Filamentous fungal strains comprising protein productivity enhancing phenotypes and methods thereof

Abstract

The present disclosure relates generally to genetically modified filamentous fungal strains (cells) and their use in the production of proteins of interest. Certain embodiments provide, inter alia, methods and compositions for designing and constructing genetically modified filamentous fungal cells (strains), recombining (modified) filamentous fungal cells (strains) comprising protein productivity enhancing phenotypes, these protein productivity enhancing phenotypes include, but are not limited to, improved volumetric efficiency, higher specific productivity, improved carbon source yield, increased bioreactor operating temperature (e.g., mitigating / reducing bioreactor cooling requirements and reducing operating costs), and the like; methods and compositions, among other things, for culturing / fermenting filamentous fungal strains at an increased temperature range to produce proteins of interest.

Description

Technical Field

[0001] The present disclosure relates generally to the fields of biology, molecular biology, filamentous fungi, yeast, fermentation, genetics, industrial protein production, etc. More particularly, the strains and methods of the present disclosure relate to genetic modifications in filamentous fungi that result in phenotypically altered variant (modified) strains, wherein such modified strains are particularly suitable for growth in submerged culture (e.g., for large-scale production of proteins for industrial / commercial applications).

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 383,320, filed on November 11, 2022, which is incorporated herein by reference in its entirety.

[0004] References to sequence listings

[0005] The electronically submitted content of the text file sequence listing named "NB41704-WO-PCT_SequenceListing.xml", created on October 4, 2023, and 32KB in size, is hereby incorporated by reference in its entirety. Background Art

[0006] Filamentous fungi (e.g., Aspergillus species, Penicillium species, Talaromyces species, Fusarium species, Myceliophthora species, Neurospora species, Candida species, Trichoderma species, etc.) are capable of expressing high levels of native and heterologous proteins, making them highly suitable for large-scale production of proteins (e.g., enzymes, antibodies, peptides, etc.) and / or metabolites for industrial and / or commercial applications, such as pharmaceutical applications, animal health applications, food applications, beverage applications, laundry and textile applications, etc. Filamentous fungi are typically grown in submerged mycelial cultures in bioreactors that are regulated to introduce and distribute oxygen and nutrients into the culture medium (i.e., culture broth). For example, the filamentous fungus Trichoderma reesei (or T. reesei; the asexual form of the fungus Hypocrea jecorina) is known to be an efficient producer of cellulases.

[0007] Therefore, filamentous fungi are utilized because of their ability to produce proteins (e.g., enzymes), which are valuable in the production of commodities such as cellulose (derived) ethanol, textile processed products, grain processed products, detergents, fiber / pulp / paper, food additives, feed additives, etc. For example, recombinant gene expression in such fungal host strains is a common method for producing proteins (i.e., for industrial and commercial purposes), and therefore, protein productivity improvements in fungal host strains are an important economic factor in protein production costs. Therefore, as will be appreciated by those skilled in the art, such novel compositions and methods for improving protein production in filamentous fungal strains have important commercial significance. Summary of the Invention

[0008] As set forth and described herein, the present disclosure generally relates to genetically modified filamentous fungi strains (cells) and their uses in producing target proteins. In certain embodiments, the present disclosure particularly provides methods and compositions for designing and constructing genetically modified filamentous fungi cells (strains) comprising protein productivity-enhancing phenotypes, recombinant (modified) filamentous fungi cells (strains), which include but are not limited to improved volumetric efficiency, higher specific productivity, improved carbon source yield, increased bioreactor operating temperature (e.g., mitigating / reducing bioreactor cooling requirements and reducing operating costs), etc.; methods and compositions for cultivating / fermenting filamentous fungi strains to produce target proteins under increased temperature ranges; etc.

[0009] Certain embodiments of the present disclosure relate to variant / mutant / recombinant (modified) strains of filamentous fungi derived from or obtained from a parent or control strain comprising a gene encoding a native SPT5 protein. More particularly, certain aspects relate to variant filamentous fungal cells derived from or obtained from a parent filamentous fungal cell comprising a gene encoding a native SPT5 protein, wherein the variant cells comprise a genetic modification that renders the cells defective in the production of the native SPT5 protein. In certain other aspects, such variant cells comprise an increased protein productivity phenotype relative to the control or parent cells when cultured under the same conditions. In related aspects, the SPT5 gene is at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1. In certain other aspects, the native SPT5 protein encoded by the SPT5 gene is at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2.

[0010] In one or more other embodiments or aspects of the present disclosure, the native SPT5 protein comprises at least one domain selected from the group consisting of: an SPT5 N-terminal domain (NTD) having at least 80% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain having at least 80% identity to SEQ ID NO: 6, and an SPT5 C-terminal domain (CTD) having at least 80% identity to SEQ ID NO: 7. In certain other embodiments, the protein productivity-enhancing phenotype is selected from the group consisting of: increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity. In related embodiments, the variant cells of the present disclosure comprise an increased protein productivity phenotype relative to the parent cell when cultured under the same conditions at a temperature between about 25° C. and 29° C.

[0011] In one or more other embodiments or aspects, the cell of the present disclosure comprises an expression cassette for an introduced heterologous protein of interest (POI). In one or more other embodiments or aspects, the cell of the present disclosure expresses / produces one or more lignocellulose degrading enzymes. In certain embodiments, the one or more lignocellulose degrading enzymes expressed / produced are expressed by endogenous genes encoding the one or more lignocellulose degrading enzymes. In other embodiments, the one or more lignocellulose degrading enzymes are expressed by an introduced (heterologous) expression cassette.

[0012] Certain other one or more embodiments or aspects of the present disclosure provide, inter alia, methods for producing increased amounts of lignocellulose degrading enzymes in modified filamentous fungal cells. In certain embodiments, such methods include obtaining a parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein. In one or more related embodiments or aspects, one or more parent filamentous fungal cells having an SPT5 gene encoding a native SPT5 protein are genetically modified, wherein the genetic modification renders the modified cells obtained therefrom defective in the production of the native SPT5 protein. In certain other one or more related embodiments or aspects, such methods include fermenting / culturing the modified cells under suitable conditions to produce lignocellulose degrading enzymes, wherein the amount of lignocellulose degrading enzymes produced by the modified cells is increased relative to the parent cells when fermented / cultured under the same conditions at a temperature between about 25°C and 29°C.

[0013] Certain other one or more embodiments or aspects of the present disclosure provide, inter alia, methods for producing increased amounts of heterologous proteins of interest in modified filamentous fungal cells. In certain embodiments, such methods include obtaining a parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein and producing one or more heterologous proteins of interest. In certain other embodiments, such methods include obtaining a parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein and introducing one or more expression cassettes encoding one or more (heterologous) proteins of interest into the parent cell. In one or more other embodiments or aspects, the parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein is genetically modified, wherein the genetic modification renders the modified cell obtained therefrom deficient in the production of the native SPT5 protein. In certain other one or more related embodiments or aspects, such methods include fermenting / culturing the modified cell under suitable conditions to produce one or more heterologous proteins of interest, wherein the amount of the one or more heterologous proteins of interest produced by the modified cell is increased relative to the parent cell when fermented / cultured under the same conditions at a temperature between about 25°C and 29°C.

[0014] In certain embodiments of the methods and / or compositions of the present disclosure, the modified filamentous fungal cell defective in the expression / production of a native SPT5 protein comprises an increased protein productivity phenotype, particularly when fermented at an elevated fermentation temperature, wherein the increased protein productivity phenotype includes increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity. For example, in certain embodiments, the modified filamentous fungal cell defective in the expression / production of a native SPT5 protein comprises an increased total protein productivity phenotype when fermented at an elevated temperature. In certain related embodiments, the total protein productivity of the modified filamentous fungal cell defective in the expression / production of a native SPT5 protein is increased by at least 1% relative to the parent or control cell when fermented at an elevated fermentation temperature under the same conditions. In certain aspects, the elevated fermentation temperature is at least about 28.05°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, 29°C, 29.1°C, 29.2°C, 29.3°C, 29.4°C, 29.5°C, 29.6°C, 29.7°C, 29.8°C, 29.9°C or 30°C.

[0015] Biological sequence description

[0016] SEQ ID NO: 1 is the Trichoderma reesei polynucleotide (DNA) sequence encoding the native SPT5 protein of SEQ ID NO: 2.

[0017] SEQ ID NO: 2 is the amino acid sequence of the native (full-length) SPT5 protein encoded by SEQ ID NO: 1.

[0018] SEQ ID NO: 3 is the open reading frame (ORF) sequence encoding the native (full-length) SPT5 protein of SEQ ID NO: 2.

[0019] SEQ ID NO: 4 is the amino acid sequence of a C-terminally truncated SPT5 variant protein.

[0020] SEQ ID NO: 5 is the amino acid sequence of the SPT5 N-terminal domain (NTD).

[0021] SEQ ID NO: 6 is the amino acid sequence of the NusG superfamily (NGN) domain.

[0022] SEQ ID NO: 7 is the amino acid sequence of the SPT5 C-terminal domain (CTD).

[0023] SEQ ID NO: 8 is the artificial RNA target site (TS) sequence designated “CLsgRNA58”.

[0024] SEQ ID NO: 9 is an artificial DNA sequence designated "AL950".

[0025] SEQ ID NO: 10 is an artificial DNA sequence designated "AL952".

[0026] SEQ ID NO: 11 is an artificial DNA sequence designated "CL2350".

[0027] SEQ ID NO: 12 is an artificial DNA sequence designated "CL2351".

[0028] SEQ ID NO: 13 is a Trichoderma reesei DNA sequence encoding a native GEF1 protein comprising SEQ ID NO: 14.

[0029] SEQ ID NO: 14 is the amino acid sequence of the native (full-length) GEF1 protein encoded by SEQ ID NO: 13.

[0030] SEQ ID NO: 15 is a member of the family GEF1 REST "Artificial RNA target site (TS) sequence.

[0031] SEQ ID NO: 16 is an artificial DNA sequence designated "CLN2514".

[0032] SEQ ID NO: 17 is an artificial DNA sequence designated "CLN2517". BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The native SPT5 protein (SEQ ID NO: 2; Figure 1 A) and C-terminally truncated mutant SPT5 protein (SEQ ID NO: 4; Figure 1 B) amino acid sequence. Figure 1 As shown, the native (full-length) SPT5 protein contains 1,057 amino acid residues ( Figure 1 A), while the C-terminally truncated mutant protein contains 929 amino acid residues ( Figure 1 B), where the last 128 C-terminal amino acid residues of the native SPT5 protein ( Figure 1 A, Underlined residues ) in mutant SPT5 protein ( Figure 1 B) is missing.

[0034] Figure 2 The amino acid sequence of the native Trichoderma species SPT5 protein is presented ( Figure 2A; SEQ ID NO: 2), showing the SPT5 N-terminal domain (NTD; SEQ ID NO: 5, grey shaded residues), the SPT5 NusG (NGN) domain (SEQ ID NO: 6, underlined residues), and the STP5 C-terminal domain (CTD; SEQ ID NO: 7, bold residues). Figure 1 As shown in A, the C-terminal truncation of the variant SPT5 protein (SEQ ID NO: 4) occurs near the C-terminus of the SPT5 domain, as indicated by the double-underlined serine (S) residue. Again, for clarity, Figure 2 B presents the amino acid sequences of the N-terminal domain (NTD; SEQ ID NO: 5), NusG (NGN) domain (SEQ ID NO: 6), and C-terminal domain (CTD; SEQ ID NO: 7) of the native Trichoderma SPT5 protein. DETAILED DESCRIPTION

[0035] As set forth and described herein, the present disclosure generally relates to genetically modified filamentous fungi strains (cells) and their uses in producing target proteins. More particularly, bacterial strains and methods of the present disclosure relate to genetic modifications in filamentous fungi, which genetically modify the variant strains that produce phenotype changes, wherein such variant strains are particularly suitable for growing in deep cultures (e.g., for large-scale production of proteins for industrial / commercial applications). As described below and illustrated, some embodiments of the present disclosure especially provide for designing and constructing genetically modified filamentous fungi cells (strains) comprising protein productivity-enhancing phenotypes (including but not limited to improved volumetric efficiency, higher specific productivity, improved carbon source yield, reduced bioreactor (fermenter) operating costs), methods and compositions of modified filamentous fungi cells; methods and compositions for cultivating / fermenting filamentous fungi strains to produce target proteins under increased temperature ranges; etc.

[0036] I. Definition

[0037] Before describing bacterial strain and method of the present invention in detail, define following term for the sake of clarity.Undefined term should conform to the conventional meaning used in related art.Unless defined otherwise, all technical and scientific terms used herein all have the identical implication that is usually understood by those of ordinary skill in the field of the present composition and method application.

[0038] All publications and patents cited in this specification are incorporated herein by reference.

[0039] Where a range of values is provided, it is understood that each intermediate value is to the tenth of a unit (unless the context clearly indicates otherwise) to the lower limit, and any other stated or intermediate values between the upper and lower limits of the range and within the stated range are encompassed within the compositions and methods of the present invention. These upper and lower limits of smaller ranges may be independently included within smaller ranges and are also encompassed within the compositions and methods of the present invention, subject to any particular exclusions in the stated ranges. Where a stated range includes one or both limits, ranges excluding either or both of those included limits are also encompassed within the compositions and methods of the present invention.

[0040] Certain ranges are provided herein where a numerical value is preceded by the term "about". The term "about" is used herein to provide literal support for the exact number that it follows, as well as a number that is close to or approximately the number that follows the term. In determining whether a number is close to or approximately a specifically recited number, the close or approximate unrecited number may be a number that, in the context in which it is presented, provides a substantial equivalent to the specifically recited number. For example, with respect to a numerical value, the term "about" means that the numerical value is approximately the same as the numerical value. - 10% to + In another example, the phrase "a pH of about 6" refers to a pH of from 5.4 to 6.6, unless the pH is otherwise specifically defined.

[0041] The headings provided herein are not limitations of the various aspects or embodiments of the compositions and methods of the invention that can be obtained by reference to the specification as a whole. Therefore, the terms defined below are more fully defined when the specification is taken as a whole.

[0042] In accordance with this embodiment, the following abbreviations and definitions apply. It should be noted that the singular forms "a / an" and "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to "an enzyme" includes a plurality of such enzymes, and reference to "a dose" includes reference to one or more doses and equivalents thereof known to those skilled in the art, etc.

[0043] It is further noted that the claims may be drafted to exclude any optional element. Accordingly, this statement is intended to serve as an antecedent basis for use of exclusive terminology such as "solely," "only," "exclusively," "not including," and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0044] It should be further noted that, as used herein, the term "comprising" means "including but not limited to" the one or more components following the term "comprising." The components following the term "comprising" are required or mandatory, but a composition comprising one or more components may also include other non-mandatory or optional components.

[0045] It is also noted that, as used herein, the term “consisting of is meant to include and be limited to the component or components following the term “consisting of.” Thus, the components following the term “consisting of” are required or mandatory, and no other components may be present in the composition.

[0046] As will be apparent to those skilled in the art after reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated or combined with the features of any of the other several embodiments without departing from the scope or spirit of the inventive compositions and methods described herein. Any recited method may be carried out in the order of events recited or in any other order that is logically possible.

[0047] As used herein, the terms "wild-type" and "native" are used interchangeably and refer to a gene, protein, fungal cell or strain as found in nature.

[0048] As used herein, the terms "recombinant" or "non-natural" refer to organisms, microorganisms, cells, nucleic acid molecules, or vectors that have at least one engineered genetic alteration or have been modified by the introduction of a heterologous nucleic acid molecule, or to cells (e.g., microbial cells) that have been altered so that the expression of heterologous or endogenous nucleic acid molecules or genes can be controlled. Recombinant also refers to cells that are derived from non-natural cells, or are the offspring of non-natural cells that have one or more such modifications. Genetic alterations include, for example, modifications that introduce expressible nucleic acid molecules encoding proteins, or additions, deletions, substitutions, or other functional changes to other nucleic acid molecules of the cell's genetic material. For example, recombinant cells can express genes or other nucleic acid molecules that are not found in the same or homologous form in natural (wild-type) cells, or can provide altered endogenous gene expression patterns, such as overexpression, underexpression, minimal expression, or no expression at all.

[0049] "Recombination," "recombining," or the production of a "recombined" nucleic acid is generally the assembly of two or more nucleic acid fragments, wherein the assembly results in a chimeric gene.

[0050] As used herein, the term "gene" is synonymous with the term "allele" and refers to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are typically haploid, so a single copy of a given gene (i.e., a single allele) is sufficient to confer a given phenotype.

[0051] As used herein, the term "gene" means a segment of DNA involved in producing a polypeptide (protein) chain, which may or may not include regions preceding and following the coding region (e.g., 5' untranslated region (5'UTR) or "leader" sequence, 3'UTR or "tail" sequence, promoter sequence, terminator sequence, etc.), as well as intervening sequences (introns) between individual coding segments (exons). For example, a gene (DNA) sequence of interest (GOI) may encode a regulatory protein, a structural protein, a commercially important industrial protein or peptide (e.g., an enzyme (e.g., protease, mannanase, xylanase, amylase, glucoamylase, cellulase, oxidase, phytase, lipase)), etc. The gene of interest may be a naturally occurring gene, a mutated (modified) gene, or a synthetic gene.

[0052] As used herein, the term "promoter" refers to a nucleic acid sequence for directing transcription of a downstream gene or its open reading frame (ORF). Conventionally, a promoter will be suitable for a host cell (e.g., a filamentous fungal cell) expressing a target gene. Promoters, together with other transcriptional and translational regulatory nucleic acid sequences (also referred to as "control sequences"), are necessary for expressing a given gene. Generally speaking, transcriptional and translational regulatory sequences include, but are not limited to, promoter and terminator sequences, including core promoters and enhancers or activators or repressor sequences, transcriptional and translational initiation and termination sequences. In certain embodiments, the promoter is an inducible promoter or a constitutive promoter. In certain embodiments, the inducible promoter is an inducible cellulase gene promoter.

