Deep-sea archaea high-temperature alpha-glucosidase mutant and application thereof

Abstract

The invention relates to the technical field of biology, and particularly discloses a deep-sea archaea high-temperature alpha-glucosidase mutant and application, and the gene sequence of the mutant is shown as SEQ ID NO.1. The mutant can be used for preparing products for promoting the growth of probiotics. According to the invention, corresponding alanine site-directed mutants S207A, M182A and K196A are respectively constructed on the basis of key substrate binding sites S207, M182 and K196, which are screened by virtue of AutoDockVina molecular docking, and the alanine site-directed mutants S207A, M182A and K196A are respectively constructed on the basis of the key substrate binding sites S207, M182 and K196. The strategy of selecting alanine as a substitute residue is derived from the characteristics of no charge, small volume and hydrophobicity, so that the disturbance to the whole structure of the protein is minimized, and meanwhile, the path of substrate entry and product release is optimized possibly by reducing steric hindrance. According to the three mutants, the catalytic efficiency is improved to different degrees, and the effectiveness of a site-directed mutagenesis strategy based on structural information guidance in enzyme performance modification is embodied. The mutant can promote the growth of probiotics.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a deep-sea archaeal high-temperature α-glucosidase mutant and applications thereof. Background Art

[0002] α-Glucosidase, also known as maltase and α-transglucosidase, cleaves α-1,4-glycosidic bonds from the non-reducing ends of oligosaccharide substrates, releasing glucose, or transfers the freed glucose residue to another substrate via an α-1,6-glycosidic bond, thereby producing non-fermentable isomaltooligosaccharides (IMOs), glycolipids, or glycopeptides. α-Glucosidase is used as a saccharifying enzyme in the starch processing industry, working with α-amylase to produce high-glucose syrups. α-Glucosidase is widely distributed in animals, plants, and microorganisms, primarily in the GH4, GH13, GH31, GH63, GH97, and GH122 families. GH13 and GH31 are the two main species of α-glucosidase, distinguishable by their substrate affinity. Enzymes play an important role in biocatalytic reactions but are often limited by their catalytic activity and stability. By mutating the enzyme gene, enzyme mutants with improved performance can be obtained, thereby improving the application efficiency of the enzyme in industrial production.

[0003] α-glucosidase is mainly derived from Aspergillus, but as an intracellular enzyme, its secretion amount is relatively small. Traditional cell wall breaking extraction methods are not only time-consuming and costly, but also have low purity of the obtained product. These problems greatly limit the efficient production of oligosaccharides. Moreover, in the large-scale production and application process, most of them are carried out under relatively extreme temperature environments, which have high temperature requirements for α-glucosidase. Therefore, recombinant expression of high-temperature α-glucosidase of thermophilic archaea is an important way to meet industrial production conditions. In order to break through the existing bottleneck, it is urgent to develop an α-glucosidase gene expression system with high efficiency, low cost, high temperature resistance, high conversion rate and simple operation, so as to promote the rapid development of oligosaccharide production and processing industry. For this purpose, a deep-sea archaea high-temperature α-glucosidase mutant and its application are provided. Summary of the Invention

[0004] The purpose of the present invention is to address the defects of the existing technology and provide a deep-sea archaea high-temperature α-glucosidase mutant and its application to solve the problems raised by the above background technology.

[0005] To achieve the above object, the present invention provides the following technical solution: an α-glucosidase mutant from the deep-sea hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1, characterized in that the gene sequence of the mutant is shown in SEQ ID NO.1.

[0006] Use of the aforementioned α-glucosidase mutant from the deep-sea hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 in preparing a product for promoting the growth of probiotics.

[0007] A method for preparing the aforementioned α-glucosidase mutant from the deep-sea hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 is characterized by the following specific steps:

[0008] Step 1: The α-glucosidase sequence from the hyperthermophilic archaeon KOD1 was sent to Shanghai Bioengineering for synthesis. The synthesized α-glucosidase gene was subjected to molecular docking and site-directed mutagenesis to obtain the mutant sequence and extract the plasmid;

[0009] Step 2: Transform the plasmid into E. coli DH5α competent cells, place on ice for 30 minutes, heat shock in a 42°C water bath for 90 seconds, quickly transfer to an ice bath for 2-3 minutes, add 600 μL of antibiotic-free LB medium to each centrifuge tube, mix well, and incubate at 37°C, 180 rpm for 1-1.5 hours. Take 100 μL of the bacterial solution and spread it on LB solid medium containing 50 μg / mL kanamycin and incubate at 37°C for 12-15 hours.

