Nucleic acid aptamer for detecting protein of transgenic ingredient CP4-EPSPS in transgenic soybean

Abstract

The invention provides a nucleic acid aptamer for protein detection of a transgenic component CP4-EPSPS in transgenic soybeans. The nucleotide sequence of the nucleic acid aptamer is shown as SEQ ID No.1 or SEQ ID No.2. The invention also provides a preparation method of the nucleic acid aptamer for protein detection of the transgenic component CP4-EPSPS in transgenic soybeans. The two aptamers provided by the invention have relatively strong specificity to CP4 EPSPS protein, the detection limit can reach 2 ng / kg, the recovery rate is 88.34%-112.12%, the precision reaches 5.18%, and the two aptamers have relatively good reproducibility.

Description

Technical Field

[0001] The present invention relates to the technical field of CP4-EPSPS protein detection, in particular to a nucleic acid aptamer for detecting the CP4-EPSPS protein, a genetically modified component in genetically modified soybeans. Background Art

[0002] With the continuous advancement of biotechnology, the pace of research and development of genetically modified crops and the area of ​​cultivation continue to grow globally. my country's imports of genetically modified soybeans have increased annually. The improved traits of imported genetically modified soybeans are primarily focused on insect resistance, herbicide tolerance, and quality. Herbicide-resistant genetically modified soybeans are the most common, occupying a key position in agricultural production. The CP4 EPSPS protein (5-enolpyruvylshikimate-3-phosphate synthase) is a common herbicide-resistant protein derived from Agrobacterium tumefaciens. It is often used in the development of herbicide-resistant genetically modified crops and is widely present in many genetically modified soybean varieties. It is one of the important targets for detecting genetically modified ingredients.

[0003] Currently, the main methods for detecting genetically modified ingredients include DNA-based PCR amplification and protein-based ELISA immunoassays. PCR, with its high sensitivity and specificity, is suitable for qualitative or quantitative detection of genetically modified ingredients. ELISA, on the other hand, identifies genetically modified ingredients by detecting specific protein expression. While simple to operate and low-cost, its sensitivity and stability are significantly affected by antibody quality, and it is susceptible to interference in complex food matrices, resulting in limitations in reproducibility and accuracy.

[0004] Aptamers are single-stranded nucleotides that can bind to their target molecules through a unique structure formed by their own curling and folding. The diversity of single-stranded nucleotide sequences and spatial structures allows them to form complex tertiary structures when encountering different targets due to electrostatic interactions, hydrogen bonding, or complementary base pairing. This allows them to recognize and specifically bind to a variety of target molecules. Aptamers have the advantages of high affinity, high specificity, good chemical stability, and strong modifiability, showing broad application prospects in food safety testing, environmental monitoring, and clinical diagnosis. The recognition mode of aptamers and targets is similar to that of antibodies, and they are called "chemical antibodies." Compared with traditional antibodies, aptamers can be obtained through in vitro screening using the SELEX technology, avoiding the animal immunization process, and are easy to scale up and modify, making them suitable for the construction of new high-sensitivity detection platforms.

[0005] However, there are currently no reports on the design of nucleic acid aptamers specifically targeting the CP4 EPSPS protein and their practical application in genetically modified soybeans. Furthermore, existing detection methods still have shortcomings in sensitivity, selectivity, and stability, especially when testing low-concentration samples, making it difficult to meet increasingly stringent food safety regulatory requirements. Summary of the Invention

[0006] In order to overcome the problems of low detection sensitivity, poor stability, and poor repeatability in the above-mentioned prior art, the present invention proposes a nucleic acid aptamer for detecting the genetically modified component CP4-EPSPS protein in genetically modified soybeans.

[0007] The technical solution of the present invention is achieved as follows: In the first aspect, the present invention provides a nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in transgenic soybeans, and the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID No. 1 and 2.

[0008] In a second aspect, the present invention also provides the use of nucleic acid aptamers in detecting the transgenic component CP4-EPSPS protein in transgenic soybeans.

[0009] On the basis of the above technical solution, preferably, the CP4-EPSPS protein detection method includes the following steps: S1, using magnetic bead-coupled nucleic acid aptamer Aptamer 1 to enrich and separate CP4 EPSPS protein in the sample; S2, the nucleic acid aptamer Aptamer2 labeled with a fluorescent dye binds to the enriched CP4 EPSPS protein to form the MBs-Capture Aptamer 1-CP4 EPSPS protein-Aptamer 2 complex; S3, detect and analyze the recovered fluorescence signal intensity to quantitatively detect the CP4 EPSPS protein; On the basis of the above technical solution, preferably, the Aptamer 1 and Aptamer 2 are nucleic acid aptamers, and the nucleotide sequences are shown as SEQ ID No. 1 and 2.

[0010] In a third aspect, the present invention further provides a kit for detecting CP4-EPSPS protein in transgenic soybeans, comprising the above-mentioned nucleic acid aptamer.

[0011] On the basis of the above technical solution, preferably, magnetic beads and fluorescent dyes are also included.

[0012] The nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in transgenic soybeans of the present invention has the following beneficial effects compared with the prior art: By rationally designing and optimizing the screening conditions, the nucleic acid aptamers obtained in this invention can achieve efficient recognition and quantitative detection of CP4EPSPS protein, with the following advantages: (1) High sensitivity: The detection limit reaches 2 ng / kg, which is significantly better than the traditional ELISA method. (2) Good recovery rate: The recovery rate in complex food matrices is stable at 88.34%-112.12%, meeting international standards. (3) Excellent precision: The relative standard deviation (RSD) is less than 5.18%, with good intra- and inter-batch repeatability. (4) Good reproducibility: It is applicable to a variety of sample types and has strong anti-interference ability.

