using various carbon sources. Among them, Yarrowia lipolytica has been the most intensively studied. Yarrowia lipolytica is an unconventional yeast that requires only a simple culture medium containing inorganic salts and thiamine as a vitamin supplement. It can produce α-KG from renewable resources such as ethanol, rapeseed oil, and raw glycerol. It has been reported that Yarrowia lipolytica N1 can convert ethanol, the sole carbon source, into α-KG, reaching a maximum concentration of 49 g / L. When cultured on medium containing rapeseed oil, Yarrowia lipolytica VKM Y-2412 can accumulate α-KG to 106.5 g / L. Using glycerol as a substrate, the final α-KG concentration in shake flasks was 39.2 g / L, and in a bioreactor (using a multistage feeding strategy), the final α-KG concentration was 66.2 g / L.
[0005] Currently, with the advancement of genetic engineering, the ability to increase α-ketoglutarate production through engineering is limited to approximately 40%. L-glutamate oxidase, which can enzymatically convert L-glutamate to α-ketoglutarate, is highly specific and irreversible, further improving the efficiency of α-ketoglutarate production in engineered strains. However, to date, there have been no reports of heterologous expression of glutamate oxidase in Yarrowia lipolytica.
[0006] The present invention intends to use L-glutamate oxidase to specifically convert L-glutamate into high-value-added α-ketoglutarate, thereby increasing the added value of the product, thereby effectively alleviating the problem of glutamate overcapacity and providing a new idea for the sustainable development of the glutamate industry. Summary of the Invention
[0007] The present invention aims to provide a method for increasing α-ketoglutarate production to address the problems of the prior art. The present invention develops an engineered Yarrowia lipolytica strain capable of producing α-ketoglutarate using L-glutamate as a substrate. This represents the first heterologous expression of glutamate oxidase in Yarrowia lipolytica, providing a new and promising pathway for producing α-ketoglutarate.
[0008] To achieve the above object, the present invention provides the following solutions:
[0009] The present invention provides a method for constructing a genetically engineered bacterium for fermenting and producing α-ketoglutaric acid, comprising the steps of integrating the GLOD gene into the Yarrowia lipolytica genome to construct the genetically engineered bacterium;
[0010] The nucleotide sequence of the GLOD gene is shown in any one of SEQ ID NOs. 5-10.
[0011] Preferably, the nucleotide sequence of the GLOD gene is shown as SEQ ID NO.8.
[0012] Furthermore, the construction method further comprises the step of integrating the PYC gene into the Yarrowia lipolytica genome;
[0013] The accession number of the PYC gene in NCBI is YALI0_C24101g.
[0014] Furthermore, the construction method further comprises the steps described in any one of (1) to (3):
[0015] (1) A step of integrating the IDP gene into the Yarrowia lipolytica genome;
[0016] (2) a step of integrating the CAT gene into the Yarrowia lipolytica genome;
[0017] (3) integrating the IDP gene, CAT gene, and GUT1 gene into the Yarrowia lipolytica genome;
[0018] The accession numbers of the IDP gene, the CAT gene and the GUT1 gene in NCBI are YALI1_F06197g, YALI0F30987p and YALI1_F00654g respectively.
[0019] The present invention also provides a genetically engineered bacterium for producing α-ketoglutaric acid by fermentation, which is constructed according to the above construction method.
[0020] The present invention also provides the use of the above-mentioned genetically engineered bacteria in the fermentation production of α-ketoglutaric acid.
[0021] The present invention also provides a method for increasing the yield of α-ketoglutaric acid, comprising the steps of fermenting and culturing the genetically engineered bacteria using a fermentation medium containing L-glutamic acid to prepare the α-ketoglutaric acid.
[0022] Furthermore, the concentration of L-glutamic acid in the fermentation medium is 40 g / L.
[0023] The present invention discloses the following technical effects:
[0024] (1) The present invention heterologously expresses six glutamate oxidase genes GLOD from different sources in Yarrowia lipolytica for the first time, enabling the engineered strain to utilize glutamate for the biosynthesis of high-value-added chemicals. This process can reduce production costs.