[0010] Step 3: Pick a single colony and inoculate it into LB solid medium containing kanamycin, culture it at 37℃ for 6-8h, and amplify the target gene using Taq PCR Master Mix;

[0011] Step 4: Transform the extracted E. coli DH5α plasmid into E. coli BL21 competent cells, place on ice for 30 minutes, place in a 42°C water bath for 60-90 seconds, immediately transfer to ice for 2 minutes, add 600 μL LB liquid medium, and incubate in a constant temperature shaker at 37°C, 150 rpm for 1.5 hours; spread 100 μL of the bacterial solution on LB solid medium and incubate at 37°C for 12-14 hours;

[0012] Step 5: Take a single colony and inoculate it into LB liquid medium containing kanamycin, culture at 37℃, 180r / min for 4-6h, and OD 600 When the OD value is about 0.8, 2% inoculum is inoculated into LB liquid medium, cultured at 37℃, 180r / min for 4-5h, and the OD value is 600 When the pH was about 0.8, isopropyl-β-D-thiogalactoside was added to a final concentration of 0.5 mmol / L, the temperature was 16°C, and the fermentation was carried out for 48 h;

[0013] Step 6: After induction, centrifuge the bacterial solution at 12000g for 15 minutes, discard the supernatant, and wash the bacteria three times with PBS buffer. Finally, use PBS buffer to concentrate the total volume of the bacterial solution 10 times and resuspend the bacteria. Use an ultrasonic disruptor to disrupt for 2 seconds, rest for 3 seconds, and ultrasonically disrupt for 20 minutes. After the disruption is completed, centrifuge at 12000g for 15 minutes. After ultrafiltration, take the supernatant as the crude enzyme solution and measure the enzyme activity.

[0014] As a preferred technical solution of the present invention, the composition of LB culture medium is: 0.5% yeast powder, 1% tryptone, 1% NaCl, pH 7.4.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention is based on the key substrate binding sites S207, M182 and K196 screened out by AutoDockVina molecular docking, and the corresponding alanine site-directed mutants S207A, M182A and K196A are constructed respectively. The strategy of selecting alanine as a replacement residue is based on its uncharged, small size and hydrophobic properties, which helps to minimize the disturbance to the overall structure of the protein, and may also optimize the path of substrate entry and product release by reducing steric hindrance. These three mutants all improve the catalytic efficiency to varying degrees, reflecting the effectiveness of the site-directed mutagenesis strategy guided by structural information in enzyme performance modification. Especially under the application requirements of preparing high-polymerization oligosaccharides, the improvement of reaction rate and the enhancement of substrate flux are of great significance to improving product yield. This mutant can promote the growth of probiotics. Therefore, this type of highly active mutant has broad application prospects in the preparation of functional oligosaccharides, the development of prebiotics and intestinal health-related food additives. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is a molecular docking diagram of α-glucosidase of the present invention;

[0018] Figure 2 This is the LigPlus molecular docking result of the α-glucosidase of the present invention;

[0019] Figure 3 This is the PCR amplification diagram of the target gene of the mutant enzyme of the present invention;

[0020] Figure 4 The optimal temperature and pH of the mutant enzyme of the present invention;

[0021] Figure 5 This is a TLC analysis of the hydrolyzate of the mutant enzyme of the present invention;

[0022] Figure 6 This is an HPLC chart of the hydrolysis product analysis of the mutant enzyme of the present invention;

[0023] (Figure a: maltose is the glycosyl donor and lactose is the glycosyl acceptor; Figure b: maltose is the glycosyl donor and fucosyllactose is the glycosyl acceptor);

[0024] Figure 7 This is the effect of the transglycoside product of the present invention on the growth of the probiotic Lactobacillus plantarum.

[0025] Figure 8 This is the effect of the transglycoside product of the present invention on the growth of the probiotic Lactobacillus salivarius.

[0026] Figure 9 This is the effect of the transglycoside product of the present invention on the growth of the probiotic Lactobacillus fermentum. DETAILED DESCRIPTION

[0027] The preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the protection scope of the present invention.