[0013] Therefore, the nucleic acid aptamer of the present invention fills the current technical gap in the molecular recognition of CP4 EPSPS protein, and provides new technical means and theoretical support for the safety supervision and rapid detection of genetically modified soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0015] Figure 1 Figure 1 is the partial sequence alignment result of EPSPS gene; Figure 2 This is the enzyme digestion identification diagram; Figure 3 a is an SDS-PAGE analysis of protein expression identification, M: protein molecular weight standard; 1: pET28a induction; 2: uninduced; 3: after induction; 4: supernatant after induction and disruption; 5: precipitate after induction and disruption; b is an SDS-PAGE analysis of protein purification, M: protein molecular weight standard; 1: sample after disruption; 2: outflow; 3-4: elution; c is an SDS-PAGE analysis of protein identification, M: protein molecular weight standard; 1: 0.5 mg / ml BSA; 2: sample after purification; Figure 4 To optimize the PCR amplification conditions, a is 25 cycles, b is 27 cycles; lane 1: Marker; lane 2: 61.2℃; lane 3: 58.8℃; lane 4: 55.9℃; lane 5: 53.6℃; lane 6: 52℃; Figure 5Figure a shows the results of PCR product purification, lane 1: Marker; lanes 2 and 3: purified products; b shows the results of PCR product digestion, lane 1: Marker; lanes 3, 4, 5, 7, 8, 9: 10 μL digestion products; lane 10: ssDNA library; Figure 6 This is the result diagram of nucleic acid aptamer recovery rate; Figure 7 This is a homology analysis diagram of high-throughput sequencing results; Figure 8 is the fluorescence analysis diagram of nucleic acid aptamer; Figure 9 is a diagram of CdTe / CdS / ZnS quantum dots; Figure 10 Figure 2 shows the specificity of the aptamer for CP4 EPSPS. DETAILED DESCRIPTION

[0016] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0017] 1. Cloning of CP4 EPSPS Full-length splicing primers were designed using the PAS (PCR-based Accurate Synthesis) method. The protective base synthesis gene EPSPS was designed at both ends of the primers and ligated between the NcoI (CCATGG)-XhoI (CTCGAG) sites of the vector pET-28a(+). The resulting recombinant plasmid pET-28a(+) - EPSPS was transformed into the TOP10 cloning strain.

[0018] Reagents and consumables: pET-28a(+) and TOP10 strains were provided by Zoonbio Biotechnology; restriction endonucleases (TaKaRa) and Pfu DNA polymerase (Zoonbio, Catalog No. PC12); Tyrptone and Yeast Extract (OXOID), Agarose (Shanghai Gene Company); DNA gel purification kit and plasmid mini-extraction kit (AXYGEN); PCR tubes, pipette tips and other consumables (Fisher); other reagents were domestically produced and of analytical or chemical grade.

[0019] pET-28a(+)-EPSPS sequencing verification: Full-length splicing primers were designed using the PAS (PCR-based Accurate Synthesis) method. The resulting recombinant plasmid pET-28a(+)-EPSPS was transformed into the TOP10 cloning strain. Positive clones were selected for sequencing. The sequencing results are shown below. The single-lined region represents the EPSPS gene region.

[0020] CCATGG GCATGGCTCAAATAAATAACATGGCACAGGGAATTCAGACCCTGAATCCAAATAGCAATTTT CATAAACCGCAGGTTCCGAAGTCTTCCAGTTTCCTGGTTTTTGGCAGCAAAAAGCTGAAGAACAGCGCGAATAGCA TGCTGGTTTTAAAGAAAGATAGCATCTTTATGCAAAAATTCTGCTCCTTCCGCATCAGCGCGAGCGTTGCTACCGC GTGTATGTTACATGGTGCGTCCAGCCGTCCGGCAACCGCAAGGAAGAGTAGCGGTTTGTCCGGCACCGTGCGCATC CCGGGCGACAAGTCGATCAGCCACCGTTCGTTCATGTTCGGTGGTTTGGCGTCGGGTGAGACGCGTATCACTGGTT TGCTGGAGGGCGAAGACGTTATCAATACGGGTAAGGCAATGCAGGCTATGGGTGCGCGTATCAGAAAAGAAGGCGA CACCTGGATTATCGACGGCGTGGGCAACGGCGGTTTATTGGCCCCGGAAGCTCCGTTGGACTTCGGAAACGCTGCG ACGGGGTGCCGTCTGACGATGGGTTTGGTCGGTGTCTATGATTTTGATTCGACCTTTATTGGTGACGCAAGCCTGA CCAAACGTCCGATGGGCCGTGTGCTTAACCCGCTGCGTGAAATGGGTGTCCAGGTTAAGAGCGAGGATGGCGACCG CCTGCCGGTGACCCTGCGTGGTCCGAAAACCCCGACTCCGATTACCTACCGCGTGCCGATGGCGTCTGCACAGGTT AAATCTGCGGTCCTGCTGGCGGGGTTGAACACGCCGGGTATTACCACCGTTATTGAGCCGATCATGACCTGCGATC ACACCGAAAAAATGCTGCAAGGTTTTGGTGCGAACCTGACCGTCGAAACCGATGCGGATGGTGTACGCACTATTCG TCTGGAGGGTCGTGGTAAACTGACCGGCCAAGTGATTGACGTGCCAGGCGACCCGTCAAGCACCGCGTTCCCGCTG GTTGCGGCTCTGCTGGTTCCGGGTTCCGATGTGACGATTCTGAACGTGCTGATGAATCCTACGAGAACAGGTTTGA TTCTGACTCTCCAAGAAATGGGTGCGGACATCGAGGTGATCAACCTGCGCCTAGCCGGCGGCGAGGACGTAGCGGA TCTGCGCGTGCGTTCCTCTACCTTGAAGGGTGTTACCGTTCCGGAGGACCGCGCACCACCGATGATCGACGAGTAC CCGATTCTGGCCGTCGCTGCGGCTTTCGCCGAAGGCGCGACGGTTATGAACGGCCTTGAGGAACTGCGTGTCAAGG AAAGCGACCGTTTAAGCGCAGTGGCCAACGGCCTGAAGTTGAATGGCGTGGACTGTGATGAGGGCGAGACGAGCCT GGTTGTTCGTGGTCGTCCGGATGGTAAAGGTCTGGGCAACGCATCTGGCGCGGCGGTGGCCACCCATCTGGACCAC CGCATCGCCATGAGCTTTCTGGTGATGGGTCTTGTGAGCGAGAACCCGGTTACCGTTGATGATGCCACCATGATCG CGACCAGCTTCCCGGAATTTATGGATCTGATGGCAGGTTTAGGTGCTAAAATTGAACTGAGCGATACCAAGGCAGC GCATCACCACCACCATCACTAA CTCGAG.