[0053] As used herein, the term "promoter activity" is the ability of a nucleic acid to direct transcription of a downstream (3') polynucleotide in a host cell. To test promoter activity, a (promoter) nucleic acid can be operably linked to a downstream polynucleotide to produce a recombinant nucleic acid. The recombinant nucleic acid can be introduced into a cell, and transcription of the polynucleotide can be evaluated. In some cases, the polynucleotide can encode a protein, and transcription of the polynucleotide can be evaluated by assessing the production of the protein in the cell.

[0054] As used herein, the term "operably connected" refers to a functional connection between two or more nucleic acid sequences. Therefore, when a nucleic acid sequence is placed in a functional relationship with another nucleic acid sequence, the nucleic acid sequence is "operably connected" to another nucleic acid sequence. For example, if a promoter sequence or a terminator sequence affects the transcription of a coding sequence, the promoter sequence or the terminator sequence is operably connected to the coding sequence; if a ribosome binding site is positioned to promote translation, the ribosome binding site is operably connected to the coding sequence; if a nucleic acid sequence encoding a secretory leader sequence (i.e., a signal peptide) is expressed as a preprotein that participates in polypeptide secretion, the nucleic acid sequence encoding a secretory leader sequence (i.e., a signal peptide) is operably connected to a nucleic acid sequence (e.g., ORF) encoding a polypeptide. Generally, "operably connected" means that the connected DNA (nucleic acid) sequence is continuous, and in the case of a secretory leader sequence, is continuous and in the reading phase. However, enhancers do not have to be continuous. Connecting two or more nucleic acid sequences (i.e., operably connected) is accomplished using any method of those skilled in the art.

[0055] As used herein, a "functional gene" is a gene that can be used by cellular components to produce an active gene product (typically a protein). In contrast, a "non-functional gene" cannot be used by cellular components to produce an active gene product (i.e., a functional protein), or has a reduced ability to be used by cellular components to produce an active gene product (i.e., a functional protein).

[0056] As used herein, a "functional protein" is a protein that has a function or activity (e.g., enzymatic function / activity, binding function / activity (e.g., DNA binding), surface active properties, etc.) and has not been mutagenized, truncated, or otherwise modified to eliminate or reduce that function / activity.

[0057] As used herein, the term "gene" is synonymous with the term "allele" and refers to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are typically haploid, so a single copy of a given gene (i.e., a single allele) is sufficient to confer a given phenotype.

[0058] As used herein, the terms "wild-type" and "native" are used interchangeably and refer to a gene, protein, fungal cell or strain as found in nature.

[0059] As used herein, the phrases "one or more modified filamentous fungal cells," "one or more mutant filamentous fungal cells," "one or more variant filamentous fungal cells," "one or more recombinant fungal cells," "one or more modified filamentous fungal strains," and the like are used interchangeably and refer to filamentous fungal cells that are derived from (obtained from) a control or parental filamentous fungal cell belonging to the subphylum Pezizomycotina. For example, a "modified" filamentous fungal cell can be derived from (obtained from) a control or parental filamentous fungal cell, wherein the modified cell comprises at least one genetic modification that is not found in the control or parental cell.

[0060] As used herein, the term "ascomycete fungal cell" refers to any organism in the phylum Ascomycota in the kingdom Fungi. Examples of ascomycete fungal cells include, but are not limited to, filamentous fungi of the subphylum Pezizomycotina, such as Trichoderma species, Aspergillus species, Myceliophthora species, and Penicillium species.

[0061] As used herein, term " filamentous fungi " refers to all filamentous forms of Eumycota and Oomycota.For example, filamentous fungi include but are not limited to Acremonium (Acremonium), Aspergillus, Emericella (Emericella), Fusarium, Humicola (Humicola), Mucor (Mucor), Myceliophthora, Neurospora, Penicillium, Scytalidium (Scytalidium), Thielavia (Thielavia), Tolypocladium (Tolypocladium) and Trichoderma species.In certain embodiments, filamentous fungi can be Aspergillus aculeatus (Aspergillus aculeatus), Aspergillus awamori (Aspergillus awamori), Aspergillus foetidus (Aspergillus foetidus), Aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans (Aspergillus nidulans), Aspergillus niger (Aspergillus niger) or Aspergillus oryzae (Aspergillus oryzae).

[0062] In some embodiments, the filamentous fungus is a Fusarium species, such as Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum), Fusarium trichothecioides, Fusarium venenatum, etc. In other embodiments, the filamentous fungus is Humicola insolens, Humicola lanuginosa, Mucormiehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, Thielavia terrestris, etc. In certain other embodiments, the filamentous fungus is Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma viride, etc.

[0063] As used herein, exemplary parent Trichoderma reesei strains include, but are not limited to, Trichoderma reesei strain QM6a (ATCC Accession No. 13631), Trichoderma reesei strain RL-P37 (NRRL Accession No. 15709), and Trichoderma reesei strain RUT-C30 (ATCC Accession No. 56765); exemplary parent Aspergillus niger strains include, but are not limited to, the Aspergillus niger strain designated as ATCC Accession No. 1015; exemplary parent Aspergillus oryzae strains include, but are not limited to, Aspergillus oryzae strain RIB40 (ATCC Accession No. 42149); and exemplary parent Myceliophthora thermophila strains include, but are not limited to, the Myceliophthora thermophila strain designated as ATCC Accession No. 42464.

[0064] For example, Trichoderma strains RUT-C30 and RL-P37 are mutagenized (cellulase-high-producing) derivatives of Trichoderma natural isolate QM6a (Sheir-Neiss and Montenecourt, 1984), of which strain NG14 is the final common parent strain. In certain aspects, suitable Trichoderma strains can be derived from / obtained from a Trichoderma reesei strain comprising a deletion of the Trichoderma reesei pyr2 gene (Δpyr2), as generally described in Sheir-Neiss and Montenecourt (1984) and PCT Publication No. WO2011 / 153449, specifically incorporated herein by reference in its entirety.

[0065] In certain other aspects, exemplary Trichoderma strains are presented and described in Table 1.

[0066] Table 1 Description of strains

[0067]

[0068]

[0069] As used herein, the Trichoderma reesei parent strain designated "T4" is a cellulase-producing strain derived from Trichoderma reesei strain RL-P37, as generally described in PCT Publication No. WO 2021 / 092356 (specifically incorporated herein by reference in its entirety).

[0070] As used herein, a parent (control) strain of Trichoderma reesei designated "T4-GEF1" was serially passaged under selective conditions to identify and isolate strains capable of high temperature protein production without adversely affecting specific productivity (Q p) mutant strains. For example, PCT Publication No. WO 2021 / 092356 generally describes the serial passage of a Trichoderma "T4" strain under selective conditions to identify and isolate mutant T4 strains capable of producing high-temperature (HT) proteins relative to the parent (control) T4 strain. As described in this publication, a mutant strain capable of producing HT proteins relative to the parent T4 strain was identified, wherein the mutated gene encodes a truncated protein named "GEF1," and the strain was designated T4-GEF1.

[0071] As used herein, a mutant Trichoderma strain designated "T4-26rc" (derived from the control strain T4-GEF1) was identified and isolated at a selective temperature wherein the specific productivity (Q) of the mutant Trichoderma strain when cultured at 29°C was significantly improved relative to that of the control T4-GEF1 strain cultured at 28°C. p ), the T4-26rc mutant has a similar Q p .

[0072] As used herein, the variant Trichoderma strain designated "SPT5 t-BBW51" is derived from a T4-GEF1 control strain and contains a single nucleotide polymorphism (SNP; G→A) in the SPT5 coding sequence (CDS) resulting in a C-terminal truncation (W930*) of the SPT5 protein.

[0073] As used herein, the parent strain of Trichoderma reesei designated "t-BAL50" contains an introduced single copy cellulase expression cassette integrated into the genome, wherein the cellulase cassette encodes a cellobiohydrolase 1 (Cbh1) protein, a cellobiohydrolase 2 (Cbh2), an endoglucanase 1 (Eg1) protein, and an endoglucanase 2 (Eg2) protein.

[0074] As used herein, a mutant Trichoderma strain designated "t-BDA85" is derived from the t-BAL50 strain and contains a SNP (G to A) in the SPT5 gene coding sequence (CDS) resulting in a C-terminal truncation (W930*) of the native SPT5 protein at amino acid positions 930 to 1,057, e.g. Figure 1 B (SEQ ID NO: 4).

[0075] As used herein, a mutant Trichoderma strain designated "t-BDA88" is derived from the t-BAL50 strain and comprises the pyr2 selectable marker gene inserted at nucleotide position 3,183 of the SPT5 gene CDS, thereby disrupting the SPT5 CDS and producing a truncated SPT5 protein.

[0076] As used herein, the mutant Trichoderma strain designated "t-BEX65" is generated by restoring the disrupted GEF1 gene to the restored wild-type GEF1 gene (WT GEF1).REST ) and was derived from the t-BDA85 strain.

[0077] As used herein, the terms "polypeptide" and "protein" (and / or their respective plural forms) are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds. Conventional one-letter or three-letter codes for amino acid residues are used herein. The polymer can be linear or branched, it can contain modified amino acids, and it can be interrupted by non-amino acids. These terms also encompass amino acid polymers that are modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more amino acid analogs (including, for example, non-natural amino acids, etc.), as well as other modifications known in the art.

[0078] As used herein, the term "derivative polypeptide / protein" refers to a protein that is derived or derivatizable by adding one or more amino acids to one or both of the N-terminus and the C-terminus, substituting one or more amino acids at one or more different sites in the amino acid sequence, deleting one or more amino acids at one or both ends of the protein or at one or more sites in the amino acid sequence, and / or inserting one or more amino acids at one or more sites in the amino acid sequence. Protein derivatives can be prepared by modifying the DNA sequence encoding the native protein, transforming the DNA sequence into a suitable host, and expressing the modified DNA sequence to form a derivative protein.

[0079] Related (and derivative) proteins include " variant proteins ". Variant proteins are different from reference / parent proteins (for example, wild-type proteins) by replacement, deletion and / or insertion at a small amount of amino acid residues. The number of different amino acid residues between variant and parent protein can be one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more amino acid residues. Variant proteins can have at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or even at least about 99% or more amino acid sequence identity with reference protein. Variant proteins can also be different from reference protein in aspects such as the motif, domain, epitope, conserved region selected.

[0080] As used herein, the term "similar sequence" refers to a sequence in a protein that provides a function, tertiary structure and / or conserved residues similar to that of a protein of interest (i.e., typically the original protein of interest). For example, in an epitope region containing an α-helix or β-pleated sheet structure, the replacement amino acid in the similar sequence preferably maintains the same specific structure. The term also refers to a nucleotide sequence as well as an amino acid sequence. In some embodiments, similar sequences are developed so that the replacement of amino acids produces variant enzymes that display similar or improved functions. In some embodiments, the tertiary structure and / or conserved residues of amino acids in the protein of interest are located at or near the target segment or fragment. Therefore, when the target segment or fragment contains, for example, an α-helix or β-pleated sheet structure, the replacement amino acid preferably maintains the specific structure.

[0081] As used herein, the term "homologous protein" refers to a protein that has similar activity and / or structure to a reference protein. This is not intended to imply that homologs are necessarily evolutionarily related. Thus, it is intended to indicate that the term encompasses one or more proteins that are identical, similar, or corresponding (i.e., in terms of structure and function) obtained from different organisms. In some embodiments, it is desirable to identify homologs that have similar quaternary, tertiary, and / or primary structure to a reference protein.

[0082] The degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al., 1984). For the purposes of this disclosure, the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970) as implemented in the Needle program of the EMBOSS package (Rice et al., 2000) (preferably version 3.0.0 or later). The optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.

[0083] The output of Needle labeled "Longest Identity" (obtained using the non-reduction option) was used as the percent identity and was calculated as follows:

[0084] (number of identical residues × 100) / (length of alignment - total number of gaps in the alignment)

[0085] As used herein, in the context of at least two nucleic acids or polypeptides, the phrases "substantially similar" and "substantially identical" typically mean that the polynucleotides or polypeptides comprise sequences that are at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or even at least about 99% identical, or higher, compared to a reference (i.e., wild-type) sequence. Sequence identity can be determined using known programs such as BLAST, ALIGN, and CLUSTAL using standard parameters. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. In addition, FASTA databases can be searched. One indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, e.g., where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of moderate to high stringency).

[0086] In certain embodiments, filamentous fungal cells for manipulation, construction, and use as described herein are generally from the subdivision Pezizomycotina, particularly fungi having a vegetative hyphal state and comprising an SPT5 gene or a homolog thereof.

[0087] As used herein, a "gene or polynucleotide encoding a native SPT5 protein" has sequence homology to SEQ ID NO: 1. In certain embodiments, the gene or polynucleotide encoding a native SPT5 protein has at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3. In certain aspects, the gene or polynucleotide encoding a native SPT5 protein has at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3 and encodes one or more protein domains selected from the group consisting of an SPT5 N-terminal domain (SPT5 NTD), a NusG superfamily N-terminal domain (NGN), and an SPT5 C-terminal domain (SPT5 CTD). In certain other embodiments, the gene or polynucleotide encoding a native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.

[0088] As used herein, an "open reading frame (ORF) nucleic acid sequence encoding a native SPT5 protein" has sequence homology to the ORF sequence of SEQ ID NO: 3. In certain other embodiments, the SPT5 encoded by the ORF nucleic acid sequence (encoding a native SPT5 protein) has at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to the native SPT5 protein of SEQ ID NO: 2. In certain other embodiments, the ORF encoding a native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.

[0089] As used herein, the phrases "lignocellulose degrading enzyme," "cellulase enzyme," and "cellulase" are used interchangeably and include glycoside hydrolases (GHs), such as cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases, which hydrolyze the glycosidic bonds of cellulose (hemicellulose) to produce sugars (e.g., glucose, xylose, arabinose, etc.).

[0090] As used herein, "endoglucanase" protein can be abbreviated as "EG", "cellobiohydrolase" protein can be abbreviated as "CBH", "β-glucosidase" protein can be abbreviated as "BG", and "xylanase" protein can be abbreviated as "XYL". Therefore, as used herein, the gene (or ORF) encoding the EG protein can be abbreviated as "eg", the gene (or ORF) encoding the CBH protein can be abbreviated as "cbh", the gene (or ORF) encoding the BG protein can be abbreviated as "bg", and the gene (or ORF) encoding the XYL protein can be abbreviated as "xyl". In certain embodiments, the cellobiohydrolase includes an enzyme classified under Enzyme Commission Number (EC 3.2.1.91), the endoglucanase includes an enzyme classified under EC 3.2.1.4, the endo-β-1,4-xylanase includes an enzyme classified under EC 3.2.1.8, the β-xylosidase includes an enzyme classified under EC 3.2.1.37, and the β-glucosidase includes an enzyme classified under EC 3.2.1.21.

[0091] As used herein, "cellulase gene promoter" includes but is not limited to cellobiohydrolase (cbh) gene promoter sequence, endoglucanase (eg) gene promoter sequence, β-glucosidase (bg) gene promoter sequence, xylanase (xyl) gene promoter sequence, etc.

[0092] As used herein, "nucleic acid" refers to nucleotide or polynucleotide sequences and fragments or portions thereof, as well as DNA, cDNA and RNA of genomic or synthetic origin, which may be double-stranded or single-stranded, whether representing the sense or antisense strand.

[0093] As used herein, the term "expression" refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid molecules of the present disclosure. Expression can also refer to the translation of mRNA into a polypeptide. Thus, the term "expression" includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, secretion, and the like.

[0094] As used herein, the combined terms "expression / production," as used in phrases such as "the variant strain of the filamentous fungal cell expresses / produces an 'increased' amount of a protein of interest (POI)" (i.e., relative to the parental / control cells), are intended to include any steps involved in expressing and producing the protein in the filamentous fungal strains of the present disclosure.

[0095] In certain embodiments, a gene, polynucleotide, or nucleic acid sequence encoding a native SPT5 protein comprising "sequence homology" refers to a DNA or RNA (nucleic acid) sequence that has minimal sequence differences from the corresponding nucleic acid sequence (when compared to the sequence) and retains substantially the same biological function as the corresponding nucleic acid sequence (when compared to the sequence). For example, in certain embodiments, a nucleic acid sequence having substantial sequence homology to a gene, polynucleotide, or nucleic acid encoding a native SPT5 protein is assessed by identifying the encoded gene product (native SPT5 protein) as described herein.

[0096] In certain other embodiments, nucleic acid hybridization methods are used to determine / identify genes, polynucleotides, or nucleic acid sequences that have sequence homology with genes, polynucleotides, or nucleic acids encoding native SPT5 proteins. For example, in certain embodiments, DNA / RNA sequences that have substantial sequence homology with genes encoding native SPT5 proteins (e.g., SEQ ID NO: 2) are identified by the ability of such DNA / RNA sequences to hybridize under stringent conditions to designated nucleic acid sequences of the present disclosure.

[0097] As used herein, "hybridization under stringent conditions" is intended to describe the conditions for hybridization and washing, under which nucleotide sequences that are significantly identical or homologous to each other remain hybridized to each other. Such stringent conditions are well known to those skilled in the art (see, for example, Ausubel et al., 1995; Sambrook et al., 1989). For example, in certain embodiments, non-limiting examples of stringent hybridization conditions include hybridization in 4X sodium chloride / sodium citrate (SSC) at about 65°C-70°C (or hybridization in 4×SSC plus 50% formamide at about 42°C-50°C), followed by washing with 1×SSC at about 65°C-70°C one or more times. Similarly, non-limiting examples of highly stringent hybridization conditions include hybridization in 1×SSC at about 65°C-70°C (or hybridization in 4×SSC plus 50% formamide at about 42°C-50°C), followed by washing with 0.3×SSC at about 65°C-70°C one or more times.

[0098] Certain embodiments of the present disclosure relate to modified strains of filamentous fungal cells comprising a genetic modification of a gene encoding a native SPT5 protein. Thus, certain aspects relate to variant / mutant / recombinant (genetically modified) strains of filamentous fungi derived from or obtained from a parent or control strain comprising a gene encoding a native SPT5 protein. More particularly, certain aspects relate to variant filamentous fungal cells derived from or obtained from a parent or control filamentous fungal cell comprising a gene encoding a native SPT5 protein, wherein the variant cells comprise a genetic modification that renders the cells defective in the expression / production of the native SPT5 protein. In certain other aspects, such variant cells comprise an increased protein productivity phenotype relative to the parent or control cells when cultured under identical conditions. In a related aspect, the SPT5 gene is at least about 50%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO:1. In certain other aspects, the native SPT5 protein encoded by the SPT5 gene has at least about 50%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO:2.