[0025] (2) The present invention further overexpresses the endogenous isocitrate dehydrogenase gene IDP, pyruvate carboxylase gene PYC and glycerol kinase gene GUT1 of Yarrowia lipolytica, so that as much carbon flux as possible flows into the α-ketoglutarate synthesis pathway, reducing the waste of substrates and significantly increasing the yield of α-ketoglutarate.
[0026] (3) The present invention further overexpresses the endogenous catalase gene CAT of Yarrowia lipolytica, which can decompose the hydrogen peroxide produced when the genetically engineered strain of Yarrowia lipolytica utilizes the substrate L-glutamate to produce α-ketoglutarate.
[0027] (4) The engineered Yarrowia lipolytica provided by the present invention is capable of producing α-ketoglutarate using L-glutamate as a substrate. This is the first time that glutamate oxidase has been heterologously expressed in Yarrowia lipolytica, providing a new and promising approach for producing α-ketoglutarate and a good reference for solving the problem of low α-ketoglutarate production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0029] Figure 1 The figure shows the shake flask fermentation results of heterologously expressing six glutamate oxidase genes GLOD from different sources in Yarrowia lipolytica;
[0030] Figure 2 This is a diagram showing the shake flask fermentation results after overexpressing the isocitrate dehydrogenase gene IDP, pyruvate carboxylase gene PYC, glycerol kinase gene GUT1, and catalase gene CAT in the engineered strain S4-1;
[0031] Figure 3 This is a diagram showing the shake flask fermentation results of the genetically engineered Yarrowia lipolytica strain S4-1-6 and the wild Yarrowia lipolytica strain at different L-glutamate concentrations. DETAILED DESCRIPTION
[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0033] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0037] The Yarrowia lipolytica used in the present invention can synthesize α-ketoglutarate by itself and can also convert a small amount of L-glutamate into α-ketoglutarate. It is speculated that the yeast itself contains L-glutamate oxidase. In order to improve its ability to convert L-glutamate into α-ketoglutarate, the present invention screened and transformed six codon-optimized glutamate oxidase genes GLOD from different sources into uracil auxotrophic Yarrowia lipolytica, so that it can produce L-glutamate oxidase and specifically convert L-glutamate into α-ketoglutarate. In addition, the endogenous catalase gene CAT and key genes in the tricarboxylic acid cycle of Yarrowia lipolytica are overexpressed to maximize the carbon flux into the α-ketoglutarate synthesis pathway. Finally, the uracil auxotrophic marker is complemented, and finally, a genetically engineered strain that can convert L-glutamate into α-ketoglutarate during fermentation is successfully obtained.
[0038] The reagents and raw materials used in the present invention are all commercially available.
[0039] The strains and plasmids involved in the present invention are derived from the following:
[0040] The starting strain Yarrowia lipolytica in the examples of the present invention was purchased from the China Industrial Culture Collection Center (CICC) with the strain number CICC 32861.
[0041] Plasmid pINA1312: prepared according to the method described in the literature “Nicaud, JM, Madzak, C., van den Broek, P., Gysler, C., Duboc, P., Niederberger, P., Gaillardin, C. 2002. Protein expression and secretion in the yeast Yarrowia lipolytica. FEMS Yeast Res, 2(3), 371-379”.
[0042] Example 1 Construction of uracil auxotrophic strain S0
[0043] The principle of homologous recombination was used to knock out the nutritional marker uracil in the Yarrowia lipolytica genome, as follows:
[0044] (1) Construction of knockout vector pUC19-rDNA-HisG-HygR
[0045] Based on the DNA of Yarrowia lipolytica uracil Ura on NCBI (GenBank: U40564.1), using it as a template, primer pair 1 and primer pair 2 were used to PCR amplify the upstream fragment Urα-up and the downstream fragment Urα-down, respectively, and constructed into the plasmid pUC19. Then, the complete expression cassette of HygR was amplified between the upstream fragment Urα-up and the downstream fragment Urα-down to obtain the recombinant plasmid pUC19-rDNA-HisG-HygR.
[0046] Primer pair 1:
[0047] Urα-up-F: caggaaacagctatgaccatgattacgccattaccattttaaagcaattgttaacaaga (SEQ ID NO. 1);
[0048] Urα-up-R: CTATACGAACGGTACCTAGGaactttttatcggaacctta (SEQ ID NO. 2).