[0021] The sequencing results were compared with the expected sequence, and part of the alignment sequence was intercepted. Figure 1 shown.

[0022] Plasmid enzyme digestion identification, enzyme digestion system: plasmid 3 μL, endonuclease 1 0.25 μL, endonuclease 2 0.25 μL, 10× Buffer 1.0 μL, DDW up to 10 μL. The enzyme digestion identification results are as follows Figure 2 .

[0023] 2. Expression and Purification of CP4 EPSPS Protein The target protein, EPSPS, was expressed using IPTG induction. The expression conditions were optimized and adjusted to 15°C. Analysis revealed that the target protein was primarily expressed as inclusion bodies. EPSPS was resolubilized by renaturation and purified using a Ni column affinity purification technique.

[0024] Reagents: Urea (C0710110275) was purchased from Nanjing Chemical Reagent; Acr (V900845) and Bis (V900301) were purchased from Sigma; SDS (S8010), Tris (T8060), and TEMED (T8090) were purchased from Solarbio; Protein Marker (26610) was purchased from Thermo Scientific; IPTG (I104812) was purchased from Aladdin; Tryptone (LP0042) and Yeast Extract (LP0021) were purchased from OXIOD; TOP10 strain (ZDA0001), pET28a plasmid (ZDB0003), BL21 (DE3) expression bacteria (ZDB0003), and Ni-IDA affinity chromatography gel (ZDC0001) were purchased from Zoonbio.

[0025] 1 Experimental methods and results 1.1 Expression and identification of prokaryotic proteins The theoretical molecular weight of the protein is approximately 56.3 kD (including the tag). Amino acid sequence: MAQINNM.

[0026] 1.1.1 Transformation of pET28a-EPSPS vector into E. coli BL21 (DE3) Add 1 μL of plasmid to 100 μL of competent bacteria and place on ice for 20 minutes. Heat shock at 42°C for 90 seconds, quickly place on ice for 5 minutes, and add 600 μL of LB culture medium. Incubate at 37°C at 220 rpm for 1 hour. After centrifugation, spread the entire volume onto an LB plate containing 50 μg / mL Kan and incubate inverted at 37°C overnight.

[0027] 1.1.2 IPTG-induced expression of pET28a-EPSPS fusion protein Pick a single colony from the transformation plate and inoculate it into a test tube containing 3 mL LB culture medium with 50 μg / mL Kan, and shake it at 37°C 220 r / min overnight. The next day, inoculate it into 30 mL LB culture medium with 50 μg / mL Kan at a ratio of 1:100, and shake it at 37°C 220 r / min until the bacterial OD reaches 0. 600 The pH value was 0.6-0.8. Remove 1 mL of culture and centrifuge at 10,000 rpm for 2 min at room temperature. Discard the supernatant and resuspend the pellet in 100 μL of 1× loading buffer. Add IPTG to the remaining culture to a final concentration of 0.2 mM and shake overnight at 15°C and 220 rpm to induce fusion protein expression. Remove 1 mL of culture and centrifuge at 10,000 rpm for 2 min at room temperature. Discard the supernatant and resuspend the pellet in 100 μL of 1× loading buffer. Centrifuge the remaining culture at 4,000 rpm for 10 min, discard the supernatant, and resuspend the pellet in PBS. Ultrasonicate the resuspension, then remove the supernatant and pellet, respectively, and resuspend in loading buffer. Analyze by 12% SDS-PAGE and stain with Coomassie Brilliant Blue for visualization.

[0028] 1.1.3 Analysis of expression identification results The clones were picked and protein expression was induced by IPTG. After 12% SDS-PAGE analysis, the target protein was mainly present in the precipitate. Figure 3 As shown in a.

[0029] 1.2 Denaturation of inclusion body proteins (1) Resuspend the bacterial pellet in 20 mL of lysis buffer (20 mM Tris-HCl containing 1 mM PMSF and bacteria protease inhibitor cocktail, pH 8.0) and disrupt by ultrasonication (power 400 W, working 4 seconds, rest 8 seconds, total 20 minutes). (2) Centrifuge the ultrasonically disrupted cell lysate at 10,000 r / min at 4°C for 20 minutes and collect the precipitate. Wash the inclusion bodies three times with inclusion body washing buffer (20 mM Tris, 1 mM EDTA, 2 M urea, 1 M NaCl, 1% Triton X-100, pH 8.0). (3) Solubilize the inclusion bodies in a certain proportion with lysis buffer (20 mM Tris, 5 mM DTT, 8 M urea, pH 8.0), and place at 4°C overnight; then centrifuge at 10,000 r / min for 15 minutes at room temperature. (4) Add the above solution dropwise to 20 mM Tris-HCl, 0.15 M NaCl, pH 8.0 buffer, dilute gradually in a doubling gradient with slow stirring, and place the protein solution into a dialysis bag and dialyze overnight in 20 mM Tris-HCl, 0.15 M NaCl, pH 8.0 solution.