[0028] Example 1: A method for producing an α-glucosidase mutant using the hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 strain, comprising the following steps:

[0029] Step 1: Find the sequence of the KOD1 strain in Gen Bank. The sequence number is BAD85623.1. Use software to design two restriction sites at the 5' and 3' ends of the sequence and design primers: KOD-F: (5'-ACGGAGCTCGAATTCGGATCCGTGAAAAGCAGGGATATTCTTCTGG-3'); KOD-R: (5'-GGATAACAATTCCCCTCTAGACTAAAGGAAAGCGTGCCTGTG-3')

[0030] Step 2: AutoDock vina molecular docking software was used to perform molecular docking of maltose, isomaltotriose (IMO3), isomaltotetraose (IMO4), and isomaltopentaose (IMO5) with α-glucosidase to simulate the corresponding binding sites. The docking results were then analyzed using PyMOL software. Based on the docking results, binding energies, the number and location of hydrogen bonds, and inhibition constants were analyzed, and sites with high docking scores were selected for site-directed mutagenesis. The interaction patterns between amino acids and IMOs were analyzed using LigPlus and PLIP online software.

[0031] Step 3: Design primers based on the mutation site, and obtain the mutated gene sequence by PCR, which is shown in SEQ ID NO.1. A two-step PCR method is used for target gene mutation. In the first step, the template is separated from the upstream and downstream front-end proteins and PCR amplification is performed. The amplification process includes pre-denaturation at 98°C for 5 minutes, denaturation at 98°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 3 minutes, repeated 34 cycles, and then extended at 72°C for 5 minutes. In the second step, the PCR reaction solution in the first step is transferred to a new PCR tube, and the steps are the same as the first step. The ligation product is then transformed into Escherichia coli DH5α, and the positive clones are selected for verification to confirm that the target site mutation is successful. The plasmid was extracted and expressed in competent E. coli BL21 cells. Single colonies were selected and inoculated into LBK liquid medium for colony PCR verification. Successful cultures were inoculated into LBK liquid medium for fermentation. Isopropyl β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mmol / L and induced at 16°C, 180 rpm, for 48 hours. After induction, the culture was centrifuged at 12,000 g for 15 minutes, the supernatant removed, and the cells washed three times with PBS buffer. Finally, the culture was concentrated 10-fold in PBS buffer and resuspended. Ultrasonication was used, with a 2-second interruption and a 3-second interval, for 20 minutes. After the end of the disruption, the supernatant was centrifuged at 12,000 g for 15 minutes. The supernatant was then ultrafiltered through a 10 kDa membrane to purify the enzyme extract.

[0032] Step 4: To determine the optimal temperature for the mutant enzyme, enzyme activity was measured at 50, 60, 70, 80, 90, and 100°C. To determine the temperature stability of the mutant enzyme, the mutant enzyme was incubated at 80, 90, and 100°C for 4 hours, with samples taken every 30 minutes and stored at 4°C. Finally, all samples were assayed for enzyme activity.

[0033] Step 5: In the optimal pH determination of the mutant enzyme, the enzyme activity was determined using 50 mM sodium acetate (pH 4.0-6.0), PBS buffer (pH 6.0-7.5), and Tris-HCl buffer (pH 7.5-8.5) as buffers. In the pH stability determination of the mutant enzyme, the mutant enzyme was mixed with 50 mM sodium acetate (pH 4.0-6.0), PBS buffer (pH 6.0-7.5), and Tris-HCl buffer (pH 7.5-8.5), respectively, and incubated in a water bath at the optimal temperature of the enzyme for 1 hour. After the water bath, the samples were stored at 4°C and the enzyme activity was determined.

[0034] Step 6: The transglycosidic effect of the mutant enzyme was studied, with 3% maltose as the glycosyl donor and 3% glucose, sucrose, lactose, trehalose, fucose, and fucosyllactose as the glycosyl acceptors, and the corresponding amount of enzyme solution was added. The reaction was carried out in an 80°C water bath for 6 hours, and then in a boiling water bath for 5 minutes. The supernatant was collected and filtered with a 0.22 μm filter membrane, and the reaction products were detected by TLC and HPLC.

[0035] Step 7: The mutant enzyme was reacted with a mixture of maltose and fucosyllactose at 80°C for 18 hours, and then freeze-dried for 24 hours after the reaction to obtain oligosaccharides. Then, it was added to MRS medium at concentrations of 5% and 10%. Three probiotics, Lactiplantibacillus plantarum, Lactobacillus salivarius, and Limosilactobacillus fermentum, were added to MRS medium without oligosaccharides, respectively, and cultured at 37°C for 16 hours under anaerobic conditions. The resulting bacterial liquid was used as a seed liquid. The above seed liquid was inoculated into MRS medium containing different concentrations of IMOs at an inoculum size of 1%, and the MRS medium without IMOs was used as a control, and three parallel groups were set for each concentration. Cultured under anaerobic conditions at 37°C. Samples were taken every 4 hours to measure their OD 600 All data were statistically analyzed using SPSS software, and the mean differences were compared using the independent sample T test at the 95% significance level.