[0049] Primer pair 2:
[0050] Urα-down-F: TTATACGAACGGTACCTAGGatacgattgaactacttata (SEQ ID NO. 3);
[0051] Urα-down-R: gtcacgacgttgtaaaacgacggccagtgcatctctactaccgagcctacgttgagact (SEQ ID NO. 4).
[0052] (2) The recombinant plasmid pUC19-rDNA-HisG-HygR obtained in step (1) was linearized and transformed into Yarrowia lipolytica 32861 to obtain the recombinant strain S0, wherein the transformation was performed using the Frozen EZ Yeast Transformation II kit. TM (purchased from Zymo Research), and the operation was performed according to the instructions of the kit.
[0053] Example 2 Construction of genetically engineered Yarrowia lipolytica strains H-1, H-2, H-3, H-4, H-5, and H-6
[0054] 1. Construction of engineered strains
[0055] The GLOD genes (S.gGLOD, S.pGLOD, K.sGLOD, S.sGLOD, S.vGLOD and K.cGLOD) from six different strains were inserted between the cloning sites PmlI and BamHI of pINA1312, and six recombinant plasmids were successfully obtained, namely pINA1312-SgGLOD, pINA1312-SpGLOD, pINA1312-KsGLOD, pINA1312-SsGLOD, pINA1312-SvGLOD and pINA1312-KcGLOD.
[0056] The recombinant plasmids pINA1312-SgGLOD, pINA1312-SpGLOD, pINA1312-KsGLOD, pINA1312-SsGLOD, pINA1312-SvGLOD, and pINA1312-KcGLOD were respectively digested with the restriction endonuclease NotI. The linearized plasmids were then integrated into the genome of the recombinant strain S0 using a yeast transformation kit. The uracil auxotrophic marker was also complemented to obtain the genetically engineered strains H1-SgGLOD, H2-SpGLOD, H3-KsGLOD, H4-SsGLOD, H5-SvGLOD, and H6-KcGLOD.
[0057] 2. Fermentation Experiment
[0058] The fermentation performance of the six genetically engineered strains constructed above was tested as follows:
[0059] The engineered strains were inoculated into test tubes containing 2 mL of YPD (YPD medium consisting of 2% glucose, 2% peptone, and 1% yeast extract, with the remainder being water; percentages are by mass) and cultured at 30°C and 220 rpm for 24 hours. The strains were then inoculated into 50 mL of fermentation medium in Erlenmeyer flasks and fermented at 30°C and 220 rpm for 6 days. The α-ketoglutarate content in the fermentation broth was then measured. All shake flask experiments were performed in duplicate.
[0060] Fermentation medium composition: glycerol 100.0 g / L, (NH4)2SO4 3.0 g / L, KH2PO4 3.0 g / L, MgSO4·7H2O 1.2 g / L, NaCl 0.5 g / L, sodium acetate 6.0 g / L, K2HPO4 0.1 g / L, CaCO3 10.0 g / L, thiamine 6×10 -7 g / L (filter sterilized), L-glutamic acid 40g / L.
[0061] Determination of α-ketoglutaric acid content:
[0062] HPLC detection: mobile phase: 5 mmol / L dilute sulfuric acid; flow rate: 0.6 mL / min; column temperature: 40°C; UV detector wavelength: 210 nm; injection volume: 20 μL. The column model and specifications were Aminex HPX-87H, 300 mm × 7.8 mm.
[0063] The results of α-ketoglutarate production test of each genetically engineered strain are shown in Figure 1 . Figure 1 The results showed that, compared to the WT control strain, the engineered strain of Yarrowia lipolytica introduced with the Streptomyces sp.-derived S.sGLOD gene significantly improved its ability to utilize the substrate L-glutamate, with α-ketoglutarate production reaching 9.36 g / L on the sixth day of fermentation. Therefore, the S.sGLOD gene was selected for subsequent experiments.