[0030] 1.3 Ni column affinity purification of fusion protein and analysis of results Ni column purification: Using a low-pressure chromatography system, the supernatant solution was loaded onto a Ni-IDA-Sepharose Cl-6B affinity chromatography column pre-equilibrated with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min. The column was rinsed with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min until the OD value of the effluent reached 0. 280 Wash with Ni-IDA Washing-Buffer (20 mM Tris-HCl, 20 mM imidazole, 0.15 M NaCl, pH 8.0) at a flow rate of 1 mL / min until the OD value of the effluent reaches 0.1%. 280 The target protein was eluted with Ni-IDA Elution Buffer (20 mM Tris-HCl, 250 mM imidazole, 0.15 M NaCl, pH 8.0) at a flow rate of 1 mL / min, and the flow-through was collected. The collected protein solution was placed in a dialysis bag and dialyzed overnight against PBS. Analyzed by 12% SDS-PAGE.

[0031] Analysis of purification results: The inclusion bodies were renatured to redissolve the target protein, which was then affinity purified by Ni column and analyzed by 12% SDS-PAGE.Figure 3 The concentration of the purified protein was determined by Bradford assay to be 0.8 mg / mL and used in subsequent experiments.

[0032] 3. Screening of CP4 EPSPS Protein Aptamers and Establishment of Reaction System 1. Graphene oxide method (GO-SELEX) screening Graphene oxide screening (GO-SELEX) is a classic immobilization-free aptamer screening method. During the screening process, free ssDNA accumulates and adsorbs to GO through strong π-π interactions. However, dsDNA, due to the shielding of the nucleobases by the phosphate backbone, is less strongly adsorbed by GO. This property allows centrifugation to separate free ssDNA from target-bound ssDNA. GO-SELEX avoids immobilization of the target or library during the screening process, allowing the binding of the target and ssDNA to be unaffected by steric hindrance and conformational changes, thereby improving screening efficiency. GO-SELEX has already identified aptamers targeting pesticides, avian influenza virus, and nicotinamide phosphoribosyltransferase, among other targets. The method is mature, simple to operate, and offers high screening efficiency.

[0033] 1.1 Screening of random ssDNA libraries, primers, and adapter sequences Table 1 DNA sequences

[0034] The DNA sequences in Table 1 show the random ssDNA library, primers, and aptamers used in the screening. The ssDNA library is 75 nt long, with fixed sequences of 18 and 17 nt at each end, and a random sequence of 40 nt in the middle. The aptamer sequences shown in the table are random sequences in the middle 40 nt. The random sequence determines the diversity of the random library.

[0035] 1.2 Preparation of experimental reagents (1) 1×TE: 10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 7.4. Accurately weigh 1.2 g Tris and 0.372 g EDTA.2Na, dissolve in 800 mL ultrapure water, carefully adjust the pH to 7.4 with 1 M HCl, dilute to 1 L in a volumetric flask, and sterilize until ready for use.

[0036] (2) 1×BB: Accurately weigh 6.05 g Tris, 0.375 g KCl, 5.84 g NaCl, and 0.20 g MgCl2, dissolve in 800 mL ultrapure water, carefully adjust the pH to 7.4 with 1 M HCl, dilute to 1 L in a volumetric flask, and sterilize for use.

[0037] (3) 1 M NaCl: Accurately weigh 5.84 g of NaCl and dissolve it in ultrapure water to a volume of 100 mL.

[0038] (4) Gelred staining solution: Measure 22.5 mL of ultrapure water, add 2.5 mL of NaCl, pipette and add 6 μL of Gelred nucleic acid dye, mix thoroughly and store in a dark place until ready to use.

[0039] (5) Graphene oxide dispersion: Accurately weigh 0.1 g of graphene oxide powder and dissolve it in 10 mL of ultrapure water to prepare a 10 mg / mL graphene oxide dispersion.

[0040] (6) 10% (W / V, g / mL) ammonium persulfate (APs): Accurately weigh 0.1 g of ammonium persulfate and dissolve it in 1 mL of deionized water. Dissolve it thoroughly and store at 4°C until use.

[0041] (7) 30% (W / V) N,N'-methylenebisacrylamide-acrylamide stock solution (Acr-Bis): Accurately weigh 290 g acrylamide and 10 g N,N'-methylenebisacrylamide, dissolve in ultrapure water, and dilute to 1 L with a volumetric flask. Store at 4°C until use.

[0042] (8) 3 M NaAc (pH 5.2): Accurately weigh 24.6 g of NaAc and dissolve it in 80 mL of ultrapure water. Add glacial acetic acid to adjust the pH to 5.2 and dilute to 100 mL in a volumetric flask.

[0043] 1.3 Screening Process 1.3.1 Pretreatment of random ssDNA libraries Take 20 μL of 100 μmol / L (2 nmol) random ssDNA library, add 500 μL of 1×BB buffer, mix well, and place it in a 95°C metal bath for 10 min. After taking it out, immediately place it in an ice box for an ice bath for 10 min. After the ice bath is completed, place it at room temperature for 10 min to allow the ssDNA in the library to fold into a complex tertiary structure.

[0044] 1.3.2 Screening of aptamers against transgenic soybean CP4 EPSPS protein using GO-SELEX The graphene oxide-based aptamer screening method (GO-SELEX) was used to screen aptamers for transgenic soybean CP4EPSPS protein.

[0045] This experiment primarily employed positive and negative screening methods. The first round of screening employed positive screening. To the pretreated random ssDNA library, 160 μL of CP4 EPSPS protein was added, followed by 1×BB to a 1 mL reaction system. The reaction was incubated at 37°C for 2 h. The three-dimensional structure formed by the ssDNA allowed the target protein to bind to form a complex. Then, 2 mL of a 10 mg / mL GO dispersion was added and incubated at 25°C for an additional 1.5 h. Free ssDNA was adsorbed onto the GO due to a stacking effect, while the CP4 EPSPS-bound mixture was not adsorbed by the GO. After incubation, the mixture was centrifuged at 12,000 rpm for 15 min, and the supernatant was collected for further processing.

