RT-RAA-LFD-based tobacco mosaic virus detection kit and detection method and application of RT-RAA-LFD-based tobacco mosaic virus detection kit

Abstract

The invention discloses a TMV (Tobacco Mosaic Virus) virus detection kit and detection method based on RT-RAA-LFD (Reverse Transcription-Reverse Amplification- The tobacco mosaic virus virus detection kit based on RT-RAA-LFD comprises an RT-RAA primer pair and a lateral flow chromatography test strip LFD, wherein the RT-RAA primer pair and the lateral flow chromatography test strip LFD are suitable for tobacco mosaic virus virus detection; the TMV virus detection method based on RT-RAA-LFD comprises the following steps: extracting nucleic acid from a sample to be detected, and carrying out RT-RAA reverse transcription recombinase isothermal amplification; the application of the tobacco mosaic virus detection kit is that the RT-RAA-LFD-based tobacco mosaic virus detection kit is used for identifying whether a plant sample to be detected contains tobacco mosaic viruses or not. According to the kit and the method provided by the invention, the detection efficiency is remarkably improved, the detection time and the detection cost are saved, and the kit and the method can be effectively used for quickly and accurately identifying common tobacco mosaic viruses.

Description

Technical Field

[0001] The present invention relates to the technical field of plant quarantine, in particular to a RT-RAA-LFD-based tobacco mosaic virus detection kit, detection method and application. Background Art

[0002] The genus Tobamovirus belongs to the family Virgaviridae, and 37 species have been described to date. This genus has a wide host range, encompassing numerous economic crops and ornamental plants, such as tobacco, tomato, zucchini, potato, pepper, cucurbits, and orchids. Once infected, they often cause typical symptoms such as leaf mosaic, fruit shrunkenness, and brown spots, leading to significant declines in yield and quality, and causing serious economic losses to agricultural production. Emerging pathogens such as Tomato brown rugose fruit virus (ToBRFV), Cucumber green mottle mosaic virus (CGMMV), and Tomato mottle mosaic virus (ToMMV) have attracted significant attention in many countries and regions worldwide due to their rapid mutation rates and high pathogenicity.

[0003] To effectively prevent and control the spread of tobacco mosaic virus, rapid and accurate on-site diagnostic technology is crucial. Existing common detection methods are mostly based on reverse transcription polymerase chain reaction (RT-PCR). While this technique is highly sensitive and specific, it relies heavily on temperature-controlled equipment and laboratory conditions, has a long detection cycle, and requires specialized molecular biology expertise, making it unsuitable for field or grassroots epidemic prevention applications.

[0004] In recent years, recombinase-mediated isothermal amplification (RAA) and its closely related technique, recombinase polymerase amplification (RPA), have been widely used for the rapid detection of a variety of pathogens (including viruses, fungi, and bacteria) due to their advantages, including exponential amplification at 37–42°C, minimal instrumentation requirements, simplified primer design, and rapid reaction times (typically completed within 10–20 minutes). The RAA system, consisting of core components such as recombinase, single-strand binding protein, and DNA polymerase, is often provided as a lyophilized powder, offering low cost, stable reagents, and ease of portability.

[0005] To visualize test results, lateral flow dipsticks (LFDs) have been combined with isothermal amplification technology for rapid on-site diagnosis due to their ease of use, lack of instrumentation, and on-site interpretation. However, a universal RT-RAA-LFD combined detection protocol for multiple tobacco mosaic virus (TMV) viruses is currently lacking. Summary of the Invention

[0006] To this end, the technical problem to be solved by the present invention is to provide a tobacco mosaic virus genus virus detection kit and detection method and application based on RT-RAA-LFD. Using this kit or this detection method, rapid visual detection of tobacco mosaic virus can be achieved with high detection sensitivity and strong specificity.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0008] The RT-RAA-LFD-based tobacco mosaic virus detection kit comprises an RT-RAA primer pair suitable for tobacco mosaic virus detection and a lateral flow chromatography test strip LFD; wherein:

[0009] The RT-RAA primer pair comprises a primer Tobamo-RAA-F and a primer Tobamo-RAA-R, wherein Tobamo-RAA-F is a single-stranded DNA with a sequence as shown in SEQ ID NO.1 and a 6-carboxyfluorescein label at its 5' end; and Tobamo-RAA-R is a single-stranded DNA with a sequence as shown in SEQ ID NO.2 and a biotin label at its 3' end. The RT-RAA primer pair is used to perform specific RT-RAA reverse transcription recombinase isothermal amplification of a conserved sequence in the genome of a tobacco mosaic virus to obtain an amplified product.

[0010] The lateral flow chromatography test strip LFD is a nucleic acid detection test strip using a double antibody sandwich method.

[0011] The two primers in the RT-RAA primer pair in this test kit are both degenerate primers and can be used to specifically amplify RT-RAA nucleic acids from 10 tobacco mosaic virus species. The resulting RT-RAA amplification product is labeled with both 6-carboxyfluorescein and biotin. This amplification product can be captured by a lateral flow chromatography (LFD) test strip using a double-antibody sandwich method, making it possible to rapidly detect tobacco mosaic virus using lateral flow chromatography (LFD) test strips. This test kit can achieve efficient and specific amplification of target sequences in the tobacco mosaic virus genome without complex instrumentation, and enables visual interpretation of test results, significantly shortening the test cycle and simplifying the procedure.