[0036] Example 2: Molecular docking and site-directed mutagenesis of the original sequence. Maltose, IMO3, IMO4, IMO5 and α-glucosidase were molecularly docked using AutoDock vina molecular docking software. The docking points are as follows: Figure 1 and Figure 2 As shown, 10 binding sites were obtained, namely L153, S157, S207, A172, A195, P150, M182, Q212, D192, and K196. After subsequent comparison, three sites, S207, M182, and K196, were selected for mutation. Compared with other amino acids, alanine is an uncharged hydrophobic amino acid. Alanine has less steric hindrance and has less impact on protein structure. It can also increase the size of the substrate binding pocket to a certain extent, thereby promoting the binding of the enzyme to the substrate. Therefore, all amino acids at the sites were mutated to Ala. The gene sequences of the mutant enzymes are as follows:

[0037] (1) K196 site

[0038] Gtgaaaagcagggatattcttctggagacagccgaggttcttgagtccacactcgataaaatcgacaggctcaaggtgctctcggagaaagag

[0039] aaggaggccgttaaaaccaaactaaaaaacgctgcggcgaatttcaaaaagctggccgaggaagctgagaaggacaacgaggaactggctg

[0040] agttcttcctgaagaaggcgaaggagctgaagctggcgagcgttgataagaaaatcgaggagatggggaagaaagaatatctaaaactggtta

[0041] acaggattgaactctactcccgttcagctgagtacgacttcaagccagaaaagctcgccgagctgaaaagagtctatcgtaagtacatcttcgga

[0042] atgacgtcgttcttcatactgacgggaatctacttgaatcaattcctggcggtgacggcgctaatccttgcgataccgataatactctcgatgctgtc

[0043] cctccagaggaggggctacctcgggcttctgctggcatattcagccataccaataccgctgatagtcggcgcaatggcggcaagctacggaat

[0044] cagggccctcaacgatccagcagcgatcgcggagatagcgggacaccttaacaagagcactaccttcgcgcagggatacctcgtcgtcctaacgctcctcgccgcggtagagctctacctcctgatcagcgcagcggtggagctttacaggcacaggcacgctttcctttag.

[0045] (2) M182 site

[0046] Gtgaaaagcagggatattcttctggagacagccgaggttcttgagtccacactcgataaaatcgacaggctcaaggtgctctcggagaaagag

[0047] aaggaggccgttaaaaccaaactaaaaaacgctgcggcgaatttcaaaaagctggccgaggaagctgagaaggacaacgaggaactggctg

[0048] agttcttcctgaagaaggcgaaggagctgaagctggcgagcgttgataagaaaatcgaggagatggggaagaaagaatatctaaaactggtta

[0049] acaggattgaactctactcccgttcagctgagtacgacttcaagccagaaaagctcgccgagctgaaaagagtctatcgtaagtacatcttcgga

[0050] atgacgtcgttcttcatactgacgggaatctacttgaatcaattcctggcggtgacggcgctaatccttgcgataccgataatactctcgatgctgtc

[0051] cctccagaggaggggctacctcgggcttctgctggcatattcagccataccaataccgctgatagtcggcgcagcggcggcaagctacggaat

[0052] cagggccctcaacgatccagcaaagatcgcggagatagcgggacaccttaacaagagcactaccttcgcgcagggatacctcgtcgtcctaacgctcctcgccgcggtagagctctacctcctgatcagcgcagcggtggagctttacaggcacaggcacgctttcctttag.