[0099] In one or more other embodiments or aspects of the present disclosure, the native SPT5 protein comprises at least one domain selected from the group consisting of an SPT5 N-terminal domain (NTD) at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 5, a NusG superfamily (NGN) domain at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 6, and a NusG superfamily (NGN) domain at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: NO:7 has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to an SPT5 C-terminal domain (CTD). In certain other embodiments, the protein productivity-enhancing phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity. In a related embodiment, the variant cells of the present disclosure comprise a protein productivity-enhancing phenotype relative to the parent or control cells when cultured under the same conditions at a temperature between about 25°C and 29°C.

[0100] In other related embodiments, the variant cells of the present disclosure comprise an increased protein productivity phenotype relative to a parent or control cell when cultured under the same conditions at a temperature between about 25°C, 26°C, 27°C, 28°C, or 29°C. In other embodiments, the variant cells of the present disclosure comprise an increased protein productivity phenotype relative to a parent or control cell when cultured under the same conditions at a temperature between about 25.0°C, 25.1°C, 25.2°C, 25.3°C, 25.4°C, 25.5°C, 25.6°C, 25.7°C, 25.8°C, 25.9°C, 26.0°C, 26.1°C, 26.2°C, 26.3°C, 26.4°C, 26.5°C, 26.6°C, 26.7°C, 26.8°C, 26.9°C, 27.0°C, 27.1°C, 27.2°C, 27.3°C, 27.4°C, 27.5°C, 27.6°C, 27.7°C, 27.8°C, 27.9°C, 28.0°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, .2°C, 27.3°C, 27.4°C, 27.5°C, 27.6°C, 27.7°C, 27.8°C, 27.9°C, 28.0°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C or 29.0°C, the variant cells of the present disclosure comprise an increased protein productivity phenotype relative to the parental or control cells when cultured at a temperature between

[0101] In one or more other embodiments or aspects, the cell of the present disclosure comprises an expression cassette for an introduced heterologous protein of interest (POI). In one or more other embodiments or aspects, the cell of the present disclosure expresses / produces one or more lignocellulose degrading enzymes. In certain embodiments, the one or more lignocellulose degrading enzymes produced are expressed by endogenous genes encoding the one or more lignocellulose degrading enzymes. In other embodiments, the one or more lignocellulose degrading enzymes produced are expressed by an expression cassette for an introduced (heterologous) protein of interest (POI).

[0102] As used herein, the terms "modification" and "genetic modification" are used interchangeably and include, but are not limited to: (a) introduction, substitution or removal of one or more nucleotides in a gene, or introduction, substitution or removal of one or more nucleotides in a regulatory element required for transcription or translation of a gene, (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) down-regulation of a gene (e.g., antisense RNA, siRNA, miRNA, etc.), (f) specific mutagenesis (including but not limited to CRISPR / Cas9-based mutagenesis) and / or (g) random mutagenesis of any one or more genes disclosed herein.

[0103] As used herein, variant strains of filamentous fungi comprising genetic modifications include, but are not limited to, genetic modifications to genes encoding native SPT5 proteins disclosed herein. Thus, as described in further detail below, various molecular biology methods are well known to those skilled in the art and can be used to generate / construct such variant strains of filamentous fungal cells.

[0104] As used herein, "introduction, substitution or removal of one or more nucleotides in a gene encoding a protein," such genetic modification includes gene coding sequences (ie, exons) and non-coding intervening (intron) sequences.

[0105] As used herein, "disruption of a gene," "gene disruption," "inactivation of a gene," and "gene inactivation" are used interchangeably and broadly refer to any genetic modification that substantially destroys / inactivates a target gene. Exemplary methods of gene disruption include, but are not limited to, complete or partial deletion of any portion of a gene (including a polypeptide coding sequence (CDS), a promoter, an enhancer, or another regulatory element), or mutagenesis thereof, wherein mutagenesis encompasses substitutions, insertions, deletions, inversions, and any combinations and variations thereof, which destroy / inactivate one or more target genes and substantially reduce or prevent expression / production of a functional gene product. In certain embodiments of the present disclosure, such gene disruption prevents host cells from expressing / producing the encoded lov gene product.

[0106] In certain embodiments, genes, polynucleotides, or nucleic acid sequences encoding natural SPT5 proteins are genetically modified using established gene editing technologies, such as CRISPR / Cas9 gene editing, zinc finger nuclease (ZFN) gene editing, transcription activator-like effector nuclease editing (TALEN), homing (large) nuclease editing, and the like.

[0107] In other embodiments, variant strains of filamentous fungi are constructed (ie, genetically modified) by genetic transformation methods.

[0108] In other embodiments, the target protein (e.g., endogenous POI or heterologous POI) expressed / produced by the fungal cells of the present disclosure is detected, identified, measured, determined, etc. by the following methods: protein quantification methods, gene transcription methods, mRNA translation methods, etc., including but not limited to protein migration / mobility (SDS-PAGE), mass spectrometry, HPLC, size exclusion, ultracentrifugation sedimentation velocity analysis, transcriptomics, proteomics, fluorescent tags, epitope tags, fluorescent protein (GFP, RFP, etc.) chimeras / hybrids, etc.

[0109] As used herein, functionally and / or structurally similar proteins are considered to be "related proteins". Such related proteins can be derived from organisms of different genera and / or species, or even organisms of different classes (e.g., bacteria and fungi). Related proteins also encompass homologs and / or orthologs determined by primary sequence analysis, by secondary or tertiary structure analysis, or by immunological cross-reactivity.

[0110] As used herein, the term "promoter" refers to a nucleic acid sequence that can control the expression of a coding sequence or functional RNA. Typically, the coding sequence is located at the 3' (downstream) of the promoter sequence. Promoters can all be derived from natural genes, or composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It will be understood by those skilled in the art that different promoters can direct genes to be expressed in different cell types, or at different developmental stages, or in response to different environments or physiological conditions. Promoters that make genes expressed most of the time in most cell types are generally referred to as "constitutive promoters." It should be further recognized that, in most cases, the exact boundaries of regulatory sequences have not yet been fully defined, so DNA fragments of different lengths can have the same promoter activity.

[0111] As defined herein, the term "introduced," as used in phrases such as "introducing into a fungal cell" at least one polynucleotide open reading frame (ORF) or its gene or its vector, includes methods known in the art for introducing a polynucleotide into a cell, including but not limited to protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection, and the like.

[0112] As used herein, "transformed" or "transformation" means transforming a cell by using recombinant DNA technology. Transformation typically occurs by inserting one or more nucleotide sequences (e.g., polynucleotides, ORFs, or genes) into a cell. The inserted nucleotide sequence can be a heterologous nucleotide sequence (i.e., a sequence that does not naturally occur in the cell to be transformed).

[0113] As used herein, "conversion" refers to the introduction of exogenous DNA into a host cell so that DNA remains as a chromosomal integrant or a self-replicating extrachromosomal vector. As used herein, "transforming DNA," "conversion sequence," and "DNA construct" refer to the DNA for introducing a sequence into a host cell. DNA can be generated in vitro by PCR or any other suitable technology. In certain embodiments, the transforming DNA comprises an input sequence, and in other embodiments, it further comprises an input sequence flanked by a homology box. In further embodiments, the transforming DNA comprises other non-homologous sequences (i.e., stuffing sequence or flank) that are added to the end. The end can be closed so that the transforming DNA forms a closed loop, such as, for example, inserted into a vector.

[0114] As used herein, "input sequence" refers to the DNA sequence introduced into the fungal cell chromosome. In certain embodiments, the input sequence is a part for a DNA construct. In other embodiments, the input sequence encodes one or more target proteins. In certain embodiments, the input sequence comprises a sequence that may or may not be present in the genome of the cell to be transformed (that is, it may be a homologous or heterologous sequence). In certain embodiments, the input sequence encodes one or more target proteins, genes, and / or mutations or modified genes. In alternative embodiments, the input sequence encodes functional wild-type genes or operons, functional mutant genes or operons or non-functional genes or operons. In certain embodiments, the input sequence is a non-functional sequence inserted into a gene to destroy gene function. In another embodiment, the input sequence includes a selective marker. In a further embodiment, the input sequence includes two homology boxes.

[0115] As used herein, "homology box" refers to a nucleic acid sequence homologous to a sequence in a fungal cell chromosome. More particularly, according to the present invention, a homology box is an upstream or downstream region that has a sequence identity of about 80% to 100%, a sequence identity of about 90% to 100%, or a sequence identity of about 95% to 100% to the direct flanking coding region of a gene or a portion of a gene to be deleted, destroyed, inactivated, downregulated, etc. These sequences guide the integration position of the DNA construct in the fungal cell chromosome and guide which part of the fungal cell chromosome is replaced by the input sequence. Although not intended to limit the present disclosure, the homology box can include between about 1 base pair (bp) and 200 kilobases (kb). Preferably, the homology box includes between about 1 bp and 10.0 kb; between 1 bp and 5.0 kb; between 1 bp and 2.5 kb; between 1 bp and 1.0 kb; and between 0.25 kb and 2.5 kb. Homology boxes can also include about 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb, and 0.1 kb. In some embodiments, the 5' and 3' ends of the selectable marker are flanked by homology boxes, wherein the homology boxes comprise nucleic acid sequences that closely flank the coding region of the gene.

[0116] As used herein, the term "nucleotide sequence encoding a selectable marker" refers to a nucleotide sequence that is capable of being expressed in a host cell and wherein expression of the selectable marker confers upon the cells containing the expressed gene the ability to grow in the presence of the corresponding selective agent or in the absence of essential nutrients.

[0117] As used herein, the terms "selectable marker" and "selective marker" refer to a nucleic acid (e.g., a gene) that can be expressed in a host cell that allows easy selection of those hosts containing the vector. Examples of such selectable markers include, but are not limited to, antimicrobial agents. Thus, the term "selectable marker" refers to a gene that provides an indication that the host cell has taken up the input DNA of interest or that some other reaction has occurred. Typically, a selectable marker is a gene that confers antimicrobial resistance or a metabolic advantage to the host cell to allow cells containing the exogenous DNA to be distinguished from cells that have not received any exogenous sequences during transformation.

[0118] As defined herein, a host cell "genome," fungal cell "genome," or filamentous fungal cell "genome" includes chromosomal and extrachromosomal genes.

[0119] As used herein, the terms "plasmid," "vector," and "cassette" refer to an extrachromosomal element that typically carries genes that are not typically part of the central metabolism of the cell and is typically in the form of a circular double-stranded DNA molecule. Such elements can be linear or circular autonomously replicating sequences, genome integrating sequences, phage, or nucleotide sequences derived from single-stranded or double-stranded DNA or RNA from any source, in which multiple nucleotide sequences have been joined or recombined into a unique construct capable of introducing a promoter fragment and DNA sequence for a selected gene product, as well as appropriate 3' non-translated sequences, into a cell.

[0120] As used herein, the term "vector" refers to any nucleic acid that can replicate (propagate) in a cell and can carry a new gene or DNA fragment (e.g., an "input sequence") into the cell. Thus, the term refers to a nucleic acid construct designed for transfer between different host cells. Vectors include viruses, phages, proviruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), PLACs (plant artificial chromosomes), etc., which are "episomes" (i.e., autonomously replicating) or can be integrated into the chromosome of a host cell.

[0121] As used herein, "transformation cassette" refers to a specific vector that contains a gene (or its ORF) and has elements other than the gene that facilitate transformation of a specific host cell.

[0122] As used herein, "expression vector" refers to a vector that has the ability to incorporate and express heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commercially available and are known to those skilled in the art. The selection of an appropriate expression vector is within the knowledge of those skilled in the art.

[0123] As used herein, the terms "expression cassette" and "expression vector" refer to a nucleic acid construct that is recombinantly or synthetically generated with a series of specific nucleic acid elements (that is, these are vectors or vector elements, as described above) that allow a specific nucleic acid to be transcribed in a target cell. The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes (in addition to other sequences) a nucleic acid sequence to be transcribed and a promoter. In certain embodiments, the DNA construct also includes a series of specified nucleic acid elements that allow a specific nucleic acid to be transcribed in a target cell. In certain embodiments, the DNA construct of the present disclosure includes a selective marker as defined herein and an inactivated chromosome, or a gene, or a DNA segment.

[0124] As used herein, a "targeting vector" is a vector comprising a polynucleotide sequence that is homologous to a region in the chromosome of a host cell into which the targeting vector is transformed and that can drive homologous recombination in that region. For example, a targeting vector can be used to introduce genetic modification into the chromosome of a host cell by homologous recombination. In certain embodiments, the targeting vector comprises other non-homologous sequences, such as other non-homologous sequences (i.e., stuffer sequences or flanking sequences) added to the end. The end can be closed so that the targeting vector forms a closed loop, such as, for example, inserted into a vector.

[0125] As defined herein, the phrases "enhanced protein productivity phenotype" and "increased protein productivity phenotype" are used interchangeably.

[0126] As used herein, variant cells (or strains) comprising a "protein productivity enhancement phenotype" include, but are not limited to, variant cells comprising an improved / increased volumetric productivity, variant cells comprising an improved / increased carbon conversion efficiency, variant cells comprising an improved / increased protein yield, variant cells comprising an improved / increased specific protein productivity, etc. For example, in certain embodiments, a variant cell or strain comprising an improved protein productivity phenotype expresses / produces at least 0.1% or more of total protein (g) per gram of fed sugar (relative to the parent strain), where the fed sugar can be represented by the mass of sugar added to the fermentor during the production phase (i.e., after feeding begins).

[0127] As used herein, when describing the "increased protein productivity / increased phenotype" of unmodified (parent / control) cells relative to modified (variant) cells, it is understood that the "parent" and "variant" cells are grown / cultured / fermented under the same conditions (e.g., the same conditions such as culture medium, temperature, pH, etc.).

[0128] Similarly, when describing the "expression / production" of a protein of interest (POI) in unmodified (parent or control) cells relative to the "expression / production" of the same POI in modified (variant) cells, it is understood that the "parent" and "variant" cells are grown / cultured / fermented under essentially the same conditions (e.g., the same conditions such as culture medium, temperature, pH, etc.).

[0129] As used herein, "aerobic fermentation" refers to growth in the presence of oxygen.

[0130] As used herein, the terms "broth," "cell broth," "fermentation broth," and / or "culture broth" are used interchangeably and generally refer to (i) fermentation (culture) medium and (ii) cells in liquid (submerged) culture.

[0131] As used herein, the term "cell mass" refers to the cellular component (including intact and lysed cells) present in liquid (submerged) culture. Cell mass can be expressed as dry cell weight (DCW) or wet cell weight (WCW).

[0132] As used herein, the phrase "elevated fermentation (culture) temperature" is a fermentation temperature greater than 28°C. In certain embodiments, the elevated fermentation temperature is at least about 28.05°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, 29°C, 29.1°C, 29.2°C, 29.3°C, 29.4°C, 29.5°C, 29.6°C, 29.7°C, 29.8°C, 29.9°C, or 30°C. In certain embodiments, the elevated fermentation temperature is at least about 28.5°C to about 29°C. In other certain embodiments, the elevated fermentation temperature is at least about 29°C to 30°C.

[0133] II. Fungal strains comprising a phenotype of increased protein productivity at elevated culture temperatures

[0134] As generally described and illustrated in the Examples section below, in certain embodiments, Applicants serially passaged a Trichoderma reesei whole cellulase strain designated T4-GEF1 under selective conditions to identify and isolate a strain capable of producing high-temperature proteins without adversely affecting specific productivity (Q p For example, a mutant strain of T. reesei designated T4-26rc was identified and isolated under such selective conditions (Example 2), wherein the mutant T4-26rc strain had a similar Q when cultured at 29°C relative to the control T4-GEF1 strain cultured at 28°C. p (Table 2).

[0135] As detailed in Example 2, Applicants sequenced the HT Trichoderma reesei T4-26rc mutant strain described / isolated in Example 1 to identify any mutant alleles that contribute to the observed increased protein productivity under 31° C. growth / culture conditions. More specifically, the mutant alleles identified herein are located at scaffold position 2:1043183-1043184 in wild-type Trichoderma reesei QM6a (v2.0 genome sequence assembly, available at the Joint Genomes Institute (JGI) website (genome.jgi.doe.gov)), wherein the mutant allele comprises a SNP (G→A) encoding a truncated SPT5 protein (e.g., see Figure 1 and Figure 2). In particular, when grown / cultured at 29°C, the mutant T4-26rc T. reesei strain had a similar Q when compared to (relative to) the parent (control) T. reesei T4-GEF1 strain grown / cultured at 28°C. p .

[0136] As described in Example 3, the wild-type SPT5 gene (JGI; Trichoderma reesei v2.0 Scaffold 2: 1043183-1043184) encoding the native (functional) SPT5 protein (SEQ ID NO: 2; PID: 4136) was inactivated in a Trichoderma reesei strain designated SPT5t-BBW51 by introducing a SNP (G to A) in the SPT5 gene CDS, resulting in a C-terminal truncation (W930*) of amino acid positions 930 to 1,057 of the native SPT5 protein. As presented in Example 3 (Table 2), the fermentor performance of the SPT5 t-BBW51 transformant was compared with the parental (control) T4-GEF1 strain and the mutant T4-26rc strain described in Examples 1-2. In particular, as shown in Table 2, the total protein yields of the T4, T4-GEF1, T4-26rc, and SPT5t-BBW51 strains are shown as a percentage (%) relative to a control T4 strain cultured at 25° C. For example, at 28° C., the total protein yield percentages (%) of T4, T4-GEF1, and SPT5 t-BB51 were 68%, 107%, and 112%, respectively, compared to the T4 control at 25° C. In another example, at 29° C., the total protein yield percentages (%) of T4-GEF1, T4-26rc, and SPT5 t-BB51 were 73%, 100%, and 112%, respectively, compared to the T4 control at 25° C.