[0064] Example 3 Construction of genetically engineered Yarrowia lipolytica strains S4-1, S4-2, and S4-3
[0065] 1. Construction of engineered strains
[0066] The plasmid pUC19-AVRII-rDNA-hisG (SEQ ID NO.11+SEQ ID NO.12) was linearized by restriction endonuclease EcoRI and connected with the codon-optimized SsGLOD gene and the endogenous pyruvate carboxylase gene PYC of Yarrowia lipolytica (NCBI accession number: YALI0_C24101g) by seamless cloning. The SsGLOD gene and the PYC gene were connected in the SsGLOD-PYC manner to construct the plasmid pUC19-rDNA-P UAS4B-TEFin -SsGLOD-PYC; SsGLOD gene and PYC gene were connected in the form of SsGLOD×2-PYC to construct the plasmid pUC19-rDNA-P UAS4B-TEFin -SsGLOD×2-PYC; SsGLOD gene was connected in SsGLOD×2 mode to construct plasmid pUC19-rDNA-P UAS4B-TEFin -SsGLOD×2.
[0067] Use the kit Frozen EZ Yeast Transformation II TM (Zymo Research), the above plasmid pUC19-rDNA-P UAS4B-TEFin -SsGLOD×2-PYC, pUC19-rDNA-P UAS4B-TEFin -SsGLOD×2 and pUC19-rDNA-P UAS4B-TEFin -SsGLOD-PYC were respectively integrated into the genome of the recombinant strain S0, and the uracil auxotrophic marker was complemented to obtain engineered bacteria S4-1, S4-2 and S4-3.
[0068] 2. Fermentation Experiment
[0069] The three genetically engineered strains S4-1, S4-2, and S4-3 constructed above were tested for fermentation performance using the same method as in Example 2. The results showed that strains S4-1, S4-2, and S4-3 produced α-ketoglutarate production of 11.38 g / L, 7.24 g / L, and 9.80 g / L, respectively. Therefore, strain S4-1 was selected for subsequent experiments.
[0070] Example 4 Construction of genetically engineered Yarrowia lipolytica strains S4-1-1, S4-1-2, S4-1-3, S4-1-4, S4-1-5, and S4-1-6
[0071] 1. Construction of engineered strains
[0072] (1) The endogenous isocitrate dehydrogenase gene IDP (NCBI accession number: YALI1_F06197g), catalase gene CAT (NCBI accession number: YALI0F30987p), glycerol kinase gene GUT1 (NCBI accession number: YALI1_F00654g) and pyruvate carboxylase gene PYC (NCBI accession number: YALI0_C24101g) of Yarrowia lipolytica were constructed into the plasmid pINA1312 to obtain plasmids pINA1312-IDP, pINA1312-CAT, pINA1312-GUT1, pINA1312-PYC, pINA1312-IDP-CAT, and pINA1312-IDP-CAT-GUT1.
[0073] (2) The plasmids pINA1312-IDP, pINA1312-CAT, pINA1312-GUT1, pINA1312-PYC, pINA1312-IDP-CAT, and pINA1312-IDP-CAT-GUT1 obtained in step (1) were linearized and respectively transformed into strain S4-1 to obtain recombinant Yarrowia lipolytica strains S4-1-1, S4-1-2, S4-1-3, S4-1-4, S4-1-5, and S4-1-6 (as shown in FIG. Figure 2 shown).
[0074] 2. Fermentation Experiment
[0075] The fermentation performance of the recombinant bacteria S4-1-1, S4-1-2, S4-1-3, S4-1-4, S4-1-5 and S4-1-6 constructed above was tested using the same method as in Example 2.
[0076] The results of α-ketoglutarate production of each recombinant strain are shown in Figure 2 . Figure 2 The results showed that after the IDP-CAT-GUT1 gene was introduced into the engineered Yarrowia lipolytica strain S4-1, the α-ketoglutarate concentration could reach 17.85 g / L after adding 40 g / L glutamate and fermenting for six days.
[0077] Example 5 Effect of L-glutamic acid addition on α-ketoglutaric acid production.
[0078] The fermentation performance of wild Yarrowia lipolytica strain 32861 and genetically engineered Yarrowia lipolytica strain S4-1-6 was tested at different L-glutamic acid addition amounts. The method was the same as in Example 2, and the L-glutamic acid addition amounts were set to 0 g / L, 10 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L and 60 g / L, respectively.