[0012] By adopting highly universal degenerate primer design, the detection kit of the present invention can cover ten important pathogens, realize broad-spectrum detection, and reduce the cost of repeated preparation of reagents required for multiple virus detection.

[0013] The above-mentioned tobacco mosaic virus detection kit, the tobacco mosaic virus is at least one of tobacco mosaic virus Tobamovirus tabaci, tomato mosaic virus Tobamovirus tomatotessellati, tomato mottle mosaic virus Tobamovirus maculatessellati, tomato brown wrinkled fruit virus Tobamovirus fructirugosum, pepper mild mottle virus Tobamovirus capsici, cucumber green mottle mosaic virus Tobamovirus viridimaculae, cucumber fruit mottle mosaic virus Tobamovirus maculafructi, cucumber mottle virus Tobamovirus cucumeris, sweet pepper mild mottle virus Tobamovirus paprikae and rehmannia mosaic virus Tobamovirus rehmanniae.

[0014] The RT-RAA-LFD-based method for detecting tobacco mosaic virus comprises the following steps:

[0015] S1. Extracting nucleic acid from a sample to be tested, and performing RT-RAA reverse transcription recombinase isothermal amplification on the nucleic acid of the sample to be tested using the RT-RAA primer pair in the above-mentioned tobacco mosaic virus detection kit to obtain an amplified product;

[0016] S2. Dilute the amplification product obtained in S1, drop the diluted amplification product onto the sample binding pad of the lateral flow chromatography test strip LFD in the above-mentioned tobacco mosaic virus detection kit, and perform lateral flow chromatography;

[0017] S3. After the lateral flow chromatography is completed, observe the color of the test line and quality control line on the lateral flow chromatography test strip LFD and interpret the results.

[0018] In the above-mentioned RT-RAA-LFD-based method for detecting tobacco mosaic virus, in step S3, the results are interpreted according to the following criteria:

[0019] Negative: the control line shows color, but the test line does not show color;

[0020] Positive: both the control line and the test line are colored;

[0021] Test failure or invalidation: If the quality control line does not show color, the test fails or the test strip is invalid;

[0022] When the reading result is positive, the sample to be tested contains at least one of tobacco mosaic virus Tobamovirus tabaci, tomato mosaic virus Tobamovirus tomatotessellati, tomato mottle mosaic virus Tobamovirusmaculatessellati, tomato brown wrinkled fruit virus Tobamovirus fructirugosum, pepper mild mottle virus Tobamovirus capsici, cucumber green mottle mosaic virus Tobamovirus viridimaculae, cucumber fruit mottle mosaic virus Tobamovirus maculafructi, cucumber mottle virus Tobamovirus cucumeris, sweet pepper mild mottle virus Tobamovirus paprikae and rehmannia mosaic virus Tobamovirus rehmanniae.

[0023] In the above-mentioned RT-RAA-LFD-based tobacco mosaic virus detection method, in step S1, the volume of the reaction system for RT-RAA reverse transcription recombinase isothermal amplification is 50 μL, and each reaction system contains 2 μL of nucleic acid solution of the sample to be tested as a template, 29.4 μL of hydration buffer dissolved in RAA reaction dry powder, 2.5 μL of magnesium acetate solution, 20 pmol of Tobamo-RAA-F, 20 pmol of Tobamo-RAA-R, and 12.1 μL of ddH2O.

[0024] In the aforementioned RT-RAA-LFD-based method for detecting tobacco mosaic virus, in step S2, the RT-RAA reverse transcriptase recombinase isothermal amplification conditions are: incubation at 37°C to 42°C for 20 to 30 minutes. This reaction temperature is compatible with common thermostats while also ensuring enzyme activity. If the temperature is below 37°C, the amplification reaction rate decreases significantly, making it difficult to obtain sufficient product within the specified time. If the temperature is above 42°C, the activity of the relevant enzymes may be impaired, reducing the specificity and efficiency of RT-RAA amplification.

[0025] In the aforementioned RT-RAA-LFD-based method for detecting tobacco mosaic virus, in step S2, the RT-RAA reverse transcriptase recombinase isothermal amplification conditions are: incubation at 42°C for 20 minutes. Temperature-time matrix experiments have shown that 42°C for 20 minutes produces the strongest specific signal in the shortest time, balancing sensitivity and reaction rate.

[0026] The above-mentioned RT-RAA-LFD-based method for detecting tobacco mosaic virus has a detection limit of 50 ag / μL for tobacco mosaic virus nucleic acid.

[0027] In the above-mentioned RT-RAA-LFD-based tobacco mosaic virus detection method, in step S2, when the amplified product is diluted, the dilution factor is 200 times; when the diluted amplified product is added dropwise to the sample conjugate pad, the addition amount is 50 μL. When the concentration of the template RNA (that is, the tobacco mosaic virus nucleic acid) in the RT-RAA reaction system is lower than 50 ag / μL, the RT-RAA amplification cannot proceed normally; when the concentration of the template RNA in the RT-RAA reaction system is greater than or equal to 50 ag / μL, the RT-RAA amplification can proceed normally, but the dilution factor of the amplified product will have a certain impact on the results of the lateral flow chromatography test strip test. Specifically, if the dilution factor is too large, the sensitivity of the test will be reduced, and if the dilution factor is too small, a false positive result may occur. In actual testing, when the template RNA concentration in the RT-RAA reaction system is greater than or equal to 50 μg / μL, after incubation at 37-42°C for 20-30 minutes, a 200-fold dilution of the RT-RAA amplification product and a sample volume of 50 μL are appropriate for detection using lateral flow chromatography test strips. Insufficient sample volume reduces the capture efficiency of the test strip; excessive sample volume can lead to capillary flow control, affecting flow rate and result stability.