[0046] In subsequent rounds of screening, secondary libraries prepared after each round are used for screening. The screening mode and conditions are adjusted appropriately to eliminate ssDNA sequences with weak binding to the target protein, thereby obtaining sequences with stronger binding. The entire screening process lasts for seven rounds (adjusted according to the protein type and the intermediate ssDNA concentration). Each round of screening conditions, including library loading and target protein loading, are optimized to achieve optimal screening results.

[0047] Positive screening: The random ssDNA library was incubated with the target protein at 37°C for 2 hours. Then, 2 mL of GO (graphene oxide) solution (10 mg / mL) was added and incubated at 25°C for 1.5 hours to remove ssDNA unbound to the target protein. After incubation, the mixture was centrifuged at 12,000 rpm for 15 minutes, and the GO precipitate was discarded. The supernatant was the incubation mixture of ssDNA and target protein.

[0048] Reverse screening: This involves screening with a mixture of other proteins (excluding the target protein) to enhance the specificity of the resulting aptamers. First, the random ssDNA library is incubated with the reverse screening protein at 37°C for 2 hours. GO solution is then added and incubated at 25°C for 1.5 hours. The mixture is then centrifuged at 12,000 rpm for 15 minutes. The supernatant is discarded, and the GO precipitate is redispersed in 1×BB buffer. The target protein is then added and incubated at 37°C for 2 hours. The ssDNA on the GO is again competed off. The mixture is then centrifuged and the GO precipitate is discarded. The supernatant is the reverse screening ssDNA and target protein mixture.

[0049] Table 2 GO-SELEX screening conditions

[0050] 1.4 Polymerase chain reaction (PCR) amplification of ssDNA In order to obtain the secondary library for GO-SELEX screening, the mixture of ssDNA and target protein at the end of each round of screening was used as a PCR amplification template and prepared with primers Primer-F: 5'-TACTAACGGTACAAGC TA-3' and Primer-RP: 5'-P-GCTTCTA GGTCAACGTT-3' to prepare a 50 μL reaction system for ssDNA PCR amplification.

[0051] Reaction system: Primer-F (10 μM) 2 μL, Primer-RP (10 μM) 2 μL, dNTP mixture 1 μL, 10× PCR Buffer 5 μL, Mg 2+ (25mM) 3μL, DNA template 5μL, H2O 31μL, Taq Plus DNA Polymerase 1μL.

[0052] Add the above reaction components according to the reaction volume, mix thoroughly, and place in a PCR instrument for amplification. First, perform a pre-denaturation at 95°C for 30 seconds, followed by denaturation at 95°C for 15 seconds, annealing at the optimal annealing temperature for 15 seconds, and extension at 72°C for 1 minute. Set multiple cycles of amplification. Finally, extend at 72°C for 5 minutes.

[0053] 1.4.1 Optimization of PCR annealing temperature Annealing temperature refers to the temperature parameter when the primer and template bind. It is the temperature when 50% of the primers and complementary sequences appear as double-stranded DNA molecules. It affects the specificity of PCR. Therefore, in order to achieve better PCR effects and obtain higher quality PCR products, the optimal annealing temperature must be optimized before PCR batch amplification. Set the same reaction system and the same number of cycles, but perform PCR amplification at different annealing temperatures.

[0054] 1.4.2 Optimization of the optimal number of PCR cycles The number of PCR cycles will also affect the amplification effect of PCR. Too many PCR cycles will produce nonspecific amplification, and too few PCR cycles will result in insufficient PCR products. Therefore, in order to achieve better PCR effects, it is necessary to optimize the number of PCR cycles, set the same reaction system and the same annealing temperature, and perform verification with different cycle numbers.

[0055] 1.4.3 Verification of PCR amplification products by agarose gel electrophoresis PCR amplification products can be detected using agarose gels. First, wash and air-dry the gel plate, place it in a gel tank, insert a sample comb, weigh 0.7 g of agarose, and dissolve it in 20 mL of 1× TAE. Heat in a microwave oven on medium-low heat for 1 min 40 s. Add 2 μL of dye, shake well, and quickly pour into the gel tank after all bubbles disappear. Ensure the tank is level before pouring to prevent the gel from tilting. While the gel solidifies, dilute the 50× TAE buffer 50-fold. Pour the diluted 1× TAE buffer into the electrophoresis tank, making sure not to exceed the top line. After the gel has solidified, carefully remove the sample comb and place the gel plate in the electrophoresis tank. Take 10 μL of the PCR amplification product and add 2 μL of 10× DNA Loading Buffer. Mix thoroughly by pipetting repeatedly. Carefully pipette 10 μL of the sample into the sample well. Simultaneously, add 10 μL of DNA marker to a control well. Also take 10 μL of the DNA marker into the well and add 2 μL of 10× DNA Loading Buffer. Mix thoroughly and then add 10 μL to the well. After adding the sample, set the voltage to 200 V and stop the electrophoresis when the band runs 2 / 3 of the way through the gel. After the electrophoresis is complete, remove the gel and place it in an imager for imaging and recording.

[0056] 1.5 Purification After determining the optimal PCR amplification annealing temperature and the optimal number of PCR cycles, batch amplification is performed. The amplified PCR products are then purified to remove primer dimers, excess dNTPs, excess primers, buffer, and enzymes. Purification can be performed using a kit or traditional purification methods. To improve PCR product recovery, this experiment used the traditional phenol / chloroform / isoamyl alcohol extraction and ethanol precipitation method.