[0137] Example 4 generally describes the inactivation / disruption of the wild-type SPT5 gene by introducing a single nucleotide polymorphism (SNP) into a parent (control) strain of Trichoderma reesei (t-BAL50) containing a heterologous cellulase expression cassette, wherein the modified Trichoderma reesei strain derived therefrom was designated t-BDA88, as shown in Table 3. A second transformant, designated t-BDA85, which contained a SNP (G>A) at nucleotide position 3,183 in the coding sequence of the SPT5 gene, was also evaluated via fermentor performance, as shown in Table 3. More specifically, as presented in Table 3, the fermentor performance of the t-BDA85 and t-BDA88 transformants was compared to that of the parent t-BAL50 (control) strain, wherein the total protein yield of the t-BDA85 and t-BDA88 strains is shown as a percentage (%) relative to the t-BAL50 parent (control) strain cultured at 25°C.

[0138] Example 5 of the present disclosure further evaluated the effect of SPT5 in the absence of GEF1 gene disruption (ΔGEF1). In this example, a Cas9-based approach was used to amplify the wild-type GEF1 gene (GEF1) encoding the native GEF1 protein in Trichoderma reesei strain t-BDA85. Rest ), wherein the transformant designated t-BEX65 contained the restored WT GEF1 (GEF1 Rest ) gene. As shown in Table 4, the fermentation tank performance of the t-BEX65 strain at protein production temperatures of 25°C, 28°C, and 29°C was evaluated, where the total protein yield of t-BEX65 is shown as a percentage (%) relative to t-BEX65 at 25°C.

[0139] Thus, as illustrated and described below, in certain embodiments, the gene encoding the native SPT5 protein has sequence homology to SEQ ID NO: 1. In certain embodiments, the gene encoding the native SPT5 protein has at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3. In certain embodiments, the gene encoding a native SPT5 protein has at least about 50%, 51%, 52%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3.

[0140] In certain aspects, the gene encoding the native SPT5 protein has at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3 and encodes one or more protein domains selected from the group consisting of an SPT5 N-terminal domain (SPT5 NTD), a NusG superfamily N-terminal domain (NGN), and an SPT5 C-terminal domain (SPT5 CTD). In certain other embodiments, the gene or polynucleotide encoding the native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.

[0141] In certain other embodiments or aspects of the present disclosure, the CDS (open reading frame; ORF) nucleic acid sequence of the gene encoding the native SPT5 protein has sequence homology with the ORF sequence of SEQ ID NO: 3. In certain other embodiments, the SPT5 encoded by the ORF nucleic acid sequence (encoding the native SPT5 protein) has at least about 50% to 100% sequence identity with the native SPT5 protein of SEQ ID NO: 2. In certain other embodiments, the ORF nucleic acid sequence (encoding a native SPT5 protein) encodes an SPT5 having at least about 50%, 51%, 52%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to 100% sequence identity to the native SPT5 protein of SEQ ID NO:2. In certain other embodiments, the ORF encoding the native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.

[0142] In certain embodiments, the positions of amino acid residues in a given amino acid sequence are numbered using the amino acid residue numbering (positions) of the native Trichoderma sp. SPT5 protein of SEQ ID NO: 2. For example, Figure 1 A presents the amino acid sequence of the native SPT5 protein (SEQ ID NO: 2), wherein the given amino acid sequence described herein can be aligned with the SPT5 protein amino acid sequence (SEQ ID NO: 2) using the alignment algorithm described herein (and / or an alignment algorithm known to those skilled in the art), and the amino acid residues in the given amino acid sequence that are aligned (preferably optimally aligned) with the amino acid residues in the native sequence can be conveniently numbered by reference to the corresponding amino acid residues in the SPT5 sequence.

[0143] Similarly, to establish sequence homology or sequence identity with the primary (I°) sequence of the SPT5 protein (SEQ ID NO: 2), one skilled in the art can readily compare the primary sequence of SEQ ID NO: 2 with one or more candidate SPT5 protein homologs / orthologs using sequence alignment algorithms, software, and methods known to those skilled in the art. Thus, after aligning the conserved residues, allowing for necessary insertions and deletions to maintain the alignment (i.e., avoiding elimination of conserved residues by arbitrary deletions and insertions), residues equivalent to a particular amino acid in the primary sequence of the candidate filamentous fungal SPT5 protein are defined. The alignment of conserved residues should preferably retain 100% of such residues. However, alignment of greater than 98%, 95%, 90%, 85%, 80%, 75%, 70%, 50%, or at least 45% of the conserved residues is also sufficient to define equivalent residues.

[0144] Thus, in certain aspects, the gene encoding the native SPT5 protein has at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3 and encodes one or more protein domains selected from the group consisting of an SPT5 N-terminal domain (SPT5 NTD), a NusG superfamily N-terminal domain (NGN), and an SPT5 C-terminal domain (SPT5 CTD). For example, Figure 2 As presented in A, the native Trichoderma SPT5 protein (SEQ ID NO:2) comprises 1,057 amino acid (residue) positions, wherein the SPT5 protein comprises an SPT5 N-terminal domain (SPT5 NTD) at amino acid positions 147-217 of SEQ ID NO:2, a NusG superfamily N-terminal domain (NGN) at amino acid positions 224-313 of SEQ ID NO:2, and an SPT5 C-terminal domain (SPT5CTD) at amino acid positions 856-934 of SEQ ID NO:2.

[0145] Thus, in certain other aspects, the native SPT5 proteins of the present disclosure comprise an SPT5 NTD that is identical to that of SEQ ID NO: 5 (e.g., see Figure 2 B, SEQ ID NO: 5) is at least about 80% identical. In other embodiments, the SPT5 protein comprises an NGN domain identical to SEQ ID NO: 6 (e.g., see Figure 2 B, SEQ ID NO: 6). In another embodiment, the SPT5 protein comprises an SPT5 CTD that is at least about 80% identical to SEQ ID NO: 7 (e.g., see Figure 2 B, SEQ ID NO: 7) are at least about 80% identical.

[0146] In one or more other embodiments or aspects, the present disclosure provides recombinant fungal cells comprising genetic modifications that render the fungal cells defective in the expression of native SPT5 proteins. In certain embodiments or aspects, one skilled in the art may refer to one or more figures (figures) presented herein, and / or one or more nucleic acid (DNA) sequences described herein and / or one or more protein (amino acid) sequences of the present disclosure. In certain other embodiments or aspects, one skilled in the art may refer to the Figure 1 and / or Figure 2 , particularly such native and variant SPT5 protein (amino acid) sequences as described herein. In certain other embodiments or aspects, the wild-type (WT) Trichoderma reesei SPT5 gene encoding the native SPT5 protein has substantial sequence identity to the native SPT5 protein of SEQ ID NO: 2. In other embodiments or aspects, the WT SPT5 gene has substantial sequence identity to the WT SPT5 gene of SEQ ID NO: 1. In certain other embodiments or aspects, the WT SPT5 gene comprises a genetic modification in a portion of the SPT5 gene CDS, including but not limited to a portion of the SPT5 gene CDS encoding one or more native SPT5 protein domains selected from the group consisting of SPT5 NTD, SPT5 NGN superfamily domain, SPT5 CTD; or a portion of the SPT5 gene CDS into which one or more native SPT5 protein domains (i.e., SPT5 NTD, SPT5 NGN, SPT5 CTD) are inserted; or a portion of an upstream (5') SPT5 gene regulatory sequence; and / or a portion of a downstream (3') SPT5 gene regulatory sequence; etc. As presented and described in the Examples below, such genetically modified filamentous fungal cells that exhibit a defect in the expression / production of native SPT5 protein are particularly useful for enhancing production of a protein of interest at elevated fermentation temperatures.

[0147] Based on the foregoing, the following sections further describe, inter alia, molecular biological techniques, methods, etc. for constructing filamentous fungal cells defective in the expression / production of natural (functional) SPT5 proteins or for making filamentous fungal cells defective in the expression / production of natural (functional) SPT5 proteins; molecular biological techniques, methods, etc. for constructing recombinant (modified) filamentous fungal cells that express / produce one or more lignocellulose-degrading enzymes; molecular biological techniques, methods, etc. for constructing recombinant (modified) filamentous fungal cells that express / produce one or more heterologous target proteins and / or endogenous target proteins suitable for expression / production in the filamentous fungal cells of the present disclosure; compositions, methods, techniques, etc. for growing filamentous fungal cells or fermenting filamentous fungal cells or culturing filamentous fungal cells to produce / express / secrete one or more heterologous target proteins and / or endogenous target proteins; methods, techniques, etc. for detecting, measuring, quantifying (and the like) one or more heterologous target proteins and / or endogenous target proteins; and the like.

[0148] III. Molecular Biology

[0149] As generally described above, certain embodiments of the present disclosure relate to modified filamentous fungal cells comprising a protein productivity improvement phenotype. In certain embodiments, the modified (variant) filamentous fungal cells comprise a protein productivity improvement phenotype at elevated fermentation (culture) temperatures. In certain other embodiments or aspects of the present disclosure, the modified filamentous fungal cells comprise a genetic modification that renders these fungal cells defective in the production of natural SPT5 proteins. Therefore, certain embodiments relate to molecular biology, genetic modification, polynucleotides, genes, ORFs, gene coding (CDS) sequences, vectors, expression cassettes, etc. In certain other embodiments, the present disclosure relates to recombinant nucleic acids (polynucleotides, expression cassettes, etc.) comprising genes or gene CDS or ORFs encoding one or more proteins of interest. In certain embodiments, the polynucleotides of the present disclosure comprise one or more selectable markers. Selectable markers for use in filamentous fungi include, but are not limited to, als1, amdS, hygR, pyr2, pyr4, pyrG, sucA, a bleomycin resistance marker, a blasticidin resistance marker, a pyrithione resistance marker, a chlorimuron-ethyl resistance marker, a neomycin resistance marker, an adenine pathway gene, a tryptophan pathway gene, a thymidine kinase marker, etc. In a specific embodiment, the selectable marker is pyr2, the compositions and methods of use of which are generally described in PCT Publication No. WO 2011 / 153449.

[0150] In other embodiments or aspects of the present disclosure, the filamentous fungal cells comprise a genetic modification that renders the fungal cells defective in the production of native SPT5 proteins. In certain embodiments or aspects, and as discussed further below, such genetic modifications include, but are not limited to, introduction, substitution, or removal of one or more nucleotides in an SPT5 gene or its SPT5 gene CDS; or introduction, substitution, or removal of one or more nucleotides in a regulatory element required for transcription or translation of an SPT5 gene (or its SPT5 gene CDS); SPT5 gene disruption; SPT5 gene conversion; SPT5 gene deletion; SPT5 gene downregulation; specific SPT5 mutagenesis and / or random SPT5 mutagenesis of a gene encoding an SPT5 protein.

[0151] The fungal host cells of the present disclosure are transformed using standard techniques for transforming filamentous fungi and cultivating fungi (these standard techniques are well known to those skilled in the art). Therefore, the introduction of DNA constructs or vectors into fungal host cells includes techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection-mediated transfection and DEAE-dextrin-mediated transfection), incubation with calcium phosphate DNA precipitation, high-speed bombardment with DNA-coated microparticles, gene gun or biolistic transformation, protoplast fusion, etc. General transformation techniques are known in the art. The expression of heterologous proteins in Trichoderma is described in, for example, U.S. Patent No. 6,022,725; U.S. Patent No. 6,268,328. For the transformation of Aspergillus strains, reference is also made to Cao et al. (2000).

[0152] Typically, Trichoderma species are transformed using protoplasts or cells that have been permeabilized, typically at 10 5 to 10 7 / mL, especially 2×10 6 In some embodiments, the protoplasts are grown in a suitable solution (e.g., 1.2 M sorbitol and 50 mM CaCl ) at a density of 100 μL. These protoplasts or cells are mixed with the desired DNA. Typically, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride etc. can also be added to the uptake solution to promote conversion. Similar procedures can be used for other fungal host cells (e.g., referring to U.S. Patent number 6,022,725 and U.S. Patent number 6,268,328, both of which are incorporated by reference).

[0153] In certain embodiments, the method and composition of the present invention generally relies on the conventional techniques in the field of recombinant genetics.For example, in certain embodiments, heterologous gene or ORF encoding target protein are introduced into filamentous fungus (host) cell.In certain embodiments, heterologous gene or ORF are typically cloned into an intermediate vector and then transformed into filamentous fungus (host) cell for replication and / or expression. These intermediate vectors can be prokaryotic vectors, such as plasmids or shuttle vectors.In certain embodiments, the expression of heterologous gene or ORF is under the control of its natural promoter.In other embodiments, the expression of heterologous gene or ORF is placed under the control of a heterologous promoter, which can be a heterologous constitutive promoter or a heterologous inducible promoter.

[0154] It is clear to those skilled in the art that a native (natural) promoter can be modified by replacing, substituting, adding or eliminating one or more nucleotides without changing the function of the promoter. The practice of the present invention encompasses but is not limited to these changes to the promoter.

[0155] An expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for expression of a heterologous sequence. For example, a typical expression cassette contains a 5' promoter operably linked to the heterologous nucleic acid sequence encoding the protein of interest and may also contain sequence signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination sequences. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

[0156] In addition to the promoter sequence, the expression cassette can also contain a transcriptional termination region downstream of the structural gene to provide effective termination. The termination region can be obtained from the gene identical with the promoter sequence or can be obtained from different genes. Although any fungal terminator may work in the present invention, preferred terminators include: terminators from the Trichoderma cbhI gene, terminators from the Aspergillus nidulans trpC gene, and Aspergillus awamori or Aspergillus niger glucoamylase genes.

[0157] The specific expression vector used to deliver the genetic information into the cell is not particularly critical. Any of the conventional vectors for expression in eukaryotic or prokaryotic cells can be used. Standard bacterial expression vectors include bacteriophage lambda and M13, as well as plasmids such as pBR322-based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags (e.g., c-myc) can also be added to the recombinant protein to provide a convenient isolation method.

[0158] Elements that may be included in the expression vector may also be replicons, genes encoding antibiotic resistance that allow selection of bacteria carrying the recombinant plasmid, or unique restriction sites in non-essential regions of the plasmid that allow insertion of heterologous sequences. The specific antibiotic resistance gene selected is also not critical, as any of the many resistance genes known in the art may be suitable. Prokaryotic sequences are preferably selected so that they do not interfere with replication or integration of the DNA in the fungal host.

[0159] The method for conversion of the present invention can cause all or part of the transformation vector to be stably integrated into the genome of filamentous fungi. However, it is also expected that the conversion of the extrachromosomal transformation vector that causes self-replication is maintained. A variety of standard transfection methods can be used to produce a Trichoderma reesei cell line expressing a large amount of heterologous proteins. Therefore, any known procedure for introducing exogenous nucleotide sequences into fungal host cells can be used. These include using calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, protoplast vectors, viral vectors, and any other known method for introducing cloned genomic DNA, cDNA, synthetic DNA or other exogenous genetic materials into host cells. Also use Agrobacterium (Agrobacterium) mediated transfection methods, such as the transfection methods described in U.S. Patent number 6,255,115.

[0160] After the expression vector is introduced into the cell, the transformed cell is cultured under conditions conducive to expressing the gene. Large numbers of transformed cells can be cultured as described herein. Finally, the protein product is recovered from the culture using standard techniques. Therefore, the present disclosure provides the expression of the desired protein of interest and the production of improvement, particularly at elevated fermentation (cultivation) temperatures as described herein.

[0161] In certain other embodiments, the present disclosure relates to genetically modified filamentous fungal strains (cells) comprising an increased protein productivity phenotype. In specific embodiments, the modified fungal strains of the present disclosure comprise an increased protein productivity phenotype at elevated fermentation temperatures. For example, in certain embodiments, a variant strain of a filamentous fungus comprises a genetic modification to a gene encoding an SPT5 protein, wherein the genetic modification includes, but is not limited to: (a) introduction, substitution, or removal of one or more nucleotides in an SPT5 gene (or its ORF), or introduction, substitution, or removal of one or more nucleotides in a regulatory element required for transcription or translation of an SPT5 gene (or its ORF), (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) gene downregulation, (f) specific mutagenesis, and / or (g) random mutagenesis of a gene encoding an SPT5 protein (e.g., SEQ ID NO: 2).

[0162] Thus, in certain embodiments, variant strains of filamentous fungi are constructed that contain genetic modifications to eliminate expression / production of SPT5 protein by gene deletion (ie, the cell is rendered defective in the expression of native SPT5 protein).

[0163] In other embodiments, variant strains of filamentous fungi comprising genetic modifications are constructed by partial gene deletion or gene disruption to eliminate the expression / production of native SPT5 protein. For example, as described in the Examples below, inactivation of the wild-type SPT5 gene in a parental filamentous fungal strain results in a mutant strain that exhibits an increased protein productivity phenotype relative to the parental cell when cultured at 29°C.

[0164] Thus, in certain embodiments, the modified filamentous fungal strain comprises a partial deletion of the SPT5 gene, wherein the partial deletion comprises a partial deletion of any portion of the SPT5 gene coding sequence, wherein such variant strain comprises an increased protein productivity phenotype. Thus, in certain other embodiments, such variant strains do not express / produce SPT5 protein, or such variant strains express / produce a reduced amount of SPT5 protein relative to the parent strain.

[0165] Thus, as generally set forth herein and generally described above, one skilled in the art can readily perform one or more genetic modifications that render a filamentous fungal cell defective in the expression of a native SPT5 protein by reference to one or more nucleic acid sequences and / or protein sequences disclosed herein. For example, gene deletion techniques can partially or completely remove a gene, thereby completely eliminating or reducing the expression / production of the encoded protein (e.g., SPT5). In such methods, the deletion of a gene can be accomplished by homologous recombination using an integrating plasmid / vector that has been constructed to continuously contain the 5' and 3' regions flanking the gene. The continuous 5' and 3' regions can be introduced into the filamentous fungal cell, for example, on an integrating plasmid / vector in combination with a selectable marker to allow the plasmid to integrate into the cell.