[0028] Application of a tobacco mosaic virus detection kit, wherein the application is to use the above-mentioned RT-RAA-LFD-based tobacco mosaic virus detection kit for any of the following:

[0029] a) identifying whether a plant sample to be tested contains a tobacco mosaic virus;

[0030] b) identifying whether the virus to be tested is a virus of the genus Tobacco mosaic virus;

[0031] c) Identification of Tobacco mosaic virus.

[0032] The technical solution of the present invention achieves the following beneficial technical effects:

[0033] 1. The RT-RAA-LFD-based rapid universal detection kit and method for tobacco mosaic virus provided by the present invention can accurately detect at least 10 tobacco mosaic virus species in a short period of time, contributing to the rapid, efficient, sensitive, and economical on-site diagnosis of tobacco mosaic virus species. This detection method utilizes RT-RAA reverse transcriptase recombinase isothermal amplification to rapidly amplify target viral RNA at a constant temperature of 37-42°C. The entire reaction process can be completed in about 20 minutes, and the test results are directly displayed to the naked eye via lateral flow chromatography test strips, greatly improving detection efficiency and meeting the needs of rapid on-site diagnosis.

[0034] 2. By designing universal primers targeting conserved regions of tobacco mosaic virus genes, the present invention can simultaneously amplify target sequences of 10 viruses, enabling universal detection of multiple viruses. Experimental results demonstrate that its detection limit is significantly superior to that of traditional RT-PCR methods, and reliable positive signals can be obtained even in low-concentration samples, thus ensuring high sensitivity and specificity of detection.

[0035] 3. The technical solution provided by the present invention has simple reaction conditions and only needs to be operated under constant temperature equipment. It does not require the support of high-precision instruments. The operation steps are simple, which can greatly reduce the detection cost and dependence on laboratory conditions. It is convenient for promotion and application in grassroots epidemic prevention and on-site rapid diagnosis, saving detection time and resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Agarose gel electrophoresis results of the target sequences of ten tobacco mosaic viruses (TMV, ToMV, ToMMV, ToBRFV, PMMoV, CGMMV, CFMMV, CMoV, PaMMV, and ReMV) amplified by the RT-RAA method in Example 1 of the present invention, with NC-1 and NC-2 serving as negative controls, using RNA from healthy tomato leaves and RNA from healthy watermelon leaves as templates, respectively;

[0037] Figure 2 Photographs of test strips for detecting ten tobacco mosaic viruses (TMV, ToMV, ToMMV, ToBRFV, PMMoV, CGMMV, CFMMV, CMoV, PaMMV, and ReMV) using the RT-RAA-LFD-based tobacco mosaic virus detection method in Example 1 of the present invention; NC-1 and NC-2 are negative controls, using RNA from healthy tomato leaves and RNA from healthy watermelon leaves as templates, respectively;

[0038] Figure 3 Effects of different RT-RAA reaction temperatures on the detection results of tobacco mosaic virus (taking ToBRFV and CGMMV as examples) in Experimental Example 1 of the present invention;

[0039] Figure 4 Effects of different RT-RAA reaction times on the detection results of tobacco mosaic virus (taking ToBRFV and CGMMV as examples) in Experimental Example 2 of the present invention;

[0040] Figure 5 Experimental results of the specificity experiment of the tobacco mosaic virus detection method based on RT-RAA-LFD in Experimental Example 3 of the present invention, the interfering pathogens were tobacco ringspot virus, cucumber mosaic virus, tomato ringspot virus, tomato spotted wilt virus, potato virus Y, potato virus X and watermelon mosaic virus, and the negative control NC used healthy tomato RNA as a template;

[0041] Figure 6 Sensitivity test results of the tobacco mosaic virus detection method based on RT-RAA-LFD in Experimental Example 4 of the present invention;

[0042] Figure 7 Experimental results of the sensitivity of conventional RT-PCR for tobacco mosaic virus detection. In the figure, M represents DL2000 marker;

[0043] Figure 8 The test strip results of 30 actual samples detected by the RT-RAA-LFD-based tobacco mosaic virus detection method in Example 2 of the present invention, 1-10 are tomato samples, 11-20 are pepper samples, 21-30 are melon samples, N is a negative control, and P is a positive control. DETAILED DESCRIPTION

[0044] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples were commercially available unless otherwise specified. Quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0045] Example 1

[0046] In this example, an RT-RAA primer pair for tobacco mosaic virus was designed, and the genomic RNA of tobacco mosaic virus (the genetic material of tobacco mosaic virus is all RNA) was amplified using the RT-RAA primer pair. The RT-RAA amplification product was tested using a lateral flow chromatography test strip LFD.