[0057] The traditional purification steps are as follows: directly take an appropriate amount of PCR amplification product, add an equal volume of phenol:chloroform:isoamyl alcohol (V:V:V = 25:24:1) mixture, vortex and shake for 30 seconds, centrifuge at 13,000 rpm for 15 minutes, and transfer the supernatant. When aspirating the supernatant, be sure not to shake the centrifuge tube and aspirate slowly to avoid aspirating the intermediate layer, otherwise aspirating the intermediate layer may result in impure results. After the first transfer, repeat the above steps once; then add 1 / 10 volume of 3 mol / L sodium acetate (pH = 5.2) and 2.5 volumes of anhydrous ethanol, and incubate at -20°C overnight; centrifuge the overnight reaction system at 12,000 rpm for 15 minutes, discard the supernatant, add 1 mL of pre-cooled 70% ethanol, mix thoroughly, and centrifuge at 12,000 rpm for 15 minutes. Discard the supernatant, dry in a fume hood, and dissolve in sterile water for determination of double-stranded DNA (dsDNA) concentration.

[0058] The purified samples were detected by agarose gel. The agarose gel used and the operation steps were the same as those of the gel electrophoresis detection after PCR amplification.

[0059] 1.6 Enzyme Digestion (1) Take the PCR purified product with a concentration of 5 ng / μL, add 35 μL Lambda exonuclease reaction buffer, then add 1 μL Lambda exonuclease, and mix well (adjust according to the concentration of your own PCR product). (2) Place the mixed enzyme digestion reaction system in a 37℃ incubator for enzyme digestion for 30 min. (3) Quickly remove the enzyme digestion reaction system and place it on ice to prevent over-digestion. (4) Take 10 μL of the digestion product and verify whether the digestion is successful using an 8% denaturing PAGE gel containing 7 mol / L urea. (5) Place the digestion reaction system that has been verified to be successful in a 75℃ metal bath for 10 min to inactivate the Lambda exonuclease digestion reaction. (6) Add one-tenth volume of 3 M NaAc (pH 5.2) to the supernatant of the digestion reaction system, mix it upside down, add 2 times the volume of anhydrous ethanol, vortex and shake until fully mixed, and place the mixture in a -20℃ refrigerator overnight. (7) Pre-cool the centrifuge and centrifuge the mixed solution that has been left overnight at 4°C, 14,000 rpm for 15 min. (8) Carefully discard the supernatant and add 200 μL of 4°C pre-cooled 70% ethanol to the pellet and wash it by inverting. (9) Centrifuge at 4°C, 14,000 rpm for 15 min, discard the supernatant, and place the centrifuge tube in a 50°C oven until the ethanol is completely evaporated. (10) Add 40 μL of 1× TE buffer to the pellet to dissolve it and perform Nanodrop concentration analysis to obtain the secondary library.

[0060] 1.6.1 Verification of ssDNA by 8% denaturing PAGE containing 7 mol / L urea Use 8% denaturing PAGE gel containing 7 mol / L urea to verify whether the enzyme digestion is successful. The formula of 8% denaturing polyacrylamide gel is as follows: 2.52 g urea, 2 mL ultrapure water, 1.6 mL 30% Acr / Bis, 0.6 mL 10×TBE, 36 μL 10% APS, and 9 μL TEMED.

[0061] First, clean the two long and short glass plates and the sample comb required for preparing the 8% PAGE gel with clean water and blow dry to remove any surface water stains. Align the long and short glass plates flatly and secure them in a glass plate clamp, with the shorter plate in front and the longer plate in the back. After clamping, secure them on a gel-casting rack with a sponge pad. Ensure the plates are aligned correctly to prevent gel leakage or tilting. Once clamped, add 1 mL of water to the gel plate to check for leaks. Prepare the gel solution according to the 8% native polyacrylamide gel recipe and pour it evenly and smoothly into the watertight glass plate. Quickly insert the included sample comb to avoid creating bubbles and allow the gel to solidify. Pour an appropriate amount of 1× TBE buffer into the electrophoresis tank. Clamp the solidified gel plate onto the electrodes and place it in the tank. Carefully remove the sample comb to avoid damaging the sample wells. Take 10 μL of PCR amplification product and add 2 μL of 10× DNA Loading Buffer. Mix thoroughly by pipetting. Then, carefully pipette 10 μL of the mixed DNA sample into the sample well. Simultaneously, add a DNA marker and a random ssDNA library to two other wells as controls. Set the electrophoresis parameters to 180 V and stop the run when the band reaches the 2 / 3 mark. After the run, remove the gel from the plate and incubate in the prepared Gelred staining solution at room temperature for 40 minutes. After the incubation period, photograph the gel using an imager.

[0062] 1.7 Determining the number of GO-SELEX screening rounds After each round of screening, the nucleic acid concentration (ng / μL) of the supernatant was measured using an ultra-micro spectrophotometer and compared with the input amount of the current round to obtain the recovery rate of each round of screening, which was used as an indicator of the screening progress.

[0063] 1.8 High-throughput sequencing After determining the number of screening rounds, the library from the final round was used as a PCR template for PCR amplification using Primer-F and Primer-R. The PCR product was then sent to Shanghai Bioengineering for high-throughput sequencing. The sequencing results were analyzed using DNAMAN software, and appropriate aptamers were selected for subsequent experiments.

[0064] 1.9 Graphene Oxide Fluorescence Analysis Candidate CP4 EPSPS protein aptamers were selected and analyzed using graphene oxide fluorescence. Fluorescent aptamers were incubated with transgenic soybean CP4 EPSPS protein and the same concentrations of other proteins, including corn zein, pea protein (PP), and soy protein isolate (SPI), at 37°C for 2 h. GO dispersion was then added and incubated at 25°C for 1.5 h to completely quench the fluorescence of unbound aptamers. The mixture was centrifuged at 12,000 rpm for 15 min, the precipitate discarded, and the supernatant fluorescence intensity at 520 nm under 490 nm excitation was measured using a multifunctional microplate reader. The cells were kept in the dark throughout the experiment.