[0166] In other embodiments, the variant strain of the filamentous fungus comprises a genetic modification that destroys or inactivates the gene encoding the protein (e.g., SPT5). Exemplary methods of gene destruction / inactivation include destroying any portion of the gene, including the gene coding sequence (CDS), promoter, enhancer, or another regulatory element, wherein the destruction includes substitution, insertion, deletion, inversion, and combinations thereof and variants thereof. Non-limiting examples of gene destruction techniques include inserting (integrating) an integrative plasmid containing a nucleic acid fragment homologous to the (e.g., SPT5) gene into one or more genes of the present invention, which will produce duplications of homologous regions and incorporating (inserting) vector DNA between the duplicated regions. In certain other non-limiting examples, gene disruption techniques include inserting an integration plasmid containing a nucleic acid fragment homologous to the (e.g., SPT5) gene into a gene (e.g., a gene encoding an SPT5 protein), which results in duplication of the homologous region and incorporation (insertion) of vector DNA between the repeated regions, wherein the inserted vector DNA separates, for example, the promoter of the SPT5 gene from the SPT5 protein coding region, or interrupts (destroys) the coding or non-coding sequence of the SPT5 gene, thereby obtaining a phenotype of increased protein productivity. Thus, the disruptive construct can be a selectable marker gene (e.g., pyr2) with 5' and 3' regions homologous to the SPT5 gene. The selectable marker enables identification of transformants containing the disrupted gene. Therefore, in certain embodiments, gene disruption includes modification of the following gene control elements, such as promoters, ribosome binding sites (RBS), untranslated regions (UTRs), codon changes, and the like.

[0167] In other embodiments, the variant strain of (that is, genetic modification) filamentous fungi is made up by introducing, replacing or removing one or more Nucleotide in gene or its required regulating and controlling element for transcription or translation.For example, Nucleotide can be inserted or removed, so that premature termination codon is introduced, start codon is removed or open reading frame (ORF) is frameshifted.Such modification can be completed by the mutagenesis that generates by site-directed mutagenesis or PCR according to methods known in the art.

[0168] In another embodiment, the variant strain of filamentous fungi is constructed by the method for gene transformation.For example, in the gene transformation method, the nucleotide sequence corresponding to the target gene is induced in vitro to produce the defective nucleic acid sequence, and then the nucleotide sequence is transformed into the parental cell to produce the variant cell that comprises the defective gene.Through homologous recombination, the defective nucleic acid sequence replaces the endogenous gene.It may be desirable that the defective gene or gene fragment also encode the mark that can be used to select the transformant that contains the defective gene.For example, the defective gene and selectable marker can be combined and introduced on non-replication or temperature-sensitive plasmid.By selecting marker under the condition that does not allow plasmid replication, influence the selection of plasmid integration.By checking whether the bacterium colony loses the selectable marker and whether the gene that obtains sudden change influences the selection of the second recombination event that causes gene replacement.

[0169] In other embodiments, variant strains of filamentous fungi are constructed using nucleotide sequences complementary to the nucleic acid sequence of the SPT5 gene using established antisense (gene silencing) technology. More particularly, expression of the SPT5 gene of a filamentous fungal strain can be reduced (downregulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the SPT5 gene, which is transcribed in the cell and is capable of hybridizing with the mRNA produced in the cell. Under conditions that allow hybridization of the complementary antisense nucleotide sequence to the mRNA, the amount of translated protein is thereby reduced or eliminated (i.e., the modified cell is rendered defective in expression of the native SPT5 protein). Such antisense methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, and the like, all of which are well known to those skilled in the art.

[0170] In other embodiments, variant strains of filamentous fungi are constructed by random or specific mutagenesis using methods well known in the art (including but not limited to chemical mutagenesis and transposition). Gene modification can be carried out by subjecting parental cells to mutagenesis and screening mutant cells in which SPT5 gene expression has been reduced or eliminated. Mutagenesis can be specific or random, for example, by using suitable physical or chemical mutagens, using suitable oligonucleotides, or subjecting the DNA sequence to mutagenesis generated by PCR. In addition, mutagenesis can be carried out by using any combination of these mutagenesis methods. Examples of physical or chemical mutagens suitable for the purposes of the present invention include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), o-methylhydroxylamine, nitrous acid, ethyl methanesulfonic acid (EMS), sodium bisulfite, formic acid, and nucleotide analogs. When such agents are used, mutagenesis is typically performed by incubating the parental cells to be mutagenized under appropriate conditions in the presence of the selected mutagenizing agent, and selecting for mutant cells that exhibit reduced or no expression of the gene.

[0171] In certain other embodiments, variant strains of filamentous fungi are constructed by means of site-specific gene editing techniques. For example, in certain embodiments, variant strains of filamentous fungi are constructed (i.e., genetically modified) by using transcriptional activators such as endonucleases (TALEN), zinc finger endonucleases (ZFN), homing (large) endonucleases, etc. More particularly, genetic modification is performed on the portion to be modified in the gene (e.g., coding region, non-coding region, leader sequence, propeptide sequence, signal sequence, transcription terminator, transcriptional activator or other regulatory elements desired for expression coding region) by means of ZFN gene editing, TALEN gene editing, homing (large) endonucleases, etc. These modification methods are well known to those skilled in the art and can be used.

[0172] In certain other embodiments, variant strains of filamentous fungi are constructed by means of CRISPR / Cas9 editing (e.g., see examples herein). More particularly, compositions and methods for modifying fungal genomes using the CRISPR / Cas9 system are described and well known in the art (e.g., see PCT Publication Nos. WO 2016 / 100571, WO 2016 / 100568, WO 2016 / 100272, WO 2016 / 100562, etc.). Thus, the gene encoding the SPT5 protein can be destroyed, deleted, mutated, or otherwise genetically modified by means of a nucleic acid-guided endonuclease, which finds its target DNA by binding to a guide RNA (e.g., Cas9) or a guide DNA (e.g., NgAgo), which recruits the endonuclease to the target sequence on the DNA, where the endonuclease can generate single-strand or double-strand breaks in the DNA. This targeted DNA break becomes a substrate for DNA repair and can be recombined with a provided editing template to cause gene destruction or deletion. For example, a gene encoding a nucleic acid-guided endonuclease (e.g., Cas9 from Streptococcus pyogenes (S. pyogenes) or a codon-optimized gene encoding Cas9 nuclease) is operably linked to an active promoter in a filamentous fungal cell and an active terminator in a filamentous fungal cell, thereby producing a filamentous fungal Cas9 expression cassette. Similarly, one skilled in the art readily identifies one or more target sites specific to a gene of interest.

[0173] For example, in order to construct a DNA construct encoding a gRNA for a target site in a gene of interest, a variable targeting domain (VT) will comprise nucleotides of a target site adjacent to a motif (TGG) 5' of a (PAM) protospacer sequence, which are fused to the DNA of the Cas9 endonuclease recognition domain (CER) of the Streptococcus pyogenes Cas9. The DNA encoding the VT domain is combined with the DNA encoding the CER domain to generate the DNA encoding the gRNA. Therefore, the filamentous fungus expression cassette of the gRNA can be produced by operably linking the DNA encoding the gRNA to an active promoter in the filamentous fungus cell and an active terminator in the filamentous fungus cell.

[0174] In certain embodiments, DNA breaks induced by endonucleases are repaired / replaced with input sequences. For example, in order to accurately repair DNA breaks generated by the above-mentioned Cas9 expression cassette and gRNA expression cassette, a nucleotide editing template is provided so that the cell's DNA repair machinery can utilize the editing template. For example, approximately 500 bp 5' of a targeted gene can be fused to approximately 500 bp 3' of a targeted gene to generate an editing template that is used by the filamentous fungal host's machinery to repair DNA breaks generated by RGEN (RNA-guided endonucleases).

[0175] Cas9 expression cassette, gRNA expression cassette and editing template can be delivered to filamentous fungal cells together using many different methods (for example, protoplast fusion, electroporation, natural competence or induction competence). By amplifying the target locus with forward and reverse primers, the transformed cells are screened by PCR. These primers can amplify the wild-type locus or the modified locus edited by RGEN. These fragments are then sequenced using sequencing primers to identify edited bacterium colonies.

[0176] Another way in which the gene encoding SPT5 protein of the present disclosure can be genetically modified is by changing the expression level of the target gene. For example, the nuclease defective variants (e.g., Cas9D10A, N863A or Cas9 D10A, H840A) of the nuclease guided by such nucleotides can be used to regulate gene expression levels by enhancing or antagonizing the transcription of the target gene. These Cas9 variants are inactive to all nuclease domains present in the protein sequence, but retain the DNA binding activity guided by RNA (i.e., these Cas9 variants cannot cut any chain of DNA when combined with the homologous target site). Therefore, the nuclease defective protein (i.e., Cas9 variant) can be expressed as a filamentous fungus expression cassette when combined with a filamentous fungus gRNA expression cassette so that the Cas9 variant protein is directed to a specific target sequence in the cell. The combination of Cas9 (variant) protein with a specific gene target site can block the combination or movement of the transcriptional machinery on the cellular DNA, thereby reducing the amount of the gene product produced. Therefore, using this method can make the gene expression of any gene targeting reduced disclosed herein. By using methods such as RNAseq, gene silencing can be monitored in cells containing a nuclease-deficient Cas9 expression cassette and one or more gRNA expression cassettes.

[0177] Thus, in certain one or more embodiments, the recombinant (modified) filamentous fungal cells of the present disclosure comprise a genetic modification that renders the cells defective in the expression of a native SPT5 protein, wherein the modified cells are at least about 5% to 100% defective in the expression of a native SPT5 protein. In certain embodiments, the modified filamentous fungal cells of the present disclosure are thus at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to 100% defective in the expression of a native SPT5 protein.

[0178] IV. Target Protein

[0179] As briefly stated in the preceding sections, the strains and methods of the present invention can be used to produce commercially important proteins in submerged cultures of filamentous fungi. The protein of interest (POI) disclosed herein can be any endogenous or heterologous protein, and it can be a variant of such a POI. The protein can contain one or more disulfide bridges, or be a protein in its functional form as a monomer or a multimer, i.e., the protein has a quaternary structure and is composed of multiple identical (homologous) or non-identical (heterologous) subunits, wherein the POI or its variant POI is preferably a POI having the desired properties.

[0180] In certain embodiments, the variant strain of filamentous fungi shows the protein titer of increase relative to (unmodified) parental strain, wherein protein titer is defined as the protein amount (g / L) of every volume.For example, titer can be measured by methods known in the art (for example, ELISA, HPLC, Bradford measure, LC / MS etc.).Therefore, in certain embodiments, the variant strain of filamentous fungi comprises compared to unmodified (parent) cell at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9% or at least about 10% or more protein titer increase.

[0181] In certain embodiments, relative to (unmodified) parental strain, the variant strain of filamentous fungi shows the volumetric productivity that increases, wherein volumetric productivity is defined as the amount (g) of protein that every nominal volume (L) bioreactor every total fermentation time produces during fermentation.For example, volumetric productivity can be measured by methods known in the art (for example, ELISA, HPLC, Bradford measure, LC / MS etc.).Therefore, in certain embodiments, the variant strain of filamentous fungi comprises compared to unmodified (parent) cell at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9% or at least about 10% or more volumetric productivity increase.

[0182] In certain other embodiments, the variant strain of the filamentous fungus exhibits increased total protein yield relative to the (unmodified) parent strain, wherein total protein yield is defined as the amount of protein produced per gram of carbohydrate supplied (g). Thus, as used herein, the total protein yield (g / g) can be calculated using the following equation:

[0183] "Yf=Tp / Tc"

[0184] Wherein "Yf" is the total protein yield (g / g), "Tp" is the total protein produced during the fermentation (g), and "Tc" is the total carbohydrate supplied during the fermentation (bioreactor) operation (g). In certain embodiments, the increase in total protein yield of the modified strain compared to the unmodified (parent) cell (i.e., relative to the parent strain) is at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more.

[0185] In some embodiments, the carbon conversion efficiency of the variant strain of filamentous fungi increases relative to (unmodified) parent strain (for example, the percentage (%) of the carbon supplied with the total protein incorporated therein increases). In some embodiments, the carbon conversion efficiency of the modified strain is an increase of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to an increase in unmodified (parent) cell (that is, relative to parent strain).

[0186] In certain embodiments, the variant strain of the filamentous fungus exhibits an increased specific productivity (Qp) of POI relative to the (unmodified) parent strain. For example, the detection of specific productivity (Qp) is a suitable method for evaluating protein production rate. Specific productivity (Qp) can be determined using the following equation:

[0187] “Qp=gP / gDCW·hr”

[0188] Wherein, "gP" is the grams of protein produced in the tank; "gDCW" is the grams of dry cell weight (DCW) in the tank; and "hr" is the fermentation time in hours from the time of inoculation, which includes production time and growth time. Thus, in certain embodiments, the variant strain of the filamentous fungus comprises an increase in specific productivity (Qp) of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parent) cell.

[0189] In certain embodiments, the POI or its variant POI is selected from the group consisting of: acetylesterase, aminopeptidase, amylase, arabinanase, arabinofuranosidase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endo-β-glucanase, glucoamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glycosyl hydrolyzing enzyme. Enzymes, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, ligases, lipases, lyases, mannanases, mannosidases, oxidases, oxidases, oxidoreductases, pectin lyases, pectin acetylesterases, pectin depolymerases, pectin methylesterases, pectinolytic enzymes, perhydrolases, polyol oxidases, peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, peptidases, rhamnogalacturonases, ribonucleases, transferases, transporters, transglutaminases, xylanases, hexose oxidases, and combinations thereof.

[0190] In certain embodiments, the POI or variant POI thereof is selected from an Enzyme Commission (EC) number selected from the group consisting of EC 1, EC 2, EC 3, EC 4, EC 5, or EC 6.

[0191] For example, in certain embodiments, the POI is an oxidoreductase, including but not limited to an EC1 (oxidoreductase) enzyme selected from the group consisting of EC 1.10.3.2 (e.g., laccase), EC 1.10.3.3 (e.g., L-ascorbate oxidase), EC 1.1.1.1 (e.g., alcohol dehydrogenase), EC 1.11.1.10 (e.g., chloride peroxidase), EC 1.11.1.17 (e.g., peroxidase), EC 1.1.1.27 (e.g., L-lactate dehydrogenase), EC 1.1.1.47 (e.g., glucose 1-dehydrogenase), EC 1.1.3.X (e.g., glucose oxidase), EC 1.1.3.10 (e.g., pyranose oxidase), EC 1.13.11.X (e.g., dioxygenase), EC 1.13.11.12 (e.g., lineolate 13S-lipoxygenase), 13S-lipozygenase)), EC 1.1.3.13 (e.g., alcohol oxidase), EC 1.14.14.1 (e.g., monooxygenase), EC 1.14.18.1 (e.g., monophenol monooxigenase), EC 1.15.1.1 (e.g., superoxide dismutase), EC 1.1.5.9 (formerly, EC 1.1.99.10, e.g., glucose dehydrogenase), EC 1.1.99.18 (e.g., cellobiose dehydrogenase), EC 1.1.99.29 (e.g., pyranose dehydrogenase), EC 1.2.1.X (e.g., fatty acid reductase), EC 1.2.1.10 (e.g., acetaldehyde dehydrogenase), EC 1.5.3.X (e.g., fructosylamine reductase), EC 1.8.1.X (e.g., disulfide reductase), and EC 1.8.3.2 (e.g., thiol oxidase).

[0192] In certain embodiments, the POI is a transferase, including but not limited to an EC 2 (transferase) enzyme selected from the group consisting of EC 2.3.2.13 (e.g., transglutaminase), EC 2.4.1.X (e.g., hexosyltransferase), EC 2.4.1.40 (e.g., alternasucrase), EC 2.4.1.18 (e.g., 1,4 α-glucan branching enzyme), EC 2.4.1.19 (e.g., cyclomaltodextrin glucanotransferase), EC 2.4.1.2 (e.g., dextrin glucanase), EC 2.4.1.20 (e.g., cellobiose phosphorylase), EC 2.4.1.25 (e.g., 4-α-glucanotransferase), EC 2.4.1.333 (e.g., 1,2-β-oligoglucose phosphotransferase), EC EC 2.4.1.4 (e.g., amylosucrase), EC 2.4.1.5 (e.g., glucansucrase), EC 2.4.1.69 (e.g., galactoside 2-α-L-fucosyltransferase), EC 2.4.1.9 (e.g., inulosucrase), EC 2.7.1.17 (e.g., xylulokinase), EC 2.7.7.89 (formerly EC 3.1.4.15, e.g., [glutamine synthetase]-adenosine-L-tyrosine phosphorylase), EC 2.7.9.4 (e.g., α-glucanase), and EC 2.7.9.5 (e.g., phosphoglucanase).