[0047] RT-RAA primers were screened and designed based on sequences reported in existing literature and Genbank. In this example, universal RT-RAA primer pairs were designed based on reported sequences of 34 tobacco mosaic virus species, aiming to ensure that the designed universal primers are applicable to a wide range of tobacco mosaic virus species. Testing has shown that the RT-RAA primer pairs obtained in this example can amplify target fragments from at least ten tobacco mosaic virus species. The ten species of tobacco mosaic virus are: tobacco mosaic virus (TMV, Tobamovirus tabaci), tomato mosaic virus (ToMV, Tobamovirus tomatotessellati), tomato mottle mosaic virus (ToMMV, Tobamovirus maculatessellati), tomato brown rugose fruit virus (ToBRFV, Tobamovirusfructirugosum), pepper mild mottle virus (PMMoV, Tobamovirus capsici), cucumber green mottle mosaic virus (CGMMV, Tobamovirus viridimaculae), cucumber fruit mottle mosaic virus (CFMMV, Tobamovirus maculafructi), cucumber mottle virus (CGMMV, Tobamovirus maculafructi), cucumber fruit mottle virus (CFMMV, Tobamovirus maculafructi), cucumber fruit mottle virus (CGM ... mottlevirus (CMoV, Latin name Tobamovirus cucumeris), paprika mild mottlevirus (PaMMV, Latin name Tobamovirus paprikae), rehmannia mosaicvirus (ReMV, Latin name Tobamovirus rehmanniae).

[0048] The RT-RAA primer pairs were designed based on the conserved sequences of the ten tobacco mosaic virus genomes described above. The GenBank accession numbers for the reference sequences are: NC001367 (TMV), NC002692 (ToMV), NC022230 (ToMMV), NC028478 (ToBRFV), NC003630 (PMMoV), NC001801 (CGMMV), NC002633 (CFMMV), NC008614 (CMoV), NC004106 (PaMMV), and NC009041 (ReMV). The specific primer sequences are as follows.

[0049] Tobamo-RAA-F (SEQ ID NO.1):5'-6-FAM-AGWGYTTWYCCSTYCWCTTAAATCGAASGG-3';

[0050] Tobamo-RAA-R (SEQ ID NO.2):5'-TGGGCCSCWACCSGSGGHWMVGGGRGRATTCGAA-Biotin-3';

[0051] Tobamo-RAA-F and Tobamo-RAA-R comprise the RT-RAA primer pair for detecting tobacco mosaic virus. The 6-FAM at the 5' end of Tobamo-RAA-F represents 6-carboxyfluorescein, and the Biotin at the 3' end of Tobamo-RAA-R represents biotin.

[0052] The aforementioned RT-RAA primer pair contains two degenerate primer sequences. The degenerate primer sequences used for RT-RAA differ from those typically used for PCR. This is because RT-RAA technology relies on recombinase-mediated targeted primer binding, a mechanism that necessitates longer primers for amplification. Otherwise, a stable enzyme-primer-template ternary complex cannot be formed, resulting in low amplification efficiency or false-positive results. Generally, primers required for RT-RAA amplification must be 30-35 bp in length. These longer primers require the presence of longer, highly conserved sequences within the target gene. However, the genomic sequences of tobacco mosaic viruses exhibit significant nucleotide variation, and long conserved regions are extremely scarce.

[0053] Secondly, even if such conserved regions (viable conserved regions) can be found, designing effective RT-RAA primers for a specific viable conserved region that can cover as many virus species as possible presents numerous challenges. This is because, even if a conserved region is ultimately proven viable, the effectiveness of the primers is still subject to multiple variables (such as secondary structure and RT-RAA amplification compatibility). Furthermore, in order to cover the polymorphism of as many species as possible within the genus Tobacco Mosaic Virus, multiple degenerate bases must be introduced into the primers when designing degenerate primers for RT-RAA. With each increase in the number of degenerate sites (the sites where degenerate bases are located) in a primer, the number of base combinations in the corresponding primer sequence increases exponentially, leading to an exponential increase in the number of possible candidate primers. Primers in these candidate primer sets need to be tested individually and repeatedly adjusted.

[0054] In this example, when designing primers, three candidate conserved regions were initially screened from the genomes of 34 tobacco mosaic virus species based on multiple sequence alignment. For each candidate conserved region, the inventors synthesized and tested more than 10 pairs of degenerate primers and performed RT-RAA amplification verification in 10 tobacco mosaic virus samples. Ultimately, only the RT-RAA primer pair in this example obtained a strong and specific amplification signal, and was able to successfully amplify the most types of tobacco mosaic virus species. The remaining candidate primers either failed to amplify any bands, or showed non-specific amplification, or could only amplify a few types of tobacco mosaic virus species, failing to meet general detection requirements.

[0055] That is, the RT-RAA primer pair shown in this example was successfully obtained after systematic evaluation of multiple candidate conserved regions failed, and through a large number of experimental comparisons, condition optimization and combination adjustments.

[0056] Using the aforementioned RT-RAA primer pairs, RT-RAA amplification (reverse transcription recombinase isothermal amplification) was performed on the genomic RNA of each of the ten tobacco mosaic virus species, yielding a specific DNA fragment for each virus. The specific DNA fragments obtained after amplification of the RNA of the ten viruses were sequenced, and the sequences were as follows:

[0057] TMV (136 bp):

[0058] AGGTTTTTCCCTCCACTTAAATCGAAGGGTTGTGTCTTGGATCGCGCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGAGGGGTTCGAATCCCCCCGTTACCCCCGGTAGGGGCCCA

[0059] ToMV(136bp):

[0060] AGTGTTTTTCCCTCCACTTAAATCGAAGGGTAGTGTCTTGGAGCGCGCGGAGTAAACATATATGGTTCATATATGTCCGTAGGCACGTAAAAAAGCGAGGGATTCGAATTCCCCCGGAACCCCCGGTTGGGGCCCA

[0061] ToMMV(136 bp):