[0065] 2. Results and Discussion 2.1 Optimization of PCR amplification conditions The experiment uses the first round of screening products as a demonstration of PCR cycle number optimization. Since the amount of ssDNA library added in each round of screening is different, the PCR cycle number needs to be optimized before each subsequent round of PCR amplification. Set up the same PCR reaction system, set the PCR annealing temperature to (52℃, 53.6℃, ​​55.9℃, 58.8℃, 61.2℃) according to the Tm value of the primer, and compare the PCR cycle number of 25 cycles and 27 cycles. Amplification reaction is carried out in a PCR instrument, and the amplified product is verified by agarose gel electrophoresis. The gel running results are shown as follows: Figure 4 As shown: When the number of cycles is 25 and the annealing temperature is 61.2℃, the bands in other lanes are the clearest and brightest ( Figure 4 (a); When the number of cycles is 27, the bands in each lane are clear ( Figure 4 However, the brightness of the first lane was lower than that of the first lane at 25 cycles. Therefore, 61.2°C was selected as the annealing temperature for the first round of PCR amplification in GO-SELEX screening, and 25 cycles was the number of cycles for screening the first round of PCR amplification products.

[0066] The optimal number of PCR cycles in each round: first round: 25 cycles; second round: 27 cycles; third round: 27 cycles; fourth round: 28 cycles; fifth round: 30 cycles; sixth round: 29 cycles; seventh round: 28 cycles.

[0067] 2.2 PCR product purification The PCR products obtained under the above PCR conditions were purified using the traditional purification method of phenol / chloroform / isoamyl alcohol extraction and ethanol precipitation. After purification, the purified products were verified by agarose gel electrophoresis. Gel electrophoresis verified the purified products twice. Verification one by one can better verify the purification results of each time, whether they meet the enzyme digestion conditions and the influence of purification concentration on the bands. The results are as follows Figure 5 As shown in a: The purified band is clear and bright, and can be used for subsequent enzyme digestion experiments.

[0068] 2.3 Enzyme digestion of PCR products When the purified PCR amplification product is obtained, Lambda exonuclease is used to enzymatically cut the PCR-purified dsDNA with phosphate groups into single-stranded ssDNA to obtain a secondary library.

[0069] During the screening process, except for the first-round library, which is a random ssDNA library, subsequent secondary libraries are single-stranded libraries prepared after PCR amplification. The main methods for obtaining single-stranded libraries include asymmetric PCR, streptavidin method, and lambda exonuclease method. Asymmetric PCR method usually requires different ratios of F and R primers for amplification, which requires a large number of cycles, so there is a greater possibility of obtaining non-specific bands. The streptavidin magnetic bead method requires streptavidin-coated magnetic beads and biotin, and the materials required are relatively complex. Lambda exonuclease can act on double-stranded DNA, gradually cleaving off 5' single nucleotides in the 5'-3' direction. Its optimal substrate is 5'-phosphorylated double-stranded DNA. The enzymatic digestion method used in this experiment is lambda exonuclease.

[0070] After the enzyme digestion is completed, 8% denaturing PAGE gel containing 7 mol / L urea is used to verify whether the enzyme digestion is successful. The verification results are as follows: Figure 5 As shown in b: Lane 1 is the DNA Marker band, lanes 3, 4, 5, 7, 8, and 9 are the bands obtained by taking 10 μL of the enzyme digestion product, and lane 10 is the control ssDNA library. The product after enzyme digestion is consistent with the ssDNA library, indicating that the enzyme digestion was successful and single-stranded. The successful enzyme digestion product was purified with 3 M NaAc (pH 5.2) and anhydrous ethanol and used as the secondary library for the next round.

[0071] 2.4 Determining the number of GO-SELEX screening rounds After the screening is completed, the recovery rate is selected as the evaluation index of the screening process. The calculation formula of the recovery rate is shown in Formula 2-1:

[0072] This experiment used the GO-SELEX method to screen serum protein aptamers. A total of 7 rounds of screening were performed, and a round of reverse screening was performed in the 6th round. Through reverse screening, the specificity of the aptamer can be enhanced, thereby obtaining sequences with stronger specificity. Figure 6 As shown in the figure: with the increase in the number of screening rounds, the recovery rate gradually increased, and the enrichment of the screening products increased, indicating that the affinity of the nucleic acid aptamer to the target protein increased. In the 6th round, a reverse screening was performed, and non-target proteins were added to remove nucleic acid aptamers that can bind to other proteins to enhance the specificity of the nucleic acid aptamer. The recovery rate decreased. In the 7th round, positive screening was performed again, and the recovery rate increased and was similar to the recovery rates of the 4th and 5th rounds. The recovery rate tended to be stable, so the screening was stopped and the screening products of the 7th round were selected for the next experiment.

[0073] 2.5 Analysis of high-throughput sequencing results The secondary library obtained in round 7 was selected as a PCR template for PCR amplification using Primer-F and Primer-R. The PCR products were sent to Shanghai Bioengineering for high-throughput sequencing. Sequencing results revealed a total of 72,758 sequences, of which the top 29 sequences with the highest repeat counts were used for analysis. As shown in Table 3, the sequences in this table represent the 40-nt intermediate sequences after removing the fixed sequences at both ends. Sequencing results were analyzed for homology using DNAMAN software.

[0074] Table 3 Results of high-throughput sequencing of nucleic acid aptamers

[0075] 2.5.1 Homology Analysis of High-Throughput Sequencing Results DNAMAN software was used to analyze the homology of candidate aptamers. Figure 7 As shown in the figure: the homology of 29 nucleic acid aptamers was poor, and multiple aptamers with the same base sites were selected for homology analysis again. The results showed that the bases of the first three base sites of the seven candidate aptamers, seq-4, seq-5, seq-19, seq-20, seq-24, seq-25, and seq-28, were the same, and the bases of the first 8 base sites were basically the same, with a repetition rate of 53.66%. They have good homology and can be used as candidate aptamers for subsequent experiments.