[0193] In other embodiments, the POI is a hydrolase including, but not limited to, an EC 3 (hydrolase) enzyme selected from the group consisting of: EC 3.1.XX (e.g., esterases), EC 3.1.1.1 (e.g., pectinases), EC 3.1.1.14 (e.g., chlorophyllases), EC 3.1.1.20 (e.g., tannases), EC 3.1.1.23 (e.g., glyceride acyl hydrolases), EC

[0194] EC 3.1.1.26 (e.g., galactolipase), EC 3.1.1.32 (e.g., phospholipase A1), EC 3.1.1.4 (e.g., phospholipase A2), EC 3.1.1.6 (e.g., acetylesterase), EC 3.1.1.72 (e.g., acetylxylan esterase), EC 3.1.1.73 (e.g., feruloyl esterase), EC 3.1.1.74 (e.g., cutinase), EC 3.1.1.86 (e.g., rhamnogalacturonan acetylesterase), EC 3.1.1.87 (e.g., fumonisin B1 esterase), EC 3.1.26.5 (e.g., ribonuclease P), EC 3.1.3.X (e.g., phosphomonoester hydrolase), EC EC 3.1.30.1 (e.g., Aspergillus nuclease S1), EC 3.1.30.2 (e.g., Serratia marcescens nuclease), EC 3.1.3.1 (e.g., alkaline phosphatase), EC 3.1.3.2 (e.g., acid phosphatase), EC 3.1.3.8 (e.g., 3-phytase), EC 3.1.4.1 (e.g., phosphodiesterase I), EC 3.1.4.11 (e.g., phosphatidylinositol phospholipase C), EC 3.1.4.3 (e.g., phospholipase C), EC 3.1.4.4 (e.g., phospholipase D), EC 3.1.6.1 (e.g., arylsulfatase), EC 3.1.8.2 (e.g., diisopropyl-fluorophosphatase), EC 3.2.1.10 (e.g., oligo-1,6-glucosidase), EC EC 3.2.1.101 (e.g., mannan endo-1,6-α-mannosidase), EC 3.2.1.11 (e.g., α-1,6-glucan-6-glucanohydrolase), EC 3.2.1.131 (e.g., xylan α-1,2-glucuronidase), EC 3.2.1.132 (e.g., chitosan N-acetylglucosaminyl hydrolase), EC

[0195] EC 3.2.1.139 (e.g., α-glucuronidase), EC 3.2.1.14 (e.g., chitinase), EC 3.2.1.151 (e.g., xyloglucan-specific endo-β-1,4-glucanase), EC 3.2.1.155 (e.g., xyloglucan-specific exo-β-1,4-glucanase), EC 3.2.1.164 (e.g., galactan endo-1,6-β-galactosidase), EC 3.2.1.17 (e.g., lysozyme), EC 3.2.1.171 (e.g., rhamnogalacturonan hydrolase), EC 3.2.1.174 (e.g., rhamnogalacturonan rhamnohydrolase), EC 3.2.1.2 (e.g., β-amylase), EC 3.2.1.20 (e.g., α-glucosidase), EC 3.2.1.22 (e.g., α-galactosidase), EC

[0196] EC 3.2.1.25 (e.g., β-mannosidase), EC 3.2.1.26 (e.g., β-fructofuranosidase), EC 3.2.1.37 (e.g., xylan 1,4-β-xylosidase), EC 3.2.1.39 (e.g., glucan endo-1,3-β-D-glucosidase), EC 3.2.1.40 (e.g., α-L-rhamnosidase), EC 3.2.1.51 (e.g., α-L-fucosidase), EC 3.2.1.52 (e.g., β-N-acetylglucosaminidase), EC 3.2.1.55 (e.g., α-N-arabinofuranosidase), EC 3.2.1.58 (e.g., glucan 1,3-β-glucosidase), EC EC 3.2.1.59 (e.g., glucan endo-1,3-α-glucosidase), EC 3.2.1.67 (e.g., galactan 1,4-α-galacturonidase), EC 3.2.1.68 (e.g., isoamylase), EC 3.2.1.7 (e.g., 1-β-D-fructan fructohydrolase), EC 3.2.1.74 (e.g., glucan 1,4-β-glucosidase), EC 3.2.1.75 (e.g., glucan endo-1,6-β-glucosidase), EC 3.2.1.77 (e.g., mannan 1,2-(1,3)-α-mannosidase), EC 3.2.1.80 (e.g., fructan β-fructosidase), EC 3.2.1.82 (e.g., exo-poly-α-galacturonidase), EC EC 3.2.1.83 (e.g., kappa-carrageenase), EC 3.2.1.89 (e.g., arabinogalactan endo-1,4-β-galactosidase), EC 3.2.1.91 (e.g., cellulo-1,4-β-cellobiosidase), EC 3.2.1.96 (e.g., mannosyl-glycoprotein endo-β-N-acetylglucosaminidase), EC 3.2.1.99 (e.g., arabino-1,5-α-L-arabinosidase), EC 3.4.XX (e.g., peptidase), EC 3.4.11.X (e.g., aminopeptidase), EC 3.4.11.1 (e.g., leucyl aminopeptidase), EC 3.4.11.18 (e.g., methionyl aminopeptidase), EC 3.4.13.9 (e.g., Xaa-Pro dipeptidase), EC 3.4.14.5 (e.g., dipeptidyl-peptidase IV), EC 3.4.16.X (e.g., serine-type carboxypeptidase), EC 3.4.16.5 (e.g., carboxypeptidase C), EC 3.4.19.3 (e.g., pyroglutamyl peptidase I), EC 3.4.21.X (e.g., serine endopeptidase), EC 3.4.21.1 (e.g., chymotrypsin), EC 3.4.21.19 (e.g., glutamyl endopeptidase), EC 3.4.21.26 (e.g., prolyl oligopeptidase), EC 3.4.EC 3.4.22.1 (e.g., trypsin), EC 3.4.22.2 (e.g., papain), EC 3.4.22.3 (e.g., ficin), EC 3.4.22.32 (e.g., stem bromelain), EC 3.4.22.33 (e.g., fruit bromelain), EC 3.4.22.6 (e.g., chymopapain), EC 3.4.23.1 (e.g., pepsin A), EC EC 3.4.23.2 (e.g., pepsin B), EC 3.4.23.22 (e.g., Cryprion pepsin), EC 3.4.23.23 (e.g., Mucor pepsin), EC 3.4.23.3 (e.g., pepsin), EC 3.4.24.X (e.g., metalloendopeptidases), EC 3.4.24.39 (e.g., deuterolysins), EC 3.4.24.40 (e.g., Serratia marcescens enzyme), EC 3.5.1.1 (e.g., asparaginase), EC 3.5.1.11 (e.g., penicillin amidase), EC 3.5.1.14 (e.g., N-acyl-aliphatic-L-amino acid amidohydrolase), EC 3.5.1.2 (e.g., L-glutamine amidohydrolase), EC EC 3.5.1.28 (e.g., N-acetylmuramoyl-L-alanine amidase), EC 3.5.1.4 (e.g., amidase), EC 3.5.1.44 (e.g., protein-L-glutamine amidohydrolase), EC 3.5.1.5 (e.g., urease), EC 3.5.1.52 (e.g., peptide-N(4)-(N-acetyl-β-glucosaminyl)asparagine amidase), EC 3.5.1.81 (e.g., N-acyl-D-amino acid deacylase), EC 3.5.4.6 (e.g., AMP deaminase), and EC 3.5.5.1 (e.g., nitrilase).

[0197] In other embodiments, the POI is a lyase including, but not limited to, an EC 4 (lyase) enzyme selected from the group consisting of EC 4.1.2.10 (e.g., mandelonitrile lyase), EC 4.1.3.3 (e.g., N-acetylneuraminic acid lyase), EC 4.2.1.1 (e.g., carbonic anhydrase), EC 4.2.2.- (e.g., rhamnogalacturonan lyase), EC 4.2.2.10 (e.g., pectin lyase), EC 4.2.2.22 (e.g., pectin trisaccharide-lyase), EC 4.2.2.23 (e.g., rhamnogalacturonan endolyase), and EC 4.2.2.3 (e.g., mannose aldehyde-specific alginate lyase).

[0198] In certain other embodiments, the POI is an isomerase including, but not limited to, an EC 5 (isomerase) enzyme selected from the group consisting of EC 5.1.3.3 (e.g., aldose 1-epimerase), EC 5.1.3.30 (e.g., D-psicose 3-epimerase), EC 5.4.99.11 (e.g., isomaltulose synthase), and EC 5.4.99.15 (e.g., (1→4)-α-D-glucan 1-α-D-glucosylmutase).

[0199] In yet other embodiments, the POI is a ligase including, but not limited to, an EC 6 (ligase) enzyme selected from the group consisting of EC 6.2.1.12 (eg, 4-coumarate:Coenzyme A ligase) and EC 6.3.2.28 (eg, L-amino acid α-ligase).

[0200] V. Fermentation

[0201] In certain embodiments, the present disclosure provides methods for producing a target protein, which methods include growing or cultivating filamentous fungal cells or fermenting filamentous fungal cells, wherein the fungal cells secrete the target protein. Generally speaking, fermentation methods well known in the art are used to ferment fungal cells. In certain embodiments, fungal cells are grown under batch or continuous fermentation conditions. Classical batch fermentation is a closed system, in which the composition of the culture medium is set at the beginning of fermentation, and the composition does not change during the fermentation period. At the beginning of fermentation, the desired organism is inoculated into the culture medium. In this method, fermentation is allowed to occur without adding any components to the system. Typically, batch fermentation meets the qualification of "batch" with respect to adding a carbon source, and control factors (such as pH and oxygen concentration) are often attempted. The metabolite and biomass composition of the batch system constantly changes until the fermentation stops. In batch culture, cells progress to a high growth logarithmic phase through a static lag phase, and finally enter a stable phase in which the growth rate decreases or stops. If left untreated, cells in the stationary phase eventually die. Typically, cells in the logarithmic phase are responsible for the mass production of products.

[0202] The suitable modification of standard batch system is " fed-batch fermentation " system.In this modification of typical batch system, along with the progress of fermentation, substrate is added with increment.When catabolite repression may suppress the metabolism of cell and under the situation that expectation has limited amount of substrate in substratum, fed-batch system is useful.The measurement of actual substrate concentration in fed-batch system is difficult and therefore it is estimated based on the variation of measurable factors (such as pH, dissolved oxygen and waste gas (such as CO ) partial pressure).Batch and fed-batch fermentation are commonly used and known in this area.

[0203] Continuous fermentation is an open system, in which the fermentation medium limited is continuously added to the bioreactor, and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation maintains culture at a constant high density usually, in which cells are mainly in logarithmic phase growth. Continuous fermentation allows one or more factors affecting cell growth and / or product concentration to be regulated. For example, in one embodiment, limiting nutrients (such as carbon source or nitrogen source) are maintained at a fixed speed, and all other parameters are allowed to be regulated. In other systems, many factors affecting growth can constantly change, and the cell concentration measured by culture medium turbidity remains unchanged. Continuous systems strive to maintain steady-state growth conditions. Therefore, the cell loss caused by extracting culture medium should be balanced with the cell growth rate in the fermentation. The method for regulating the nutrients and growth factors used for continuous fermentation technology and the technology used to maximize product formation rate are well known in the industrial microbiology field.

[0204] Certain embodiments of the present disclosure relate to fermentation procedures for cultivating fungi. Fermentation procedures for producing cellulase are known in the art. For example, cellulase can be produced by solid culture or deep culture (comprising batch, fed-batch and continuous process). Cultivation is usually completed in a growth medium that comprises an aqueous mineral salt medium, an organic growth factor, a carbon source and energy material, molecular oxygen and of course the starting inoculum of a filamentous fungus host to be used.

[0205] In addition to the carbon and energy sources, oxygen, assimilable nitrogen and the microbial inoculum, it is necessary to supply appropriate amounts of mineral nutrients in the right proportions to ensure proper microbial growth, maximize the assimilation of the carbon and energy sources by the cells during microbial conversion, and obtain maximum cell yield and maximum cell density in the fermentation medium.

[0206] The composition of the aqueous mineral culture medium can vary within wide limits, depending in part on the microorganisms and substrates used, as is known in the art. In addition to nitrogen, these mineral cultures should also include suitable amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium in suitable soluble, assimilable ionic forms and combinations, and preferably also certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, among others, also in suitable soluble, assimilable forms, all as is known in the art.

[0207] The fermentation reaction is an aerobic process in which the required molecular oxygen is supplied by a molecular oxygen-containing gas such as air, oxygen-enriched air, or even substantially pure molecular oxygen, as long as the contents of the fermentation vessel are maintained at a suitable oxygen partial pressure effective to aid the growth of the microbial species in a vigorous manner.

[0208] Microorganism also needs assimilable nitrogen source. Assimilable nitrogen source can be any nitrogenous compound or can release the nitrogen of the form that is suitable for microorganism to carry out metabolic utilization. Although can adopt multiple organic nitrogen source compound such as protein hydrolysate, can utilize cheap nitrogenous compound usually, such as ammonia, ammonium hydroxide, urea and multiple ammonium salt (such as ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride or multiple other ammonia compound). Ammonia itself is convenient for large-scale operation, and can pass through aqueous fermentation product (fermentation medium) and use by bubbling with suitable amount. Simultaneously, can also adopt such ammonia to help carry out pH control.

[0209] The pH range in the aqueous microbial fermentation (fermentation mixture) should be within the exemplary range of about 2.0 to 8.0. In the case of filamentous fungi, the pH is typically within the range of about 2.5 to 8.0; in the case of Trichoderma reesei, the pH is typically within the range of about 3.0 to 7.0. The preferred pH range for microorganisms depends to some extent on the culture medium used and the specific microorganism, and thus varies slightly with changes in the culture medium, as can be readily determined by those skilled in the art.

[0210] Preferably, fermentation is carried out in a manner that the carbon-containing substrate can be controlled as a limiting factor, thereby providing good conversion of the carbon-containing substrate and avoiding these cells to be polluted by the unconverted substrate of basic amount for the cell. The latter situation is not a problem for water-soluble substrates, because any remaining trace material can be easily washed off. However, this may be a problem under the situation of non-water-soluble substrates, and needs the product treatment step that increases such as suitable washing steps.

[0211] As described above, the time to reach this level is not critical and may vary with the specific microorganism and fermentation process being performed. However, it is well known in the art how to determine the carbon source concentration in the fermentation medium and whether the desired carbon source level has been reached.

[0212] Fermentation can be carried out as a batch or continuous operation, with fed-batch operation being more preferred for ease of control, production of uniform amounts of product, and most economical use of all equipment.

[0213] If desired, part or all of the carbon source and energy material and / or part of the assimilable nitrogen source (such as ammonia) may be added to the aqueous mineral culture medium before feeding the aqueous mineral culture medium to the fermentor.

[0214] Each stream introduced into the reactor is preferably controlled at a predetermined rate, or in response to demand that can be determined by monitoring, for example, the concentration of carbon and energy substrates, pH, dissolved oxygen, oxygen or carbon dioxide in the off-gas from the fermentor, cell density measurable by dry cell weight, light transmittance, etc. The feed rates of the various materials can be varied to achieve the fastest possible cell growth rate consistent with efficient utilization of the carbon source and energy source, and to achieve the highest possible microbial cell productivity relative to substrate changes.

[0215] In batch operation or preferably fed-batch operation, all equipment, reactors or fermentation apparatus, vessels or containers, piping, associated circulation or cooling equipment, etc. are initially sterilized, typically by applying steam, for example, at about 121° C. for at least about 15 minutes. The sterilized reactor is then inoculated with a culture of the selected microorganism in the presence of all required nutrients, including oxygen and a carbon-containing substrate. The type of fermentor used is not critical.

[0216] The collection and purification of proteins from the fermentation broth can also be performed by procedures known in the art. The fermentation broth will typically contain cell debris, including cells, various suspended solids and other biomass contaminants (which are preferably removed from the fermentation broth by means known in the art) as well as the desired cellulase product.

[0217] Suitable methods for such removal include conventional solid-liquid separation techniques such as, for example, centrifugation, filtration, dialysis, microfiltration, rotary vacuum filtration or other known methods to produce a cell-free filtrate. The fermentation broth or cell-free filtrate may preferably be further concentrated using techniques such as ultrafiltration, evaporation or precipitation prior to crystallization.

[0218] The protein component of the precipitation supernatant or filtrate can be purified with the aid of salts (eg, ammonium sulfate) and then by various chromatographic procedures (eg, ion exchange chromatography, affinity chromatography, or similar art-recognized methods).

[0219] VI. Exemplary Embodiments

[0220] Non-limiting embodiments of the present disclosure include, but are not limited to:

[0221] 1. A recombinant (modified) filamentous fungal cell derived from a parent filamentous fungal cell comprising a gene encoding a native SPT5 protein, wherein the recombinant cell comprises a genetic modification that renders the cell defective in the expression / production of the native SPT5 protein.

[0222] 2. The recombinant cell of embodiment 1, wherein the parent cell expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.

[0223] 3. The recombinant cell of embodiment 1, comprising an increased protein productivity phenotype relative to the parental cell when cultured under identical conditions at a temperature between about 25°C and 29°C.

[0224] 4. The recombinant cell of embodiment 1, wherein the gene encoding the native SPT5 protein is at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1.

[0225] 5. The recombinant cell of embodiment 1, wherein the native SPT5 protein is at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:2.

[0226] 6. The recombinant cell of embodiment 1, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of: an SPT5 N-terminal domain (NTD) at least 80% identical to SEQ ID NO: 5, a NusG superfamily (NGN) domain at least 80% identical to SEQ ID NO: 6, and an SPT5 C-terminal domain (CTD) at least 80% identical to SEQ ID NO: 7.

[0227] 7. The recombinant cell of embodiment 3, wherein the protein productivity-enhancing phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity.

[0228] 8. The recombinant cell of embodiment 3, comprising an increased protein productivity phenotype relative to the parent cell when fermented under identical conditions at 26°C.

[0229] 9. The recombinant cell of embodiment 3, comprising an increased protein productivity phenotype relative to the parent cell when fermented under identical conditions at 27°C.

[0230] 10. The recombinant cell of embodiment 3, comprising an increased protein productivity phenotype relative to the parent cell when fermented under identical conditions at 28°C.

[0231] 11. The recombinant cell of embodiment 3, comprising an increased protein productivity phenotype relative to the parent cell when fermented under identical conditions at 29°C.

[0232] 12. The recombinant cell of embodiment 1, wherein the recombinant cell and the parental cell comprise one or more introduced expression cassettes encoding one or more heterologous proteins of interest.

[0233] 13. The recombinant cell of embodiment 12, wherein the one or more expression cassettes encode a heterologous protein selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor, and a hormone.

[0234] 14. The recombinant cell of embodiment 13, wherein the enzyme is selected from the group consisting of an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase, and a ligase.

[0235] 15. The recombinant cell of embodiment 2, expressing one or more lignocellulose degrading enzymes.

[0236] 16. The recombinant cell of embodiment 12, comprising one or more introduced expression cassettes encoding one or more lignocellulose degrading enzymes.

[0237] 17. The recombinant cell of embodiment 15 or embodiment 16, wherein the one or more lignocellulose degrading enzymes are selected from the group consisting of: cellobiohydrolases, xylanases, endoglucanases, and beta-glucosidases.

[0238] 18. The recombinant cell of embodiment 1, further comprising a genetic modification that renders the cell defective in production of native GEF1 protein.

[0239] 19. The recombinant cell of embodiment 1, wherein the genetic modification that renders the cell defective in the expression / production of the native SPT5 protein comprises a complete or partial deletion of a wild-type SPT5 gene coding sequence (CDS) and / or a complete or partial deletion of an upstream (5') wild-type SPT5 gene promoter.