[0062] AGTGTTTTTCCCTCCACTTAAATCGAAGGGTTTTGTCTTGGAACGCGCGGGTTAAATATACATGGTTCATGTATATCCGTAGACAAGTAATAATGCGTGGGATTCGAATTCCCCCGGAACCCCCGGTAGGGGCCCA

[0063] ToBRFV(135 bp):

[0064] AGTGTTTTTCCCTCCACTTAAATCGAAGGGTAGTGTCTTGGAGCGCGCGGGACAAATGTGTATGGTTCATACACATCCGTAGGCACGTAATAAAGCGAGGGATTCGAATTCCCCCGGAACCCCCGGAGGGGCCCA

[0065] PMMoV(138 bp):

[0066] AGTGTTTTTCCCTCCACTTAAATCGAAGGGTTGTCGTTGGGATGGAACGCAATTAAATACATGTGTGACGTGTATTTGCGAACGACGTAATTATTTTTCAGGGGTTCGAATCCCCCCCGAACCGCGGGTAGCGGCCCA

[0067] CGMMV(136 bp):

[0068] AGTGCTTTCCCGTTCACTTAAATCGAACGGTTTGCTCATTGGTTTGCGGAAACCTCTCACGTGTGACGTTGAAGTTTCTATGGGCAGTAATTCTGCAAGGGGTTCGAATCCCCCCTTTTCCCCGGGTAGGGGCCCA

[0069] CFMMV(138 bp):

[0070] AGAGTTTTTCCCTCCTCTTAAATCGAAGGGATTGTTTGCGCGGTTTCTACCGAGCCTCTGCTGTGTGACAGTAAGCTGGCGTAAGCAATTATGGGTAGAGGTGTTCGAATCACCCCCTTTGCCCCGGGTAGGGGCCCA

[0071] CMoV(136 bp):

[0072] AGTGTTTTTCCGTCCACTTAAATCGAACGGCTTTCTCATCTGGATCGTATTGTCCTCTCCCCTGTGAAGGTGATGACTTGATGAGTTTGTATAATACGAGGGGTTCGAATCCCCCCTAACCCCGGGTAGGGGCCCA

[0073] PaMMV(238 bp):

[0074] AGTGTTTATCCCTCCACTTAAATCGAAGGGCGGTTGTGGTCATCACTACATTTATGTAGTGCAACTTGAAGAAGATGAGGTGGTACATACCAAAATGTACAGTGGTTTTCCCTCCACTTGAATCGAAGGGTTGGTTGTTGGAGTTTTCACGTGAGACGTTGGTGCAACGTAACTGCGTGTACAACTGTAAAAGTAAAAAGGGGTTCGAATCCCCCCTTTACCCCGGGTATGGGGCCCA

[0075] ReMV(136 bp):

[0076] AGTGTTTTTCCCTCCACTTAAATCGAAGGGTTGTGTCTTGGTTCGCGCGGGTCAAGTGTATATGGTGCATATACATCCGTAGGCACGTAATAAAGCGAGGGATTCGAATTCCCCCGTTACCCCCGGTAGGGGCCCA

[0077] The RT-RAA reaction system is shown in Table 1. Buffer A represents the hydration buffer, buffer B represents the magnesium acetate solution, and the RAA reaction powder represents a mixture of lyophilized recombinase, polymerase, and buffer salts. Buffer A, buffer B, and RAA reaction powder are all included in the RNA Constant Temperature Rapid Amplification Kit (Basic)-II (Cat. No. WLRB8207KIT) from Ampu Future Biotechnology Co., Ltd. To prepare the RT-RAA reaction system, first add buffer A to the centrifuge tube containing the RAA reaction powder to fully dissolve it. Then, add the RNA template, 10 μmol / L Tobamo-RAA-F, 10 μmol / L Tobamo-RAA-R, and ddH2O to the solution. Buffer B is then added and mixed thoroughly. Finally, the RNA template is added and the volume is adjusted to 50 μL with ddH2O. The final reaction system contains 20 pmol of both Tobamo-RAA-F and Tobamo-RAA-R.

[0078] Table 1 RT-RAA reaction system

[0079] Reagents volume RNA template (Tobacco mosaic virus RNA) 2μL Abuffer 29.4μL B buffer 2.5 μL 10 μmol / L Tobamo-RAA-F 2μL 10μmol / L Tobamo-RAA-R 2μL RAA reaction powder Volume not included <![CDATA[ddH2O]]> 12.1μL total 50 μL

[0080] After the RT-RAA reaction system is prepared, it is incubated at 42°C for 20 minutes to obtain an amplified product containing a specific DNA fragment.

[0081] like Figure 1 The results of agarose gel electrophoresis of the amplified products obtained by RT-RAA amplification are shown. NC-1 and NC-2 in the figure are negative controls (the templates used for RT-RAA amplification were RNA from healthy tomato and watermelon leaves, respectively). M represents a DNA marker. The results in the figure demonstrate that the RT-RAA primer pairs, RT-RAA reaction system, and RT-RAA reaction procedure provided in this example can effectively amplify RNA from the 10 tobacco mosaic virus species described above, generating specific DNA fragments.