[0053] (3) Site S207

[0054] Gtgaaaagcagggatattcttctggagacagccgaggttcttgagtccacactcgataaaatcgacaggctcaaggtgctctcggagaaagag

[0055] aaggaggccgttaaaaccaaactaaaaaacgctgcggcgaatttcaaaaagctggccgaggaagctgagaaggacaacgaggaactggctg

[0056] agttcttcctgaagaaggcgaaggagctgaagctggcgagcgttgataagaaaatcgaggagatggggaagaaagaatatctaaaactggtta

[0057] acaggattgaactctactcccgttcagctgagtacgacttcaagccagaaaagctcgccgagctgaaaagagtctatcgtaagtacatcttcgga

[0058] atgacgtcgttcttcatactgacgggaatctacttgaatcaattcctggcggtgacggcgctaatccttgcgataccgataatactctcgatgctgtc

[0059] cctccagaggaggggctacctcgggcttctgctggcatattcagccataccaataccgctgatagtcggcgcaatggcggcaagctacggaat

[0060] cagggccctcaacgatccagcaaagatcgcggagatagcgggacaccttaacaaggcgactaccttcgcgcagggatacctcgtcgtcctaacgctcctcgccgcggtagagctctacctcctgatcagcgcagcggtggagctttacaggcacaggcacgctttcctttag.

[0061] Example 3: Properties of the Mutant Enzyme

[0062] Step 1: Preparation of the Crude Enzyme Solution

[0063] The plasmid extracted after transformation into E. coli DH5α was re-transformed into E. coli BL21 competent cells. 100 μL of bacterial solution was spread on LB plates containing 50 μg / mL kanamycin and cultured inverted at 37°C for 12-16 hours. A single colony was picked and inoculated into LBK liquid medium for colony PCR verification. Figure 3 After verification, gel electrophoresis was performed, and the bacterial solution with successful test results was inoculated into LBK liquid medium for fermentation. The culture was cultured at 37°C, 180 rpm for 6 to 8 hours until the OD 600 =0.6-0.8, then the cells were maintained and isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM. The cells were induced at 16°C, 180 rpm for 48 hours. After induction, the bacterial solution was centrifuged at 12,000 g for 15 minutes, the supernatant discarded, and the cells were washed three times with PBS buffer. Finally, the total volume of the bacterial solution was concentrated 10 times with PBS buffer and resuspended. The cells were ultrasonically disrupted for 2 seconds, 3 seconds, and ultrasonically disrupted for 20 minutes. After disruption, the cells were centrifuged at 12,000 g for 15 minutes. Finally, the supernatant was collected and ultrafiltered using a 10 kDa membrane to purify the enzyme extract.

[0064] Step 2: Effect of temperature on enzyme activity

[0065] In the optimal temperature determination of the mutant enzyme, 20 mmol / L p-nitrophenyl-α-D-pyranoglucoside (pNPG) was used as the substrate and the enzyme activity was determined at 50, 60, 70, 80, 90, and 100°C. Figure 4 As shown, the optimum temperature of the mutant enzyme is 100°C.

[0066] Step 3: Effect of pH on enzyme activity

[0067] In the determination of the optimal pH of the mutant enzyme, 20 mmol / L p-nitrophenyl-α-D-pyranoglucoside (pNPG) was used as a substrate, and 50 mM sodium acetate (pH 4.0-6.0), PBS buffer (pH 6.0-7.5) and Tris-HCl buffer (pH 7.5-8.5) were used as buffers to determine the enzyme activity. In the determination of the pH stability of the mutant enzyme, the mutant enzyme was mixed with 50 mM sodium acetate (pH 4.0-6.0), PBS buffer (pH 6.0-7.5) and Tris-HCl buffer (pH 7.5-8.5), respectively, and placed in a water bath at the optimal temperature of the enzyme for 1 hour. After the water bath, the sample was stored at 4°C, and finally the enzyme activity was determined. Figure 4 As shown, the optimal pH of the mutant enzyme is 6.

[0068] Example 4: Analysis of hydrolysis products of mutant enzymes

[0069] 3% maltose was used as the glycosyl donor, and 3% glucose, sucrose, lactose, trehalose, fucose, and fucosyllactose were used as the glycosyl acceptors. The corresponding amount of enzyme solution was added, and the mixture was reacted in an 80°C water bath for 6 hours, then in a boiling water bath for 5 minutes, and centrifuged at 8000r for 5 minutes. The supernatant was collected and filtered with a 0.22μm filter membrane. The reaction products were then detected by TLC and HPLC. Figure 5 and Figure 6 Based on the results, lactose and fucosyllactose were selected for subsequent experimental studies. TLC and HPLC analysis revealed that the products contained trisaccharides, tetrasaccharides, and heptasaccharides when 3% maltose was used as the glycosyl donor and 3% lactose and fucosyllactose were used as the glycosyl acceptors.