[0240] 20. The recombinant cell of embodiment 19, wherein the partial deletion of the wild-type (WT) SPT5 gene CDS comprises a deletion of at least nine (9) to about one hundred (100) consecutive nucleotides of the WT SPT5 gene CDS and / or a deletion of at least nine (9) consecutive nucleotides of the upstream WT SPT5 gene promoter.

[0241] 21. The recombinant cell of embodiment 20, wherein the partial deletion of the WT SPT5 gene CDS comprises a deletion of at least nine (9) consecutive nucleotides encoding an SPT5 N-terminal domain (NTD) identical to the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides encoding an SPT5 NusG domain (NGN) identical to the native SPT5 NGN of SEQ ID NO: 6, a deletion of at least 9 consecutive nucleotides encoding an SPT5 C-terminal domain (CTD) identical to the native SPT5 NTD of SEQ ID NO: 7, a deletion of at least 9 consecutive nucleotides before or after the nucleotides encoding the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides before or after the nucleotides encoding the native SPT5 NGN of SEQ ID NO: 6, and / or a deletion of at least 9 consecutive nucleotides before or after the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7.

[0242] 22. The recombinant cell of embodiment 1, wherein the genetic modification that renders the cell defective in expression / production of the native SPT5 protein comprises disruption of a wild-type (WT) SPT5 gene coding sequence (CDS) and / or disruption of an upstream (5') WT SPT5 gene promoter.

[0243] 23. The recombinant cell of embodiment 22, wherein the disruption of the WT SPT5 gene CDS comprises a disruption of an SPT5 N-terminal domain (NTD) identical to the native SPT5 NTD of SEQ ID NO: 5, a disruption of an SPT5 NusG domain (NGN) identical to the native SPT5 NGN of SEQ ID NO: 6, a disruption of an SPT5 C-terminal domain (CTD) identical to the native SPT5 NTD of SEQ ID NO: 7, a disruption of a nucleotide position before or after the nucleotide encoding the native SPT5 NTD, a disruption of a nucleotide position before or after the nucleotide encoding the native NGN of SEQ ID NO: 6, and / or a disruption of a nucleotide position before or after the nucleotide encoding the native SPT5 CTD of SEQ ID NO: 7.

[0244] 24. The recombinant cell of embodiment 1, wherein the genetic modification that renders the cell defective in the expression / production of the native SPT5 protein comprises an antisense (gene silencing) nucleotide sequence that is complementary to a nucleic acid sequence encoding a native form of the wild-type SPT5 gene coding sequence (CDS).

[0245] 25. A mutant Trichoderma reesei cell comprising a variant SPT5 gene having a guanine (G) to adenine (A) single nucleotide polymorphism (SNP) mutation in the SPT5 gene coding sequence (CDS) at nucleotide position 2,790 of SEQ ID NO: 3.

[0246] 26. The mutant cell of embodiment 25, wherein the variant SPT5 gene encodes a truncated SPT5 protein that is at least about 90% to 100% identical to SEQ ID NO:4.

[0247] 27. The mutant cell of embodiment 25, which expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.

[0248] 28. The mutant cell of embodiment 25, comprising an increased protein productivity phenotype and expressing the same one or more endogenous proteins of interest and / or expressing the same one or more heterologous proteins of interest relative to a control Trichoderma reesei cell comprising a wild-type SPT5 gene CDS, wherein the mutant cell and the control cell are fermented under the same conditions at a temperature between about 25°C and 29°C.

[0249] 29. An isolated variant SPT5 gene having at least 90% to 100% identity to SEQ ID NO: 3 and comprising a G to A SNP mutation at nucleotide position 2,790 of SEQ ID NO: 3.

[0250] 30. An isolated polynucleotide encoding a variant SPT5 protein having at least 90% to 100% sequence identity to a C-terminally truncated SPT5 protein of SEQ ID NO: 4.

[0251] 31. A method for producing increased amounts of a lignocellulose degrading enzyme in a modified filamentous fungal cell, the method comprising (a) obtaining a parent filamentous fungal cell having a gene encoding a native SPT5 protein, genetically modifying the parent cell to obtain a modified filamentous fungal cell defective in the expression / production of the native SPT5 protein, and (b) fermenting the modified cell under suitable conditions to produce the lignocellulose degrading enzyme, wherein the amount of the lignocellulose degrading enzyme produced by the modified cell is increased relative to the parent cell when fermented under the same conditions at a temperature between about 25°C and 29°C.

[0252] 32. A method for producing increased amounts of a heterologous protein of interest (POI) in a modified filamentous fungal cell, the method comprising (a) obtaining a parent filamentous fungal cell having a gene encoding a native SPT5 protein, genetically modifying the parent cell to obtain a modified filamentous fungal cell defective in the expression / production of the native SPT5 protein, wherein an expression cassette encoding the POI is introduced into the parent cell before, during, or after rendering the cell defective in the production of the native SPT5 protein; and (b) fermenting the modified cell under suitable conditions to produce the heterologous POI, wherein the modified cell produces an increased amount of the POI relative to the parent cell when fermented under the same conditions at a temperature between about 25°C and 29°C.

[0253] 33. The method of embodiment 31 or embodiment 32, wherein the gene encoding the native SPT5 protein is at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1.

[0254] 34. The method of embodiment 31 or embodiment 32, wherein the native SPT5 protein is at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2.

[0255] 35. The method of embodiment 31 or embodiment 32, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of: an SPT5 N-terminal domain (NTD) at least 80% identical to SEQ ID NO: 5, a NusG superfamily (NGN) domain at least 80% identical to SEQ ID NO: 6, and an SPT5 C-terminal domain (CTD) at least 80% identical to SEQ ID NO: 7.

[0256] 36. The method of embodiment 31 or embodiment 32, wherein the cells are fermented at 26°C.

[0257] 37. The method of embodiment 31 or embodiment 32, wherein the cells are fermented at 27°C.

[0258] 38. The method of embodiment 31 or embodiment 32, wherein the cells are fermented at 28°C.

[0259] 39. The method of embodiment 31 or embodiment 32, wherein the cells are fermented at 29°C.

[0260] 40. The method of embodiment 31, wherein the one or more lignocellulose degrading enzymes are selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases, and beta-glucosidases.

[0261] 41. The method of embodiment 32, wherein the expression cassette encodes a heterologous protein selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor, and a hormone.

[0262] 42. The method of embodiment 41, wherein the enzyme is selected from the group consisting of an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase, and a ligase.

[0263] 43. The method of embodiment 31 or embodiment 32, further comprising a genetic modification that renders the cell defective in the production of native GEF1 protein.

[0264] 44. The method of embodiment 31 or embodiment 32, wherein the genetic modification that renders the cell defective in the expression / production of the native SPT5 protein comprises a complete or partial deletion of a wild-type SPT5 gene coding sequence (CDS) and / or a complete or partial deletion of an upstream (5') wild-type SPT5 gene promoter.

[0265] 45. A method as described in Example 44, wherein the partial deletion of the wild-type (WT) SPT5 gene CDS includes a deletion of at least nine (9) to about one hundred (100) consecutive nucleotides of the WT SPT5 gene CDS and / or a deletion of at least nine (9) consecutive nucleotides of the upstream WT SPT5 gene promoter.

[0266] 46. The method of embodiment 45, wherein the partial deletion of the WT SPT5 gene CDS comprises a deletion of at least nine (9) consecutive nucleotides encoding an SPT5 N-terminal domain (NTD) identical to the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides encoding an SPT5 NusG domain (NGN) identical to the native SPT5 NGN of SEQ ID NO: 6, a deletion of at least 9 consecutive nucleotides encoding an SPT5 C-terminal domain (CTD) identical to the native SPT5 NTD of SEQ ID NO: 7, a deletion of at least 9 consecutive nucleotides before or after the nucleotides encoding the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides before or after the nucleotides encoding the native SPT5 NGN of SEQ ID NO: 6, and / or a deletion of at least 9 consecutive nucleotides before or after the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7.

[0267] 47. The method of embodiment 31 or embodiment 32, wherein the genetic modification that renders the cell defective in expression / production of the native SPT5 protein comprises disruption of a wild-type (WT) SPT5 gene coding sequence (CDS) and / or disruption of an upstream (5') WT SPT5 gene promoter.

[0268] 48. The method of embodiment 47, wherein the disruption of the WT SPT5 gene CDS comprises disruption of an SPT5 N-terminal domain (NTD) identical to the native SPT5 NTD of SEQ ID NO: 5, disruption of an SPT5 NusG domain (NGN) identical to the native SPT5 NGN of SEQ ID NO: 6, disruption of an SPT5 C-terminal domain (CTD) identical to the native SPT5 NTD of SEQ ID NO: 7, disruption of a nucleotide position before or after the nucleotide encoding the native SPT5 NTD, disruption of a nucleotide position before or after the nucleotide encoding the native NGN of SEQ ID NO: 6, and / or disruption of a nucleotide position before or after the nucleotide encoding the native SPT5 CTD of SEQ ID NO: 7.

[0269] 49. The method of embodiment 31 or embodiment 32, wherein the genetic modification that renders the cell defective in the expression / production of the native SPT5 protein comprises an antisense (gene silencing) nucleotide sequence that is complementary to a nucleic acid sequence encoding a native form of the wild-type SPT5 gene coding sequence (CDS).

[0270] 50. The method of embodiment 31 or embodiment 32, wherein the modified cell comprises a protein productivity enhancement phenotype selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity compared to the parent cell when fermented under identical conditions.

[0271] 51. The fungal cell of embodiment 1, wherein the cell is selected from the group consisting of: an Acremonium species cell, an Aspergillus species cell, a Cephalosporium species cell, a Fusarium species cell, a Humicola species cell, a Mucor species cell, a Myceliophthora species cell, a Neurospora species cell, a Penicillium species cell, a Cylindrotheca species cell, a Thielavia species cell, a Tolypocladium species cell, and a Trichoderma species cell.

[0272] 52. The method of embodiment 31 or embodiment 32, wherein the fungal cell is selected from the group consisting of: an Acremonium species cell, an Aspergillus species cell, a Cephalosporium species cell, a Fusarium species cell, a Humicola species cell, a Mucor species cell, a Myceliophthora species cell, a Neurospora species cell, a Penicillium species cell, a Cylindrotheca species cell, a Thielavia species cell, a Tolypocladium species cell, and a Trichoderma species cell.

[0273] Examples

[0274] Certain aspects of the present disclosure may be further understood based on the following examples, which should not be construed as limiting. Modifications to materials and methods will be apparent to those skilled in the art. Standard recombinant DNA and molecular cloning techniques used herein are well known in the art (Ausubel et al., 1987; Sambrook et al., 1989).

[0275] Example 1

[0276] Identification of mutant Trichoderma strains comprising an enhanced protein productivity phenotype at elevated culture temperatures

[0277] As generally described above, PCT Publication No. WO 2021 / 092356 describes, inter alia, the serial passage of a Trichoderma T4 cellulase-producing strain under selective conditions to identify and isolate mutant T4 strains capable of producing a high-temperature (HT) protein compared to a parent (control) T4 strain. In particular, the WO 2021 / 092356 publication identifies mutant T4 strains capable of producing HT protein without adversely affecting specific productivity (Q) compared to / relative to a control T4 strain. p ) is a mutant T4 strain (named "T4-GEF1"), wherein relative to the T4 parent (control) strain, the mutant T4 strain comprises a mutant "GEF1 gene" encoding a truncated "GEF1 protein".

[0278] As discussed above in Table 1 of Section I, certain exemplary Trichoderma strains comprising a deletion of the GEF1 gene (ΔGEF1, e.g., derived from the control strain T4-GEF1) are described herein and serially passaged under selective conditions to isolate strains capable of producing the HT protein without adversely affecting the specific productivity Q. p More specifically, in this example, a mutant T. reesei strain named "T4-26rc" was identified and isolated that had a similar Q when cultured at 29°C to that of the parent (control) T. reesei T4-GEF1 strain when cultured at 28°C. p .

[0279] For example, the T4-GEF1 control strain was sporulated on BIRD agar and 1 × 10 7 Spores / mL were suspended in water and treated with 0.15 mg / mL 1-methyl-3-nitro-1-nitrosoguanidine (Sigma 112,994-1) for two (2) hours at room temperature until only 1% of the spores remained alive. The spores were inoculated into evolution medium containing 0.5% microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethyl cellulose (CMC; Sigma-Aldrich C5678, St. Louis, MO) or acid-swollen cellulose (e.g., for preparation, see Wood, 1971) as the sole carbon source. In addition, ammonium sulfate (4 g), sodium dihydrogen phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g) and 2.5 ml of 400X trace element solution were contained per liter.

[0280] More specifically, in the first method, about one (1) million chemically mutated spores were inoculated into two hundred fifty (250) ml concave bottom flasks containing the above-mentioned evolution medium having as the sole carbon source. The flasks were incubated at 180 rpm and 31° C. for five (5) days. At this point, 10% volume / volume was transferred to a second identical flask, which was incubated in the same manner. Serial passages were continued for eleven (10) generations (P) as follows: P1 = seven (7) days, P2 = seven (7) days, P3 = five (5) days, P4 = five (5) days, P5 = five (5) days, P6 = four (4) days, P7 = four (4) days, P8 = four (4) days, P9 = three (3) days, and P10 = two (2) days. The P10 broth from the P10 shake flask was centrifuged at 4,000 rpm for ten (10) minutes. The supernatant was discarded, and the cells were suspended in water and plated on BIRD medium.

[0281] Single colony forming units of total protein were assessed by BCA (Product No. 23228, Thermo Scientific, Rockford, IL) after four (4) days of incubation at 31°C, 200 rpm, and 80% humidity in slow-release lactose microtiter plates (srMTP; see, e.g., PCT Publication No. WO 2014 / 047520). Therefore, the mutant strains, which produced a comparable amount of total protein at 31°C to that produced by the parent strain at 28°C, were further evaluated for high temperature protein production in fermentors.

[0282] In the second method, mutant spores of the T4-GEF1 parent (control) strain of T. reesei were encapsulated in water and oil emulsion droplets using the method described by Bachmann et al. (2013). The droplets contained evolution medium with 0.5% microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethyl cellulose (Sigma-Aldrich C5678, St. Louis, MO), or acid-swollen cellulose (Wood, 1988) as the sole carbon source. In addition, ammonium sulfate (4 g), sodium dihydrogen phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g), and 2.5 ml of 400X trace element solution were contained per liter. The droplets were incubated in tubes at 31°C for three (3) days, at which time the emulsion was broken using the method described by Bachmann et al. (2013). The cells were recovered, spores were generated on agar plates, re-encapsulated and incubated at 31°C for three (3) days. This process was repeated 10 times. After the last passage, the cells were suspended in water and plated on BIRD medium. After incubation for four (4) days at 31°C, 200 rpm and 80% humidity in srMTP lactose plates (PCT Publication No. WO2014 / 047520), the total BCA protein of single colony forming units was evaluated (Product No. 23228, Thermo Scientific, Rockford, IL). The high temperature protein production of the mutant strain was further evaluated in a fermentor, and the total protein amount produced at 31°C was comparable to the total protein amount produced by the parent strain at 28°C.

[0283] In the third method, evolution culture combination large particle flow cytometry is used to separate high temperature mutant.The T4-GEF1 of sudden change is evolved by going down to posterity ten times as mentioned above.Use evolution culture to be inoculated in the 250mL flask containing 50mL citrate minimum culture medium.The inoculation flask was hatched 48 hours under 28 ℃-34 ℃, 180-200rpm, and subsequently for inoculating the DASGIP fermentor tank running under high productivity fermentation condition, these conditions comprise pH 4.8,31 ℃, 0.04 specific glucose sophorose of feed rate (g gh).At 169 hours, results 10mL broth sample, and by electro-extrusion (electro-extrusion), cells are encapsulated in 300um alginate particles, and make it in the Tr seed culture medium with 0.01%-0.5% sophorose or lactose at 31 ℃, 150-200rpm and grow overnight. The particles were stained with 4 μl / mL resorufin cellobioside (CAS 1000404-48-7) for 10-30 minutes at 31°C and subsequently sorted on a large particle cell sorter COPAS (Union Biometrica, Holliston, MA, USA). The brightest 0.2%-0.5% of particles (561 nm excitation and 610 / 20 nm emission) were sorted into 96-well MTPs containing Bird-E agar. The plates were incubated at 31°C for 5-10 days to isolate sporulating mutants. These mutants were evaluated for improved productivity in srMTPs and fermentors at 25-31°C.

[0284] As described in Example 2 below, a mutant T. reesei T4-GEF1 strain designated "T4-26rc" was identified as a high temperature (HT) mutant strain capable of achieving optimal protein production when grown / cultured at 29°C, compared to (relative to) the parental (control) T4-GEF1 strain achieving optimal protein production when grown / cultured at 28°C (comparison).

[0285] Example 2

[0286] Characterization of a mutant Trichoderma strain T4-26rc containing a mutated SPT5 gene

[0287] Applicants sequenced the high temperature (HT) Trichoderma reesei T4-26rc mutant strain described / isolated in Example 1 to identify any mutant alleles that contribute to the increased protein productivity observed under 31° C. culture conditions. More specifically, the mutant alleles identified herein are located at scaffold position 2:1043183-1043184 in wild-type Trichoderma reesei QM6a (v2.0 genome sequence assembly, available at the Joint Genome Institute (JGI) website (genome.jgi.doe.gov)), wherein the mutant alleles contain a SNP (G to A) in the coding sequence of the gene, thereby encoding a truncated SPT5 protein, such as Figure 1 As stated.