[0082] Furthermore, 1 μL of each virus's RT-RAA amplification product, as well as the NC-1 and NC-2 amplification products, was taken and diluted in 199 μL of ddH2O. 50 μL of the 200-fold diluted amplification product was aspirated and added to the sample well of a lateral flow chromatography test strip LFD (Cat. No. WLFS8204, a product of Amp Future, a nucleic acid detection test strip using a double antibody sandwich method) (that is, the diluted amplification product was dripped onto the sample conjugate pad of the lateral flow chromatography test strip) and the test results were observed for 1 minute.

[0083] The final result is as follows Figure 2As shown in the figure, the lateral flow chromatography test strip test line (T line) and quality control line (C line) corresponding to each virus group are colored, indicating a positive reaction. The lateral flow chromatography test strip successfully detected the tobacco mosaic virus. The lateral flow chromatography test strip test line (T line) corresponding to the three groups of NC-1, NC-2, and water as a blank control is not colored, and the quality control line (C line) is colored, indicating a negative reaction, which is also in line with expectations. When both the paper strip test line (T line) and the quality control line (C line) are colorless, the test strip is considered invalid or the test has failed, and retesting is required.

[0084] These results demonstrate that the RT-RAA primer pair provided in this example can effectively amplify genomic RNA from ten tobacco mosaic virus species, and the amplified products can be detected using lateral flow chromatography (LFD) test strips. This example successfully provides a method for detecting tobacco mosaic virus using RT-RAA-LFD.

[0085] Experimental Example 1

[0086] In this experimental example, based on the method provided in Example 1, only the temperature during RT-RAA amplification was changed to amplify the genomic RNA of tobacco mosaic virus to test the optimal temperature during RT-RAA amplification.

[0087] In this experiment, the viruses used were ToBRFV and CGMMV. For RT-RAA amplification, six RT-RAA reaction systems were prepared for each virus and amplified at 27°C, 32°C, 37°C, 42°C, 47°C, and 52°C for 20 minutes. After amplification, 1 μL of the amplified product was diluted in 199 μL of ddH2O. 50 μL of the 200-fold diluted amplified product was then added to the sample wells of a lateral flow chromatography test strip (Cat. No. WLFS8204, Amp Future Co., Ltd.) and the test results were observed after 1 minute. If both the test line (T line) and the control line (C line) of the test strip develop color, the corresponding temperature conditions are suitable for RT-RAA amplification.

[0088] like Figure 3 The figure shows the effect of different reaction temperatures on RT-RAA amplification results for tobacco mosaic virus (ToBRFV and CGMMV, for example). As shown in the figure, the two groups with reaction temperatures of 37°C and 42°C produced relatively distinct bands, suggesting that RT-RAA amplification is best performed at temperatures between 37°C and 42°C. For ToBRFV, the bands obtained by RT-RAA amplification at 42°C were darker, suggesting that the enzyme used in RT-RAA amplification may be more active at 42°C.

[0089] Experimental Example 2

[0090] In this experimental example, based on the method provided in Example 1, only the time of RT-RAA amplification was changed to amplify the genomic RNA of tobacco mosaic virus to test the optimal reaction time of RT-RAA amplification.

[0091] In this experiment, the viruses used were ToBRFV and CGMMV. For RT-RAA amplification, seven RT-RAA reaction systems were prepared for each virus, with amplification performed at reaction times of 0, 5, 10, 15, 20, 25, and 30 minutes, all at 42°C. After RT-RAA amplification, 1 μL of the amplified product was diluted in 199 μL of ddH2O. 50 μL of the 200-fold diluted amplified product was then aspirated and added to the sample wells of a lateral flow chromatography test strip (Cat. No. WLFS8204, Amp Future Co., Ltd.), and the test results were observed after 1 minute. The expected result is that when the RT-RAA reaction time reaches or exceeds a certain value, both the C and T lines on the lateral flow chromatography test strip appear.

[0092] like Figure 4 The figure shows the effect of different reaction times on RT-RAA amplification results for tobacco mosaic virus (ToBRFV and CGMMV). As shown in the figure, for both viruses, a 20-minute reaction time resulted in distinct bands on the test strips. For CGMMV, the band color faded when the reaction time exceeded 20 minutes. This suggests that the RT-RAA amplification time can range from 20 to 30 minutes, with 20 minutes being the most optimal.

[0093] According to the results of Experimental Examples 1 and 2, the optimum temperature for the RT-RAA reaction is 42° C., and the reaction time is 20 min.

[0094] Experimental Example 3

[0095] In this experimental example, an experiment was designed to test the specificity of the RT-RAA-LFD-based tobacco mosaic virus detection method provided in Example 1 to tobacco mosaic virus.

[0096] First, total RNA was extracted from plant samples infected with common viruses in Solanaceae and cucurbit crops: tobacco ringspot virus (TRSV, Nepovirus nicotianae), cucumber mosaic virus (CMV, Cucumovirus CMV), tomato ringspot virus (ToRSV, Nepovirus lycopersici), tomato spotted wilt virus (TSWV, Orthotospovirus tomatomaculae), potato virus Y (PVY, Potyvirus yituberosi), potato virus X (PVX, Potexvirus ecspotati), and watermelon mosaic virus (WMV, Potyvirus citrulli) (a total of seven plant samples infected with different viruses) and used as templates for RT-RAA amplification. When extracting total RNA, the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441) of TIANGEN was used for extraction, and the specific operation steps were carried out according to the kit instructions.

[0097] The RT-RAA reaction system was prepared according to the method in Example 1, and the total RNA of the seven virus-infected plants was subjected to RT-RAA amplification and LFD detection respectively.