[0079] The test results of α-ketoglutarate production under different L-glutamic acid addition amounts are shown in Figure 3 . Figure 3 The results showed that the production of α-ketoglutarate in wild Yarrowia lipolytica increased and then decreased with increasing glutamate concentrations in the culture medium. Adding low concentrations of glutamate promoted the accumulation of α-ketoglutarate, suggesting that endogenous glutamate oxidase may be present in Yarrowia lipolytica. Furthermore, the engineered strain S4-1-6 of Yarrowia lipolytica produced the highest α-ketoglutarate production on the sixth day of fermentation at a glutamate concentration of 40 g / L, reaching 17.85 g / L. Furthermore, the present invention found that both excessively high and low concentrations resulted in decreased α-ketoglutarate production in the engineered strains of Yarrowia lipolytica.
[0080] The sequence information involved in the present invention is as follows:
[0081] The S.gGLOD gene is derived from Streptomyces ghanaensis, and the codon-optimized nucleotide sequence is shown in SEQ ID NO.5;
[0082] The S.pGLOD gene is derived from Streptomyces platensis, and the codon-optimized nucleotide sequence is shown in SEQ ID NO.6;
[0083] The K.sGLOD gene is derived from Kitasatospora setae, and the codon-optimized nucleotide sequence is shown in SEQ ID NO. 7;
[0084] The S.sGLOD gene is derived from Streptomyces sp. X119-6, and the codon-optimized nucleotide sequence is shown in SEQ ID NO.8;
[0085] The S.vGLOD gene is derived from Streptomyces viridochromogenes, and the codon-optimized nucleotide sequence is shown in SEQ ID NO.9;
[0086] The K.cGLOD gene is derived from Kitasatospora cystarginea, and the codon-optimized nucleotide sequence is shown in SEQ ID NO.10.
[0087] The nucleotide sequence of plasmid pUC19-AVRII-rDNA-hisG is shown in SEQ ID NO.11+SEQ ID NO.12.
[0088] SEQ ID NO.5:
[0089]
[0090] SEQ ID NO.6:
[0091]
[0092] SEQ ID NO.7:
[0093]
[0094] SEQ ID NO.8:
[0095]
[0096] SEQ ID NO.9:
[0097]
[0098] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A method for constructing a genetically engineered bacterium for fermenting and producing α-ketoglutaric acid, characterized in that: The method comprises the steps of integrating the GLOD gene into the Yarrowia lipolytica genome to construct the genetically engineered bacteria; The nucleotide sequence of the GLOD gene is shown in any one of SEQ ID NOs. 5-10.
2. The construction method according to claim 1, characterized in that The nucleotide sequence of the GLOD gene is shown in SEQ ID NO.
8.
3. The construction method according to claim 2, characterized in that The construction method further comprises the step of integrating the PYC gene into the Yarrowia lipolytica genome; The accession number of the PYC gene in NCBI is YALI0_C24101g.
4. The construction method according to claim 3, characterized in that The construction method further comprises the step of integrating the IDP gene into the Yarrowia lipolytica genome; The accession number of the IDP gene in NCBI is YALI1_F06197g.
5. The construction method according to claim 3, characterized in that The construction method further comprises the step of integrating the CAT gene into the Yarrowia lipolytica genome; The accession number of the CAT gene in NCBI is YALI0F30987p.
6. The construction method according to claim 3, characterized in that: The construction method further comprises the steps of integrating the IDP gene, the CAT gene and the GUT1 gene into the Yarrowia lipolytica genome; The accession numbers of the IDP gene, the CAT gene and the GUT1 gene in NCBI are YALI1_F06197g, YALI0F30987p and YALI1_F00654g respectively.
7. A genetically engineered bacterium for producing α-ketoglutarate by fermentation, constructed according to the construction method according to any one of claims 1 to 6.
8. Use of the genetically engineered bacteria according to claim 7 in the fermentation production of α-ketoglutaric acid.
9. A method for increasing the yield of α-ketoglutaric acid, characterized in that: The method comprises the steps of using a fermentation medium containing L-glutamic acid to ferment and culture the genetically engineered bacteria according to claim 7 to prepare the α-ketoglutaric acid.
10. The method according to claim 9, characterized in that The concentration of L-glutamic acid in the fermentation medium is 40 g / L.