[0288] Example 3

[0289] Inactivation of the SPT5 gene in Trichoderma strains by inserting the PYR2 gene

[0290] In this example, a Cas9-based approach was used to inactivate the wild-type SPT5 gene (JGI; Trichoderma reesei v2.0 Scaffold 2: 1043183-1043184) encoding the native SPT5 protein (SEQ ID NO: 2; PID: 4136) in a Trichoderma strain. More specifically, purified Cas9 protein and modified EZ tracrRNA were purchased from Synthego (Redwood City, CA), and a modified crRNA was synthesized by Synthego that had the following sequence at the 5' end (CLsgRNA58; SEQ ID NO: 8) that was specific for the target site (TS) CLsgRNA58 within the Trichoderma reesei SPT5 gene. CLsgRNA58: CGUCGGCGCCGAAACACCCC (SEQ ID NO: 8)

[0291] For example, the Cas9 target site (TS) determined by the above-mentioned CLsgRNA58 RNA sequence (SEQ ID NO: 8) in the SPT5 gene is at nucleotide positions 3,209 to 3,228 in the coding sequence (CDS), which is close to the mutation at nucleotide position 3,183 observed in the T4-26rc mutant identified / described in Example 1-2. Therefore, according to the manufacturer's instructions, tracrRNA and crRNA are annealed to form a guide RNA (gRNA), which is then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9: RNP). Before use, Cas9: RNP is mixed with Lipofectamine CRISPR-MAX purchased from ThermoFisher Scientific, Inc. (Waltham, MA).

[0292] A linear DNA fragment containing the T. reesei pyr2 gene with native promoter and terminator sequences and flanked by 492 bp of T. reesei repeat sequences (SEQ ID NO: 18) was amplified by PCR using primers AL950 (SEQ ID NO: 9) and AL952 (SEQ ID NO: 10). The resulting PCR product was purified using a Qiagen QIAquick PCR purification kit.

[0293] AL950:CCTAACTAACGTCTGACATCG(SEQ ID NO:9)

[0294] AL952:CGTACCATTTGACTGATACGATG(SEQ ID NO:10)

[0295] Protoplasts of the parent Trichoderma reesei strain T4-GEF1 were transformed with the pyr2 PCR product plus Cas9:RNP. Transformants were selected for uridine auxotrophy. Transformants were screened for the desired insertion of pyr2 in the SPT5 gene by PCR using forward and reverse primer pairs CL2350 (SEQ ID NO: 11) and CL2351 (SEQ ID NO: 12), which amplify across SPT5.

[0296] CL2350: AGTCGCTGGTTGTGCTGGAC (SEQ ID NO: 11)

[0297] CL2351:TAGCGTAGATCCATAGTCCACC(SEQ ID NO:12)

[0298] The SNP (G to A) was introduced into the SPT5 gene coding sequence (CDS) of the transformant designated "SPT5 t-BBW51," which was confirmed by Sanger sequencing using primers CL2350 and CL2351.

[0299] As presented in Table 2, the fermentation tank performance of the SPT5 gene-disrupted transformant SPT5 t-BBW51 was compared with the T4 parent, T4-GEF1 control, and T4-26rc mutant strains described in Examples 1-2. In particular, as shown in Table 2, the total protein yields of the T4, T4-GEF1, T4-26rc, and SPT5t-BBW51 strains are shown as a percentage (%) relative to the parent T4 strain cultured at 25°C. For example, as presented in Table 2 below, the total protein yield of the T4 (parent) strain cultured at 28°C was reduced by approximately 32% compared to the T4 (parent) strain cultured at 25°C. Similarly, the total protein yield of the T4-GEF1 (ΔGEF1) strain cultured at 28°C was increased by approximately 7% compared to the T4 (parent) strain cultured at 25°C, and by approximately 39% compared to the T4 (parent) strain cultured at 28°C.

[0300] Table 2 Final total protein yield (g / g) as a percentage of the control (T4 at 25°C)

[0301]

[0302] In addition, as shown in Table 2 above, the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultured at 29° C. was approximately equivalent to the total protein yield of the T4 (parent) strain cultured at 25° C., wherein the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultured at 29° C. was increased by approximately 32% compared to the T4 (parent) strain cultured at 28° C. Similarly, the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultured at 29° C. was higher than the protein yield of the T4-GEF1 (ΔGEF1) strain cultured at 29° C. (Table 2). As shown above (Table 2), the total protein yield of the SPT5t-BBW51-disrupted strain (ΔSPT5) was increased by approximately 12% compared to the T4 (parent) strain cultured at 25° C., and by approximately 44% compared to the T4 (parent) strain cultured at 28° C.

[0303] Example 4

[0304] Inactivation of the SPT5 gene by introducing a SNP into a Trichoderma strain containing a heterologous cellulase expression cassette

[0305] The SPT5 gene encoding the SPT5 protein (SEQ ID NO: 2) was inactivated in a Trichoderma reesei strain using a Cas9-based method (JGI; Trichoderma reesei v2.0 Scaffold 2: 1043183-1043184). More specifically, purified Cas9 protein and modified EZ tracrRNA were purchased from Synthego (Redwood City, CA), and a modified crRNA was synthesized by Synthego with the following sequence at the 5' end (CLsgRNA58; SEQ ID NO: 8) that is specific for the target site (TS; CLsgRNA58) within the Trichoderma reesei SPT5 gene.

[0306] CLsgRNA58:CGUCGGCGCCGAAACACCCC(SEQ ID NO:8)

[0307] The Cas9 target site (TS) determined by the above-mentioned RNA sequence (SEQ ID NO:8) in the SPT5 gene is at nucleotide position 3,209-3,228 in the coding sequence, which is close to the mutation at nucleotide position 3,183 observed in mutant strains (example 2). According to the manufacturer's instructions, tracrRNA and crRNA are annealed to form guide RNA (gRNA), which is then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Before use, Cas9:RNP is mixed with the Lipofectamine CRISPR-MAX purchased from Saimo Fisher Scientific, Inc. (Waltham, MA).

[0308] A linear DNA fragment containing the T. reesei SPT5 gene with the desired SNP (G to A) at nucleotide position 3,183 in the coding sequence was amplified by PCR using primers CL2350 and CL2351. The resulting PCR product was purified using the Qiagen QIAquick PCR purification kit.

[0309] Protoplasts of the parent strain t-BAL50 of Trichoderma reesei were transformed with the SPT5 and pyr2 PCR products plus Cas9:RNP. Transformants were selected for uridine auxotrophy. Transformants were screened by PCR for the desired SNP (G to A) at nucleotide position 3,183 in the CDS of the SPT5 gene using forward and reverse primer pairs CL2350 and CL2351, which amplify across SPT5.

[0310] CL2350: AGTCGCTGGTTGTGCTGGAC (SEQ ID NO: 11)

[0311] CL2351:TAGCGTAGATCCATAGTCCACC(SEQ ID NO:12)

[0312] Insertion of the 278 bp pyr2 fragment resulted in truncation of SPT5 in a transformant designated "t-BDA88," which was confirmed by Sanger sequencing using primers CL2350 and CL2351, verifying disruption of the SPT5 CDS.

[0313] In another transformant, designated t-BDA85, a SNP (G to A) at nucleotide position 3,183 in the CDS of the SPT5 gene was identified by sequencing the PCR product using forward and reverse primer pairs CL2350 and CL2351, which amplified across SPT5, confirming SPT5 truncation.

[0314] The fermentor performance of the t-BDA85 and t-BDA88 transformants was compared to the parental (control) t-BAL50 strain as presented below in Table 3. In particular, the total protein yield of the t-BDA85 and t-BDA88 strains is shown in Table 3 as a percentage (%) relative to the t-BAL50 control strain cultured at 25°C.

[0315] For example, as presented in Table 3 below, the total protein yield of the t-BAL50 control strain cultured at 28° C. was reduced by approximately 12% compared to the t-BAL50 control strain cultured at 25° C. Similarly, the total protein yield of the t-BDA85 strain containing the SPT5 truncation cultured at 29° C. was increased by approximately 2% compared to the t-BAL50 control strain cultured at 25° C., and by approximately 14% compared to the t-BAL50 (parental) strain cultured at 28° C.

[0316] Additionally, the total protein yield of t-BDA88 containing an SPT5 disruption cultured at 29°C was reduced by 4% compared to the BAL50 control cultured at 25°C. Similarly, the total protein yield of t-BDA88 at 29°C was increased by 8% compared to t-BAL50 cultured at 28°C. Additionally, the total protein yield of t-BDA88 containing an SPT5 deletion cultured at 29°C was reduced by 6% compared to the total protein yield of t-BDA85 containing an SPT5 truncation cultured at 29°C.

[0317] Table 3 Fermentation tank performance

[0318]

[0319]

[0320] Example 5

[0321] Evaluation of SPT5 mutations in Trichoderma strains with wild-type GEF1 genes

[0322] In this example, the applicant restored the wild-type GEF1 gene (GEF1 Rest ; encoding native 5GEF1 protein) to further evaluate the mutant SPT5 phenotype of the present disclosure in the absence of any GEF1 mutant allele contribution. More specifically, restoration of the wild-type GEF1 gene (GEF1) was performed in the t-BDA85 strain described in Example 4 above. Rest ), wherein purified Cas9 protein was purchased from Synthego (Redwood City, CA).

[0323] The modified EZ tracrRNA was synthesized by Synthego, and the modified crRNA had a target site for the Trichoderma reesei GEF1 gene (GEF1) at the 5' end. Rest ) has the following specific sequence (GEF1 Rest ; SEQ ID NO: 15).

[0324] GEF1 Rest :AAGAAUCAAGGGCACCGCAG(SEQ ID NO:15)

[0325] Cas9 target site in the GEF1 gene determined by the above RNA sequence (SEQ ID NO: 15)

[0326] The TS is at nucleotide positions 3,668-3,687 in the coding sequence. According to the manufacturer's instructions, tracrRNA and crRNA are annealed to form a guide RNA (gRNA), which is then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Before use, Cas9:RNP is mixed with Lipofectamine CRISPR-MAX purchased from ThermoFisher Scientific, Inc. (Waltham, MA).

[0327] A linear DNA fragment containing the wild-type gene of Trichoderma reesei GEF1 was amplified from P37 genomic DNA by PCR using primers CLN2516 and CLN2515. The resulting PCR product was purified using the Qiagen QIAquick PCR purification kit.

[0328] Protoplasts of the parent strain tBDA-85 of Trichoderma reesei were transformed with the GEF1 PCR product plus Cas9:RNP. Transformants with resistance to sorbitol were selected. Forward and reverse primers were used.

[0329] For CLN2514 and CLN2517, transformants were screened for the expected wild-type GEF1 gene by PCR using primers that amplified across GEF1 and verified by sequencing.

[0330] CLN2514:CAGATCATAGTGCCGACGAG(SEQ ID NO:16)

[0331] CLN2517:AGTTCCCGCCTTGCAGCTTG(SEQ ID NO:17)

[0332] The wild-type sequence of GEF1 was verified by Sanger sequencing using primers CLN2514 and CLN2517 to confirm the restoration of the wild-type GEF1 gene in transformant t-BEX65.

[0333] As presented in Table 4 below, the fermentor performance of the t-BEX65 strain at protein production temperatures of 25° C., 28° C., and 29° C. was evaluated, wherein the total protein yield of the t-BEX65 strain is shown as a percentage (%) relative to the t-BEX65 strain cultured at 25° C. More specifically, as indicated in Table 4, the t-BEX65 strain comprising the mutant SPT5 SNP (G→A) and the restored GEF1 gene had an 8% decrease in total protein yield at 28° C. compared to the total protein yield at 25° C. Similarly, as shown in Table 4, the total protein yield of t-BEX65 at 29° C. was increased by 4% compared to the total protein yield at 25° C., and by 12% compared to the total protein yield at 28° C.

[0334] Table 4 Fermentation tank performance of T-BEX65

[0335] Temperature productivity* 25 100 28 92 29 104

[0336] Productivity* = g protein / gDCW / hr as a percentage (%) of T-BEX65 at 25°C

[0337] References

[0338] PCT Publication No. WO 2011 / 153449

[0339] PCT Publication No. WO 2014 / 047520

[0340] PCT Publication No. WO 2016 / 100272

[0341] PCT Publication No. WO 2016 / 100562

[0342] PCT Publication No. WO 2016 / 100568

[0343] PCT Publication No. WO 2016 / 100571

[0344] PCT Publication No. WO 2021 / 092356

[0345] U.S. Patent No. 6,022,725

[0346] U.S. Patent No. 6,255,115

[0347] U.S. Patent No. 6,268,328

[0348] Ausubel et al., "Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987, 1989 and 2003).

[0349] Cao et al., "Penicillopepsin-JT2, a recombinant enzyme from Penicilliumjanthinellum and the contribution of a hydrogen bond in subsite S3 to kcat", Protein Science (9): 991-1001, 2000.

[0350] Devereux et al., Nucleic Acids Res. 12:387-395, 1984.

[0351] Needleman and Wunsch, "A general method applicable to the search for similarities in the amino acid sequence of two proteins", J. Mol. Biol. 48: 443-453, 1970.

[0352] Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988.

[0353] Sambrook et al.,Molecular Cloning,A Laboratory Manual,2 nd Edition,ColdSpring Harbor Laboratory Press,Cold Spring,New York,1989.

[0354] Sambrook et al.,Molecular Cloning,A Laboratory Manual,4 th Edition,ColdSpring Harbor Laboratory Press,Cold Spring,New York,2012.

[0355] Sheir-Neiss and Montenecourt,"Characterization of the secretedcellulases of Trichoderma reesei wild type and mutants during controlledfermentations",Applied Microbiology and Biotechnology,20(1):46-53,1984.

[0356] Smith and Waterman,Adv.Appl.Math.2:482,1981.

[0357] Wood,“The cellulase of Fusarium solani.Purification and specificityof theβ-(1→4)-glucanase and theβ-d-glucosidase components”,Biochem.J.,121:353-362,1971.

Claims

1. A recombinant filamentous fungal cell derived from a parent filamentous fungal cell comprising a gene encoding a native SPT5 protein, wherein the recombinant cell comprises a genetic modification that renders the cell defective in expression of the native SPT5 protein.

2. The recombinant cell of claim 1, wherein the parent cell expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.

3. The recombinant cell of claim 1, comprising an increased protein productivity phenotype relative to the parental cell when cultured under identical conditions at a temperature between about 25°C and 29°C.

4. The recombinant cell of claim 1, wherein the gene encoding the native SPT5 protein is at least 90% identical to SEQ ID NO:

1.

5. The recombinant cell of claim 1, wherein the native SPT5 protein is at least 90% identical to SEQ ID NO:

2.

6. The recombinant cell of claim 1 , wherein the native SPT5 protein comprises at least one domain selected from the group consisting of: an SPT5 N-terminal domain (NTD) at least 95% identical to SEQ ID NO: 5, a NusG superfamily (NGN) domain at least 95% identical to SEQ ID NO: 6, and an SPT5 C-terminal domain (CTD) at least 95% identical to SEQ ID NO:

7.

7. The recombinant cell of claim 3, wherein the protein productivity-enhancing phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity.

8. A mutant Trichoderma reesei cell comprising a mutant SPT5 gene having a guanine (G) to adenine (A) single nucleotide polymorphism (SNP) mutation in the SPT5 gene coding sequence (CDS) at nucleotide position 2,790 of SEQ ID NO:

3. 9 . The mutant cell of claim 8 , wherein the gene encoding the native SPT5 protein is at least 90% identical to SEQ ID NO:

1.

10. The mutant cell of claim 8, wherein the native SPT5 protein is at least 90% identical to SEQ ID NO:

2.

11. An isolated SPT5 gene variant having at least 90% identity to SEQ ID NO: 3 and comprising a guanine (G) to adenine (A) single nucleotide polymorphism (SNP) mutation at nucleotide position 2,790 of SEQ ID NO:

3.

12. A method for producing increased amounts of a lignocellulose-degrading enzyme in a modified filamentous fungal cell, the method comprising: (a) obtaining a parent filamentous fungal cell having a gene encoding a native SPT5 protein, genetically modifying the parent cell to obtain a modified filamentous fungal cell defective in the expression of the native SPT5 protein, and (b) fermenting the modified cells under suitable conditions to produce lignocellulose degrading enzymes, wherein the amount of the lignocellulose degrading enzyme produced by the modified cell is increased relative to the parent cell when fermented under the same conditions at a temperature between about 25°C and 29°C.

13. The method of claim 12, wherein the gene encoding the natural SPT5 protein has at least 90% identity to the polynucleotide of SEQ ID NO:

1.

14. The method of claim 12, wherein the lignocellulose degrading enzyme is selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases, and beta-glucosidases.

15. The method of claim 12, wherein the genetic modification that renders the cell defective in expression of the native SPT5 protein comprises a complete deletion of the wild-type (WT) SPT5 gene coding sequence (CDS), a partial deletion of the WT SPT5 gene CDS, a complete or partial deletion of the upstream WT SPT5 gene promoter, a disruption of the WT SPT5 gene CDS, a disruption of the upstream WT SPT5 gene promoter, or an antisense nucleic acid sequence complementary to a portion of the WT SPT5 CDS and / or the upstream WT SPT5 gene promoter.

16. A method for producing increased amounts of a heterologous protein of interest (POI) in a modified filamentous fungal cell, the method comprising: (a) obtaining a parent filamentous fungal cell having a gene encoding a native SPT5 protein, genetically modifying the parent cell to obtain a modified filamentous fungal cell defective in expression of the native SPT5 protein, wherein an expression cassette encoding the POI is introduced into the parent cell before, during or after rendering the cell defective in production of the native SPT5 protein, and (b) fermenting the modified cells under suitable conditions to produce the heterologous POI, wherein the modified cell produces an increased amount of the POI relative to the parent cell when fermented under the same conditions at a temperature between about 25°C and 29°C.

17. The method of claim 17, wherein the gene encoding the natural SPT5 protein has at least 90% identity to the polynucleotide of SEQ ID NO:

1.

18. The method of claim 17, wherein the expression cassette encodes a heterologous POI selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor, and a hormone.

19. The method of claim 17, wherein the genetic modification that renders the cell defective in expression of the native SPT5 protein comprises a complete deletion of the wild-type (WT) SPT5 gene coding sequence (CDS), a partial deletion of the WT SPT5 gene CDS, a complete or partial deletion of the upstream WT SPT5 gene promoter, a disruption of the WT SPT5 gene CDS, a disruption of the upstream WT SPT5 gene promoter, or an antisense nucleic acid sequence complementary to a portion of the WT SPT5 CDS and / or the upstream WT SPT5 gene promoter.

Images