[0098] In addition, a positive control group, a negative control group, and a blank control group were set up. The template for RT-RAA amplification in the positive control group was ToBRFV RNA, and the template for RT-RAA amplification in the negative control NC group was healthy tomato RNA. Except for the different templates in the RT-RAA reaction system, the remaining procedures for these two groups were exactly the same as in Example 1. The blank control group was water.

[0099] like Figure 5 As shown in the figure, the RT-RAA-LFD-based tobacco mosaic virus detection method in Example 1 is highly specific for tobacco mosaic virus and is not interfered with by other viruses during detection.

[0100] Experimental Example 4

[0101] In this experimental example, the sensitivity of the tobacco mosaic virus detection method based on RT-RAA-LFD provided in Example 1 was tested.

[0102] First, total RNA was extracted from tomato fruit samples infected with ToBRFV. The RNA was extracted using the TIANGEN RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441), following the kit instructions. The final concentration of the extracted total RNA was 50 ng / μL.

[0103] The extracted total RNA was diluted in a 10-fold concentration gradient to prepare 9 different concentrations of RNA to be tested (the dilution multiples were 10 -0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 and 10 -10 ). Then, 2 μL of each of the 9 different concentrations of the test RNA was taken as a template for RT-RAA amplification. RT-RAA amplification was then performed using the RT-RAA primer pair provided in Example 1, and the amplified product was detected using the RT-RAA-LFD-based tobacco mosaic virus detection method provided in Example 1.

[0104] As a control, conventional RT-PCR was used with the specific primer combination ToBRFV-FMX (5'-AACCAGAGTCTTCCTATACTCGGAA-3') and ToBRFV-RMX (5'-CTCWCCATCTCTTAATAATCTCCT-3'), the above-mentioned 9 different concentrations of test RNA were used as PCR templates, and the RT-PCR reaction was performed using the Quanshijin Company RT-PCR kit (Cat. No. AE411). The reaction system is shown in Table 2.

[0105] Table 2 RT-PCR reaction system

[0106]

[0107] Reaction conditions: reverse transcription at 45°C for 30 minutes, annealing at 94°C for 5 minutes, 35 cycles of amplification (denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds, extension at 72°C for 45 seconds), and an additional extension at 72°C for 10 minutes. After completion of the reaction, the resulting RT-PCR products were subjected to agarose gel electrophoresis.

[0108] like Figure 6 and Figure 7 As shown, when the dilution factor of the RNA to be tested is 10 -9 When the dilution factor of the RNA to be tested reaches 10, there are still faint bands on the lateral flow chromatography test strips. For ordinary RT-PCR detection, when the dilution factor of the RNA to be tested reaches 10, -7 When the concentration is increased by 100 times, the bands in the electrophoresis results disappear.

[0109] From the above results, it can be seen that when the RT-RAA-LFD-based tobacco mosaic virus detection method provided in Example 1 is used for detection, the dilution factor of 10 -9 The detection method provided in Example 1 is more sensitive than RT-PCR detection because the test RNA (concentration of 50 ag / μL) is effectively detected. The test RNA (the test RNA with a concentration of 50 ag / μL) is a mixture of ToBRFV RNA and tomato RNA, that is, in the test RNA, the concentration of ToBRFV RNA is less than or equal to 50 ag / μL. Therefore, it can be considered that the detection limit of the method provided in Example 1 for tobacco mosaic virus nucleic acid is 50 ag / μL.

[0110] Example 2

[0111] In this example, the RT-RAA primer pair provided in Example 1 and the tobacco mosaic virus detection method based on RT-RAA-LFD were used to detect whether the tomato, pepper and melon test samples were infected with tobacco mosaic virus, so as to verify the feasibility of the method provided in Example 1 for plant materials. The test samples were seeds and leaf samples collected by the inventors. In addition to the test samples, a group of negative controls (NC group, using water as a template for RT-RAA amplification) and a group of positive controls (P group, using total RNA from tomato leaves carrying ToBRFV as a template for RT-RAA amplification) were also set up.

[0112] During the test, for the sample to be tested (plant sample), total RNA was extracted using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441) produced by TIANGEN. The specific operation steps were carried out according to the kit instructions.

[0113] The total RNA was used as an RNA template and RT-PCR amplification was performed using the method provided in Example 1. The amplified product was detected using a lateral flow chromatography test strip. Meanwhile, the RT-PCR method provided in Experimental Example 4 was used as a control.

[0114] Table 3 shows the sample conditions and test results collected by the inventors. Figure 8 The lateral flow chromatography test strips corresponding to each sample are tested.

[0115] Table 3 Samples submitted for inspection and test results

[0116]

[0117]

[0118] The results in the table and Figure 8 It can be seen that for these 30 collected samples, the detection results of the above-mentioned tobacco mosaic virus detection method based on RT-RAA-LFD (i.e., the detection method provided in Example 1) and the RT-PCR method are consistent, indicating that the above-mentioned tobacco mosaic virus detection method based on RT-RAA-LFD (i.e., the detection method provided in Example 1) has good feasibility when applied to detecting whether biological materials contain tobacco mosaic virus.

[0119] In addition, the sequences of the 10 tobacco mosaic virus species in Example 1 after RT-RAA amplification were different from each other, indicating that the RT-RAA primer pair provided in Example 1 can also be combined with sequencing to identify the above 10 tobacco mosaic virus species.

[0120] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the claims of this patent application.