[0070] Example 5: Effects of transglycoside products on probiotics

[0071] The mutant enzyme solution was reacted with a mixture of maltose and fucosyllactose for 18 hours and then freeze-dried. The freeze-dried hydrolyzate was added to MRS culture medium at an addition rate of 5% and 10%, and the three probiotics were inoculated and their growth was observed.

[0072] like Figure 7 As shown in the results, fucosylated oligosaccharides promote the growth of Lactobacillus plantarum. At an 8-hour incubation time, the 10% addition had a significantly greater promoting effect than the 5% addition. At a 12-hour incubation time, there was no significant difference in the promoting effect of the 5% and 10% additions on the growth of the probiotic. At a 16-hour incubation time, the 5% addition significantly increased the promoting effect on the growth of the probiotic.

[0073] like Figure 8 As shown, fucosylated oligosaccharides promote the growth of Lactobacillus salivarius. The promoting effect is significant at 4 and 8 hours of culture, and is further enhanced at 12 and 16 hours of culture.

[0074] like Figure 9 As shown in the results, fucosylated oligosaccharides promoted the growth of Lactobacillus mucilaginosus. The promoting effect was not significant at 4 h of culture, but increased significantly at 8, 12, and 16 h of culture.

[0075] The above embodiments merely illustrate the implementation methods of the present invention. Although the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the scope of the present invention, and these modifications and improvements fall within the scope of protection of the present invention.

Claims

1. An α-glucosidase mutant from the deep-sea hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1, characterized in that: The gene sequence of the mutant is shown in SEQ ID NO.

1.

2. Use of the α-glucosidase mutant from the deep-sea hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 according to claim 1 in the preparation of a product that promotes the growth of probiotics.

3. A method for preparing an α-glucosidase mutant from the deep-sea hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 according to claim 1, characterized in that: The specific steps are as follows: Step 1: The α-glucosidase sequence from the hyperthermophilic archaeon KOD1 was sent to Shanghai Bioengineering for synthesis. The synthesized α-glucosidase gene was subjected to molecular docking and site-directed mutagenesis to obtain the mutant sequence and extract the plasmid; Step 2: Transform the plasmid into E. coli DH5α competent cells, place on ice for 30 minutes, heat shock in a 42°C water bath for 90 seconds, quickly transfer to an ice bath for 2-3 minutes, add 600 μL of antibiotic-free LB medium to each centrifuge tube, mix well, and incubate at 37°C, 180 rpm for 1-1.5 hours. Take 100 μL of the bacterial solution and spread it on LB solid medium containing 50 μg / mL kanamycin and incubate at 37°C for 12-15 hours. Step 3: Pick a single colony and inoculate it into LB solid medium containing kanamycin, culture it at 37℃ for 6-8h, and amplify the target gene using Taq PCR Master Mix; Step 4: Transform the extracted E. coli DH5α plasmid into E. coli BL21 competent cells, place on ice for 30 minutes, place in a 42°C water bath for 60-90 seconds, immediately transfer to ice for 2 minutes, add 600 μL LB liquid medium, and incubate in a constant temperature shaker at 37°C, 150 rpm for 1.5 hours; spread 100 μL of the bacterial solution on LB solid medium and incubate at 37°C for 12-14 hours; Step 5: Take a single colony and inoculate it into LB liquid medium containing kanamycin, culture at 37℃, 180r / min for 4-6h, and OD 600 When the OD value is about 0.8, 2% inoculum is inoculated into LB liquid medium, cultured at 37℃, 180r / min for 4-5h, and the OD value is 600 When the pH was about 0.8, isopropyl-β-D-thiogalactoside was added to a final concentration of 0.5 mmol / L, the temperature was 16°C, and the fermentation was carried out for 48 h; Step 6: After induction, centrifuge the bacterial solution at 12000g for 15 minutes, discard the supernatant, and wash the bacteria three times with PBS buffer. Finally, use PBS buffer to concentrate the total volume of the bacterial solution 10 times and resuspend the bacteria. Use an ultrasonic disruptor to disrupt for 2 seconds, rest for 3 seconds, and ultrasonically disrupt for 20 minutes. After the disruption is completed, centrifuge at 12000g for 15 minutes. After ultrafiltration, take the supernatant as the crude enzyme solution and measure the enzyme activity.

4. The method according to claim 3, wherein: The composition of LB medium is: 0.5% yeast powder, 1% tryptone, 1% NaCl, pH 7.4.

Images