[0076] 2.5.2 Secondary structure analysis of high-throughput sequencing results Gibbs free energy is an artificial thermodynamic function introduced to explore the direction (forward / reverse) and limits of thermodynamic processes. Binding capacity is determined by stability and structure, and stability is correlated with Gibbs free energy. Any reaction proceeds in the direction of decreasing Gibbs free energy. A lower Gibbs free energy indicates a more stable secondary structure, which contributes to the robustness of the target-aptamer complex. As shown in Table 4 below, the Gibbs free energy of the seven candidate aptamers selected above was calculated. Aptamers seq-19, seq-24, and seq-25 exhibited lower Gibbs free energies and demonstrated better stability, so these three aptamers were selected for subsequent experiments.

[0077] Table 4 Analysis of secondary structure of nucleic acid aptamers

[0078] 2.6 Detection of Aptamer Specificity by Graphene Oxide Fluorescence The three aptamers mentioned above were selected for verification. The aptamer labeled with a fluorescent group was synthesized by Shanghai Bioengineering. The specific candidate aptamer sequences are shown in Table 5 below: Table 5 Aptamer sequences

[0079] The aptamers with fluorescent groups were incubated with transgenic soybean CP4 EPSPS protein and other proteins with the same concentration except transgenic soybean CP4 EPSPS protein. CPS will bind to the aptamers with affinity. The combined complex will interfere with the adsorption of GO on the aptamers, while the GO dispersion will completely quench the fluorescence of the aptamers that are not bound to the protein. The results are shown in Figure 2. Figure 8The results show that the fluorescence intensity values ​​of the three candidate aptamers binding to CPS protein were higher than those of other proteins, indicating that all three candidate aptamers have good affinity for CPS protein. In aptamer seq-19, zein and soy protein isolate (SPI) had some effects. In aptamer seq-25, zein also had some effects, but the overall specificity was better than seq-19. Therefore, aptamer seq-25 was used as Capture aptamer 1 with the sequence 5'-CGGTCGTAGGGGAAGTTAATACAATTTCCCCGCAAAG GCC-3' and coupled to magnetic beads to construct MBs-Capture aptamer 1 for the separation and enrichment of transgenic proteins. The seq-24 aptamer has good binding affinity with the CPS protein and is less affected by other proteins, showing good specificity. Therefore, the seq-24 aptamer was selected as Aptamer 2 with the sequence 5'-CGGGCGCA CTGTGTCAATGATTGGTTAGCATCACAATGGG-3' to prepare quantum dots CdTe / CdS / ZnS quantum dots (QDs) (see Figure 9 ) and coupled with it to construct QDs-Aptamer 2.

[0080] A 12-nt-long ssDNA sequence complementary to the 5'-ACAGTGCGCCCG-3' was designed near the 5' end of Aptamer 2 as a probe. The 3' end was amino-modified and then connected with Alexa Fluor 555 dye to construct an Alexa Fluor 555 dye-probe. Finally, QDs-Aptamer 2 and Alexa Fluor 555 dye-probe were mixed and connected in a 1:1 ratio to construct a FRET reaction system.

[0081] 3. Summary The screening method used in this experiment was graphene oxide screening, a classic immobilization-free aptamer screening method. Seven rounds of screening were performed, with a counter-screening performed in the sixth round. After completion, the ssDNA library from the final round was sequenced using high-throughput sequencing, yielding 72,758 sequences. The top 29 sequences with the highest repeat counts were analyzed for homology and secondary structure, yielding three candidate aptamers. These three candidate aptamers were then analyzed using graphene oxide fluorescence, ultimately yielding two aptamers with high affinity and specificity. Their sequences are shown in SEQ ID Nos. 1 and 2, respectively. Using these two aptamers, Capture aptamer 1 and QDs-Aptamer 2 were constructed, respectively, and a FRET reaction system was ultimately established.

[0082] IV. Establishment and Evaluation of CP4 EPSPS Protein Detection Method MBs-Capture aptamer 1 is used to enrich and isolate the target CP4 EPSPS protein, which is then added to the FRET reaction system. The target protein "captured" by Aptamer 1 simultaneously binds to Aptamer 2, causing the Alexa Fluor 555 dye-probe bound to Aptamer 2 to dissociate and restore QDs fluorescence. Rapid detection and analysis are achieved by measuring the fluorescence value, which is positively correlated with the target concentration.

[0083] Zein, soy protein isolate (SPI) and pea protein (PP) were used for specific detection respectively. The results showed that the detection system has strong specificity for CP4 EPSPS protein. Figure 10 Non-GMO soybeans were ground into powder and spiked with CP4 EPSPS protein at concentrations of 1, 2, 4, 8, 16, 32, 64, 128, 256, and 512 ng / kg. The mixtures were homogenized and tested using the established detection system. The detection limit reached 2 ng / kg, with recoveries ranging from 88.34% to 112.12% and a precision of 5.18%, demonstrating good reproducibility.

[0084] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in transgenic soybeans, characterized by: The nucleotide sequences of the nucleic acid aptamers are shown in SEQ ID No. 1 and 2.

2. Use of the nucleic acid aptamer as claimed in claim 1 in detecting the transgenic component CP4-EPSPS protein in transgenic soybeans.

3. The use according to claim 2, characterized in that: The CP4-EPSPS protein detection method includes the following steps: S1, using magnetic bead-coupled nucleic acid aptamer Aptamer 1 to enrich and separate CP4 EPSPS protein in the sample; S2, the nucleic acid aptamer Aptamer 2 labeled with a fluorescent dye binds to the enriched CP4 EPSPS protein to form the MBs-Capture Aptamer 1-CP4 EPSPS protein-Aptamer 2 complex; S3, detect and analyze the fluorescence signal intensity and quantitatively detect the CP4 EPSPS protein; Aptamer 1 and Aptamer 2 are nucleic acid aptamers, and the nucleotide sequences are shown in SEQ ID No. 1 and 2.

4. A kit for detecting CP4-EPSPS protein in genetically modified soybeans, characterized in that: The invention comprises the nucleic acid aptamer according to claim 1.

5. The kit according to claim 4, wherein: Also included are magnetic beads and fluorescent dyes.

Images