Claims

1. A tobacco mosaic virus detection kit based on RT-RAA-LFD, characterized in that: The invention comprises an RT-RAA primer pair and a lateral flow chromatography test strip LFD suitable for detecting tobacco mosaic virus; wherein: The RT-RAA primer pair comprises a primer Tobamo-RAA-F and a primer Tobamo-RAA-R, wherein Tobamo-RAA-F is a single-stranded DNA with a sequence as shown in SEQ ID NO.1 and a 6-carboxyfluorescein label at its 5' end; and Tobamo-RAA-R is a single-stranded DNA with a sequence as shown in SEQ ID NO.2 and a biotin label at its 3' end. The RT-RAA primer pair is used to perform specific RT-RAA reverse transcription recombinase isothermal amplification of a conserved sequence in the genome of a tobacco mosaic virus to obtain an amplified product. The lateral flow chromatography test strip LFD is a nucleic acid detection test strip using a double antibody sandwich method.

2. The tobacco mosaic virus detection kit according to claim 1, characterized in that The tobacco mosaic virus is at least one of tobacco mosaic virus Tobamovirus tabaci, tomato mosaic virus Tobamovirustomatotessellati, tomato mottle mosaic virus Tobamovirus maculatessellati, tomato brown wrinkled fruit virus Tobamovirus fructirugosum, pepper mild mottle virus Tobamovirus capsici, cucumber green mottle mosaic virus Tobamovirus viridimaculae, cucumber fruit mottle mosaic virus Tobamovirus maculafructi, cucumber mottle virus Tobamovirus cucumeris, sweet pepper mild mottle virus Tobamovirus paprikae and rehmannia mosaic virus Tobamovirus rehmanniae.

3. A method for detecting tobacco mosaic virus based on RT-RAA-LFD, characterized in that: The following steps are involved: S1, extracting nucleic acid from the sample to be tested, using the RT-RAA primer pair in the tobacco mosaic virus detection kit according to claim 1, performing RT-RAA reverse transcription recombinase isothermal amplification on the nucleic acid of the sample to be tested to obtain an amplified product; S2. diluting the amplification product obtained in S1, dropping the diluted amplification product onto the sample conjugate pad of the lateral flow chromatography test strip LFD in the tobacco mosaic virus detection kit according to claim 1, and performing lateral flow chromatography; S3. After the lateral flow chromatography is completed, observe the color of the test line and quality control line on the lateral flow chromatography test strip LFD and interpret the results.

4. The method for detecting tobacco mosaic virus based on RT-RAA-LFD according to claim 3, characterized in that: In step S3, the results are interpreted according to the following criteria: Negative: the control line shows color, but the test line does not show color; Positive: both the control line and the test line are colored; Test failure or invalidation: If the quality control line does not show color, the test fails or the test strip is invalid; When the reading result is positive, the sample to be tested contains at least one of tobacco mosaic virus Tobamovirus tabaci, tomato mosaic virus Tobamovirus tomatotessellati, tomato mottle mosaic virus Tobamovirusmaculatessellati, tomato brown wrinkled fruit virus Tobamovirus fructirugosum, pepper mild mottle virus Tobamovirus capsici, cucumber green mottle mosaic virus Tobamovirus viridimaculae, cucumber fruit mottle mosaic virus Tobamovirus maculafructi, cucumber mottle virus Tobamovirus cucumeris, sweet pepper mild mottle virus Tobamovirus paprikae and rehmannia mosaic virus Tobamovirus rehmanniae.

5. The method for detecting tobacco mosaic virus based on RT-RAA-LFD according to claim 3, characterized in that: In step S1, the volume of the reaction system for RT-RAA reverse transcriptase recombinase isothermal amplification is 50 μL. Each reaction system contains 2 μL of a nucleic acid solution of a test sample as a template, 29.4 μL of a hydration buffer solution containing RAA reaction dry powder, 2.5 μL of a magnesium acetate solution, 20 pmol of Tobamo-RAA-F, 20 pmol of Tobamo-RAA-R, and 12.1 μL of ddH2O.

6. The method for detecting tobacco mosaic virus based on RT-RAA-LFD according to claim 5, characterized in that: In step S2, the conditions for the isothermal amplification of the RT-RAA reverse transcriptase recombinase are: constant temperature incubation at 37° C. to 42° C. for 20 to 30 minutes.

7. The method for detecting tobacco mosaic virus based on RT-RAA-LFD according to claim 6, characterized in that: In step S2, the conditions for the isothermal amplification of the RT-RAA reverse transcriptase recombinase are: constant temperature incubation at 42° C. for 20 min.

8. The method for detecting tobacco mosaic virus based on RT-RAA-LFD according to claim 5, characterized in that: The detection limit of the tobacco mosaic virus detection method based on RT-RAA-LFD for tobacco mosaic virus nucleic acid is 50 ag / μL.

9. The method for detecting tobacco mosaic virus based on RT-RAA-LFD according to claim 8, characterized in that: In step S2, when the amplification product is diluted, the dilution factor is 200 times; when the diluted amplification product is dropped onto the sample conjugation pad, the drop volume is 50 μL.

10. Application of a tobacco mosaic virus detection kit, characterized in that: The application is to use the RT-RAA-LFD-based tobacco mosaic virus detection kit according to claim 1 for any of the following: a) identifying whether a plant sample to be tested contains a tobacco mosaic virus; b) identifying whether the virus to be tested is a virus of the genus Tobacco mosaic virus; c) Identification of tobacco mosaic virus.

Images